ID: 927789670

View in Genome Browser
Species Human (GRCh38)
Location 2:26000535-26000557
Sequence AATCTAAACAGAACAACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927789663_927789670 17 Left 927789663 2:26000495-26000517 CCCCTAAAGGAGATCCTGTCTGT No data
Right 927789670 2:26000535-26000557 AATCTAAACAGAACAACAGCTGG No data
927789662_927789670 18 Left 927789662 2:26000494-26000516 CCCCCTAAAGGAGATCCTGTCTG No data
Right 927789670 2:26000535-26000557 AATCTAAACAGAACAACAGCTGG No data
927789664_927789670 16 Left 927789664 2:26000496-26000518 CCCTAAAGGAGATCCTGTCTGTG No data
Right 927789670 2:26000535-26000557 AATCTAAACAGAACAACAGCTGG No data
927789665_927789670 15 Left 927789665 2:26000497-26000519 CCTAAAGGAGATCCTGTCTGTGG No data
Right 927789670 2:26000535-26000557 AATCTAAACAGAACAACAGCTGG No data
927789669_927789670 3 Left 927789669 2:26000509-26000531 CCTGTCTGTGGGCTCTGAAGGTT No data
Right 927789670 2:26000535-26000557 AATCTAAACAGAACAACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927789670 Original CRISPR AATCTAAACAGAACAACAGC TGG Intergenic
No off target data available for this crispr