ID: 927788597

View in Genome Browser
Species Human (GRCh38)
Location 2:25992004-25992026
Sequence ACCCATTAGGTTCTCAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927788597_927788602 27 Left 927788597 2:25992004-25992026 CCTTTACTGAGAACCTAATGGGT No data
Right 927788602 2:25992054-25992076 ACATTCACTTACCTGGTAAGTGG No data
927788597_927788601 20 Left 927788597 2:25992004-25992026 CCTTTACTGAGAACCTAATGGGT No data
Right 927788601 2:25992047-25992069 AATCTTCACATTCACTTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927788597 Original CRISPR ACCCATTAGGTTCTCAGTAA AGG (reversed) Intergenic