ID: 927786631

View in Genome Browser
Species Human (GRCh38)
Location 2:25979411-25979433
Sequence CTTGCTGCTCAGATTAATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927786630_927786631 -1 Left 927786630 2:25979389-25979411 CCTCGGGGCAGGGGTCGGTTGGC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 927786631 2:25979411-25979433 CTTGCTGCTCAGATTAATATAGG 0: 1
1: 0
2: 0
3: 3
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927786631 Original CRISPR CTTGCTGCTCAGATTAATAT AGG Intronic
901172726 1:7273294-7273316 CTTGTTGCTATGATTAATAATGG - Intronic
903263067 1:22141874-22141896 CATGCTTTTCAGATCAATATTGG + Intronic
903456687 1:23492282-23492304 CTTGCTGCTCAGTTGAGAATAGG - Intergenic
907564735 1:55424235-55424257 CTTTCTGCTCAGATTCTTCTTGG - Intergenic
908134068 1:61110814-61110836 CTTCCTGCCAAGATTAAAATTGG + Intronic
910090530 1:83457908-83457930 CTTACTGCACAGATGACTATAGG - Intergenic
912642133 1:111357213-111357235 CTTGTTGCTCAGAAAAATTTAGG - Intergenic
1063866427 10:10369864-10369886 CTTGCTGCTAAGAGAAATACAGG + Intergenic
1066500133 10:35984833-35984855 CTTGCTACACAAATTAATTTGGG + Intergenic
1067600750 10:47595734-47595756 CGTGATGCTCCAATTAATATTGG - Intergenic
1068238186 10:54265744-54265766 CTTGGTGCTCCAATTAATGTTGG - Intronic
1070015436 10:72525006-72525028 TTTGCCACTCATATTAATATAGG + Intronic
1070994093 10:80760547-80760569 GTTGATGCTCACATTAAAATTGG - Intergenic
1071129487 10:82374726-82374748 CTTGCTGCTCAGCTCACAATAGG + Intronic
1075564981 10:123496690-123496712 CTTGCTGCTGAGATTCAGAGAGG + Intergenic
1079635511 11:22734761-22734783 CTTGCTGGTCATATTATTTTGGG - Intronic
1084753732 11:71221741-71221763 CTTGCTGCTCAGAAAAAAACTGG - Intronic
1089412998 11:118262832-118262854 CTTGCTGCTAAGAAAAATACTGG + Intronic
1093623762 12:21322781-21322803 CTTGCTTTTCAGGTTAATTTTGG + Intronic
1094743559 12:33316684-33316706 CTTGCTGCTTACAGTAAAATGGG - Intergenic
1094783830 12:33822479-33822501 TTTGCTGAAGAGATTAATATTGG - Intergenic
1098284453 12:68893633-68893655 TTTGCAGTTCAGTTTAATATGGG + Intronic
1099128616 12:78798067-78798089 CTTGCTTCTCAAATGTATATAGG - Intergenic
1100861024 12:98807219-98807241 CATGCAGCTCAGAGTAAAATGGG + Intronic
1104003239 12:124873797-124873819 CTTCCTGCTCAGACTACTACAGG + Intronic
1107351725 13:39521800-39521822 CTTGCTTTGCAGATTATTATTGG + Intronic
1107848265 13:44542346-44542368 GATCTTGCTCAGATTAATATTGG + Intronic
1108289317 13:48942515-48942537 TTTGCTGTTCAAATTATTATAGG + Intergenic
1112926733 13:104684836-104684858 TGTGCTTCTCAAATTAATATAGG + Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1114385065 14:22245799-22245821 CTTTCTGCTTATATAAATATAGG + Intergenic
1114794696 14:25700331-25700353 GTTGCTGCTCAGCTGAAAATAGG - Intergenic
1115295291 14:31819065-31819087 CTTTCTGCTGATACTAATATTGG + Intronic
1116420297 14:44724341-44724363 CTTGCTGCTTATAGTAAAATAGG - Intergenic
1116968904 14:51044347-51044369 ATTGCTGCTTGGAATAATATAGG - Intronic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1123791180 15:23722061-23722083 GATTTTGCTCAGATTAATATAGG + Intergenic
1126912874 15:53433714-53433736 CTGGTTGCTTAGATTTATATTGG - Intergenic
1127277385 15:57459279-57459301 TTTGATGCATAGATTAATATTGG - Intronic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1136740846 16:32524005-32524027 CTTGCTTCTCAGCTTCATCTTGG + Intergenic
