ID: 927788601

View in Genome Browser
Species Human (GRCh38)
Location 2:25992047-25992069
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927788600_927788601 7 Left 927788600 2:25992017-25992039 CCTAATGGGTGGGTCACAGATGT No data
Right 927788601 2:25992047-25992069 AATCTTCACATTCACTTACCTGG No data
927788595_927788601 21 Left 927788595 2:25992003-25992025 CCCTTTACTGAGAACCTAATGGG No data
Right 927788601 2:25992047-25992069 AATCTTCACATTCACTTACCTGG No data
927788597_927788601 20 Left 927788597 2:25992004-25992026 CCTTTACTGAGAACCTAATGGGT No data
Right 927788601 2:25992047-25992069 AATCTTCACATTCACTTACCTGG No data
927788593_927788601 22 Left 927788593 2:25992002-25992024 CCCCTTTACTGAGAACCTAATGG No data
Right 927788601 2:25992047-25992069 AATCTTCACATTCACTTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type