ID: 927794155

View in Genome Browser
Species Human (GRCh38)
Location 2:26033884-26033906
Sequence GGCCACAGGGAGCGCGCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927794144_927794155 17 Left 927794144 2:26033844-26033866 CCCCCGGGGCGTGCTCGTAACGC No data
Right 927794155 2:26033884-26033906 GGCCACAGGGAGCGCGCCCGCGG No data
927794145_927794155 16 Left 927794145 2:26033845-26033867 CCCCGGGGCGTGCTCGTAACGCC No data
Right 927794155 2:26033884-26033906 GGCCACAGGGAGCGCGCCCGCGG No data
927794147_927794155 14 Left 927794147 2:26033847-26033869 CCGGGGCGTGCTCGTAACGCCGC No data
Right 927794155 2:26033884-26033906 GGCCACAGGGAGCGCGCCCGCGG No data
927794146_927794155 15 Left 927794146 2:26033846-26033868 CCCGGGGCGTGCTCGTAACGCCG No data
Right 927794155 2:26033884-26033906 GGCCACAGGGAGCGCGCCCGCGG No data
927794150_927794155 -5 Left 927794150 2:26033866-26033888 CCGCGCACCCTATCAGGCGGCCA No data
Right 927794155 2:26033884-26033906 GGCCACAGGGAGCGCGCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927794155 Original CRISPR GGCCACAGGGAGCGCGCCCG CGG Intergenic