ID: 927788602

View in Genome Browser
Species Human (GRCh38)
Location 2:25992054-25992076
Sequence ACATTCACTTACCTGGTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927788597_927788602 27 Left 927788597 2:25992004-25992026 CCTTTACTGAGAACCTAATGGGT No data
Right 927788602 2:25992054-25992076 ACATTCACTTACCTGGTAAGTGG No data
927788593_927788602 29 Left 927788593 2:25992002-25992024 CCCCTTTACTGAGAACCTAATGG No data
Right 927788602 2:25992054-25992076 ACATTCACTTACCTGGTAAGTGG No data
927788600_927788602 14 Left 927788600 2:25992017-25992039 CCTAATGGGTGGGTCACAGATGT No data
Right 927788602 2:25992054-25992076 ACATTCACTTACCTGGTAAGTGG No data
927788595_927788602 28 Left 927788595 2:25992003-25992025 CCCTTTACTGAGAACCTAATGGG No data
Right 927788602 2:25992054-25992076 ACATTCACTTACCTGGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927788602 Original CRISPR ACATTCACTTACCTGGTAAG TGG Intergenic
No off target data available for this crispr