ID: 927788595

View in Genome Browser
Species Human (GRCh38)
Location 2:25992003-25992025
Sequence CCCATTAGGTTCTCAGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927788595_927788601 21 Left 927788595 2:25992003-25992025 CCCTTTACTGAGAACCTAATGGG No data
Right 927788601 2:25992047-25992069 AATCTTCACATTCACTTACCTGG No data
927788595_927788602 28 Left 927788595 2:25992003-25992025 CCCTTTACTGAGAACCTAATGGG No data
Right 927788602 2:25992054-25992076 ACATTCACTTACCTGGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927788595 Original CRISPR CCCATTAGGTTCTCAGTAAA GGG (reversed) Intergenic
No off target data available for this crispr