1137705400 16:50532245-50532267 CGTTCTGCTCAGTTGAATATGGG - Intergenic
1138880271 16:61005703-61005725 CTTCCTGCACAGAATTATATTGG - Intergenic
1141287102 16:82682753-82682775 CTTGCTTCTGAGAAAAATATTGG + Intronic
1203028756 16_KI270728v1_random:551228-551250 CTTGCTTCTCAGCTTCATCTTGG - Intergenic
1203042965 16_KI270728v1_random:783203-783225 CTTGCTTCTCAGCTTCATCTTGG + Intergenic
1150428395 17:65095510-65095532 CTTGCTACTCAGATTGAAGTTGG + Intergenic
1152098901 17:78289474-78289496 CCTGCTGCTCAGATGAATGAAGG + Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1156248946 18:35332328-35332350 GTTTCTGTTCTGATTAATATAGG - Exonic
1156300871 18:35834788-35834810 CTTGCTCCTCTGTTTACTATTGG + Intergenic
1164438364 19:28251890-28251912 CATGCTGTTCAGATTAACTTGGG + Intergenic
925110378 2:1330480-1330502 CTTGCTGCACAGATTACAAAAGG - Intronic
925635656 2:5939046-5939068 TTTGCTGCTGAAATCAATATTGG - Intergenic
927786631 2:25979411-25979433 CTTGCTGCTCAGATTAATATAGG + Intronic
928615349 2:33032928-33032950 CTTTATGTTCAGATTAATTTAGG + Intronic
930923215 2:56783041-56783063 CTTGCTGGTCATTTTAAGATTGG + Intergenic
932315461 2:70778980-70779002 CTTGCTTTTCAGATTATCATAGG - Intronic
933551916 2:83788845-83788867 GTTGCTTCTCAGTTTAATTTTGG - Intergenic
937782240 2:125852145-125852167 CTTGCTGCAAAGATTACTTTTGG - Intergenic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
944275751 2:197835554-197835576 CATGCTGCTCCTATTAATAGTGG - Intronic
1172156606 20:32830205-32830227 CTTTCTCCTCAGCTTAATGTGGG + Intronic
1175065469 20:56282705-56282727 GCTGCTGCTGAGTTTAATATGGG - Intergenic
1175065471 20:56282731-56282753 CTGGCTGCTGAGTTTAATATGGG - Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1177274872 21:18897032-18897054 CTTGGTGCTTTGATGAATATTGG - Intergenic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1183695006 22:39416704-39416726 GCTGCTGCTCTGATTAATAGAGG + Intronic
1184550339 22:45201024-45201046 CCTGCTCCTCAGATTATTGTTGG - Intronic
949140636 3:628554-628576 TTTGCTAATGAGATTAATATGGG - Intergenic
951593006 3:24286799-24286821 CTTGCTCCTCAGAGAAATAAAGG - Intronic
953700076 3:45188857-45188879 CTTGCTTCTCAGAATAGTTTAGG - Intergenic
955097949 3:55818543-55818565 CCTTCTGCTCAGATGAATCTAGG + Intronic
955105307 3:55892106-55892128 CTTGCTTATCAGATGATTATGGG + Intronic
955896953 3:63710537-63710559 CTTGTTGCTTAGATTATTCTAGG - Intergenic
956811145 3:72865264-72865286 TGTACTGCACAGATTAATATTGG + Intergenic
959993452 3:112654443-112654465 CTTCCTTCTCAAAATAATATGGG - Intergenic
964230345 3:154459291-154459313 CTCGTTTCTCAGATTAATAAAGG - Intergenic
965084030 3:164071043-164071065 TTTTCTGCTCAGAATAATATTGG - Intergenic
965281718 3:166763687-166763709 TTTGCTCCTCAGGTTTATATAGG + Intergenic
965314254 3:167171550-167171572 CTTGGTGTTCAGATTTTTATTGG + Intergenic
965327780 3:167329092-167329114 CATGCTCCTCAGATTAATGATGG + Intronic
971313351 4:25545993-25546015 CTTGGTGCTCAGATTTATGCTGG + Intergenic
973651540 4:53001902-53001924 CTTACTACTTAGATTAATTTGGG - Intronic
976419436 4:84823035-84823057 CTTTCTTCTCAGAATCATATTGG - Intronic
984958446 4:185069577-185069599 CTTGCTGCTCAGTGCCATATGGG - Intergenic
987614650 5:20257403-20257425 TTTTCTGCTAAGGTTAATATAGG + Intronic
987712666 5:21522158-21522180 CTTACTGATTTGATTAATATGGG - Intergenic
988156596 5:27459823-27459845 CTTTCTACTCAGAATAATACAGG + Intergenic
