ID: 927788600

View in Genome Browser
Species Human (GRCh38)
Location 2:25992017-25992039
Sequence ACATCTGTGACCCACCCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927788600_927788601 7 Left 927788600 2:25992017-25992039 CCTAATGGGTGGGTCACAGATGT No data
Right 927788601 2:25992047-25992069 AATCTTCACATTCACTTACCTGG No data
927788600_927788602 14 Left 927788600 2:25992017-25992039 CCTAATGGGTGGGTCACAGATGT No data
Right 927788602 2:25992054-25992076 ACATTCACTTACCTGGTAAGTGG No data
927788600_927788603 23 Left 927788600 2:25992017-25992039 CCTAATGGGTGGGTCACAGATGT No data
Right 927788603 2:25992063-25992085 TACCTGGTAAGTGGCTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927788600 Original CRISPR ACATCTGTGACCCACCCATT AGG (reversed) Intergenic
No off target data available for this crispr