ID: 927788593

View in Genome Browser
Species Human (GRCh38)
Location 2:25992002-25992024
Sequence CCATTAGGTTCTCAGTAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927788593_927788602 29 Left 927788593 2:25992002-25992024 CCCCTTTACTGAGAACCTAATGG No data
Right 927788602 2:25992054-25992076 ACATTCACTTACCTGGTAAGTGG No data
927788593_927788601 22 Left 927788593 2:25992002-25992024 CCCCTTTACTGAGAACCTAATGG No data
Right 927788601 2:25992047-25992069 AATCTTCACATTCACTTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927788593 Original CRISPR CCATTAGGTTCTCAGTAAAG GGG (reversed) Intergenic