988301712 5:29438335-29438357 CTTACTGATTTGATTAATATGGG + Intergenic
989434650 5:41397248-41397270 CTTGCTGCTCTGTGTAGTATTGG + Intronic
990715341 5:58630074-58630096 CTTGCTGCTCTTATTAAAGTTGG - Intronic
990997665 5:61748789-61748811 CATGCTGCTGAGATTTATTTTGG + Intronic
991763028 5:69941305-69941327 CTTACTGATTTGATTAATATGGG - Intergenic
991784298 5:70176824-70176846 CTTACTGATTTGATTAATATGGG + Intergenic
991842255 5:70816345-70816367 CTTACTGATTTGATTAATATGGG - Intergenic
991876745 5:71177208-71177230 CTTACTGATTTGATTAATATGGG + Intergenic
992066703 5:73116192-73116214 CTGGGTGCTAAGATTAATTTGGG + Intergenic
992123451 5:73617490-73617512 ATTGCTGCTCCTATTAATACAGG - Intergenic
994819699 5:104633536-104633558 CTTGCTTATCTGATGAATATAGG + Intergenic
996147586 5:119994713-119994735 CTTGCTGTTGAGAATAATCTTGG + Intergenic
996164420 5:120207407-120207429 CTTGGTGATCAGAATTATATTGG + Intergenic
998398800 5:141836717-141836739 CTTGCTGCTTTGAGTAATCTGGG - Intergenic
998550331 5:143071148-143071170 TTTGCTATTCAGATTAATTTAGG - Intronic
998981513 5:147708350-147708372 CTTCCAGTTCAGATTTATATGGG - Intronic
1000716763 5:164653637-164653659 CTAGGTGCCCAGATTAATAATGG + Intergenic
1002463965 5:179394746-179394768 GTTGCTGCTCAGCTTGATACAGG - Intergenic
1005156700 6:22814891-22814913 CTTTTTGCTCAGGATAATATTGG + Intergenic
1009004987 6:57774233-57774255 CTTACTGATTTGATTAATATGGG + Intergenic
1016514017 6:144873683-144873705 CTTACTGCTCAGAGTCATGTGGG + Intergenic
1016707313 6:147125001-147125023 CTTTTTGCTCAGATTAACTTTGG + Intergenic
1021524949 7:21576603-21576625 CTTGCTTCTCAGAATATTTTAGG + Intronic
1026404038 7:70045924-70045946 CTTGCAACTCACATTATTATTGG + Intronic
1027307380 7:76914369-76914391 CTTACTGCACAGATGACTATAGG - Intergenic
1032001556 7:128268575-128268597 CTTGCTGCTGAGTTTCCTATGGG + Intergenic
1036072801 8:5460593-5460615 TTTGTTGCTCAAATTAATTTCGG - Intergenic
1039685293 8:39795259-39795281 CTTGTTTTTCAGATTAATTTTGG - Intronic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1040823345 8:51590066-51590088 CTTGCTGCTCAGAGCCACATTGG + Intronic
1043186442 8:77157605-77157627 CTTGCTCCTTAGATTATTTTGGG - Intergenic
1048941609 8:139405142-139405164 CTTGCTTCTCATCTGAATATCGG - Intergenic
1050493937 9:6219425-6219447 CATGCTGCTCATGTTATTATCGG + Intronic
1050613228 9:7374820-7374842 ATTGCTGCTGAGATAAAAATGGG + Intergenic
1051815013 9:21095022-21095044 CCTGCTGTTCAGATTATTCTTGG - Intergenic
1054999443 9:71432156-71432178 CTCACTGCTCACATTAATACAGG + Intronic
1058348384 9:103991832-103991854 CTTGCTGCTCATGTTACTACTGG - Intergenic
1059948511 9:119437854-119437876 GTTGCCGATCAGCTTAATATAGG - Intergenic
1060724545 9:125998259-125998281 CTTGCTGCTCAGAGCAACACTGG - Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1186628829 X:11326007-11326029 CTTGTTGCACAGATTAAACTGGG - Intronic
1187905679 X:24064068-24064090 CTTGTTGCTGACATTTATATGGG + Intronic
1190666513 X:52701069-52701091 TTTGCTGCCTAGATTAATTTCGG - Intronic
1190672905 X:52757341-52757363 TTTGCTGCCTAGATTAATTTCGG + Intronic
1191174988 X:57489827-57489849 TTTGTTGCTCAGATTAATGTTGG - Intergenic
1194495037 X:94604357-94604379 ATTAGTGGTCAGATTAATATAGG + Intergenic
1198915474 X:141666427-141666449 CTTGCTGCTAAGAATATTCTTGG + Intronic
1199048504 X:143206645-143206667 CATGCTACTCAAATAAATATTGG - Intergenic
1200942706 Y:8802558-8802580 CTTGCTGCTAAGAATATTCTTGG + Intergenic