ID: 927795287

View in Genome Browser
Species Human (GRCh38)
Location 2:26042690-26042712
Sequence GCATATATACTAAAATTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 9, 2: 16, 3: 25, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927795285_927795287 -3 Left 927795285 2:26042670-26042692 CCAGAGTGCTTGTCTCGGTAGCA 0: 1
1: 0
2: 0
3: 8
4: 58
Right 927795287 2:26042690-26042712 GCATATATACTAAAATTGGAAGG 0: 1
1: 9
2: 16
3: 25
4: 202
927795284_927795287 1 Left 927795284 2:26042666-26042688 CCATCCAGAGTGCTTGTCTCGGT 0: 1
1: 0
2: 2
3: 7
4: 74
Right 927795287 2:26042690-26042712 GCATATATACTAAAATTGGAAGG 0: 1
1: 9
2: 16
3: 25
4: 202
927795280_927795287 11 Left 927795280 2:26042656-26042678 CCCCAAAAGACCATCCAGAGTGC 0: 1
1: 0
2: 1
3: 10
4: 122
Right 927795287 2:26042690-26042712 GCATATATACTAAAATTGGAAGG 0: 1
1: 9
2: 16
3: 25
4: 202
927795281_927795287 10 Left 927795281 2:26042657-26042679 CCCAAAAGACCATCCAGAGTGCT 0: 1
1: 0
2: 0
3: 13
4: 127
Right 927795287 2:26042690-26042712 GCATATATACTAAAATTGGAAGG 0: 1
1: 9
2: 16
3: 25
4: 202
927795282_927795287 9 Left 927795282 2:26042658-26042680 CCAAAAGACCATCCAGAGTGCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 927795287 2:26042690-26042712 GCATATATACTAAAATTGGAAGG 0: 1
1: 9
2: 16
3: 25
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927795287 Original CRISPR GCATATATACTAAAATTGGA AGG Intronic
904893037 1:33793573-33793595 GCATAAATTCTAATTTTGGAGGG - Intronic
906758316 1:48344224-48344246 GTACATATACTAACATTGGAAGG + Intronic
906820839 1:48928369-48928391 GAATACATACTAAAATTGGGGGG - Intronic
906889615 1:49694572-49694594 GCATATTTATTAAAGTTGAAGGG - Intronic
908508838 1:64834085-64834107 GTATAGATACTGAAATTTGAGGG + Exonic
911643212 1:100311162-100311184 GAATATTTTCTAAAAATGGAGGG + Intergenic
911718856 1:101167739-101167761 GCATTTGAACTAAAATTTGAAGG - Intergenic
913571723 1:120126989-120127011 GCACATATGCTAAAATTGGAAGG + Intergenic
913611117 1:120510647-120510669 GCAAATATACTCAAATTGCCAGG + Intergenic
913967294 1:143387452-143387474 GCATATATACTAAAAAACAAAGG + Intergenic
914061673 1:144213059-144213081 GCATATATACTAAAAAACAAAGG + Intergenic
914117477 1:144753310-144753332 GCATATATACTAAAAAACAAAGG - Intergenic
914292643 1:146288611-146288633 GCACATATGCTAAAATTGGAAGG + Intergenic
914382655 1:147131744-147131766 GAAAATATTCTAAAATTAGATGG - Intergenic
914408297 1:147399908-147399930 ACATATATGCTAAAATTTTATGG - Intergenic
914553687 1:148739394-148739416 GCACATATGCTAAAATTGGAAGG + Intergenic
914580073 1:149011592-149011614 GCAAATATACTCAAATTGCCAGG - Intronic
916456868 1:164980100-164980122 GCACATATACTAAAATTGGAAGG - Intergenic
917024022 1:170621857-170621879 GCAGATATATTAATATTTGAAGG + Intergenic
917314676 1:173711902-173711924 ACAGATATACAAAAATAGGAGGG + Intergenic
919051892 1:192521896-192521918 ACATTTATGCCAAAATTGGAAGG + Intergenic
919396204 1:197051648-197051670 GCATATATACCTATATAGGATGG - Intronic
921039722 1:211417963-211417985 GCATTTATAATAAACTTGGTAGG - Intergenic
923655792 1:235915430-235915452 GCACATATACTAAAATTGGAAGG + Intergenic
924371251 1:243352767-243352789 GCATATGTACAAAAAGTGGAAGG - Intronic
1063013272 10:2048188-2048210 GCATATATACTCATATTATATGG + Intergenic
1065725919 10:28667934-28667956 GCACATATGCTAAAATTGGAAGG + Intergenic
1066597760 10:37070701-37070723 GCATGTAGACTAAGGTTGGAAGG - Intergenic
1066986186 10:42469456-42469478 GCACATATACTAAAACTGGTTGG + Intergenic
1067394825 10:45905425-45905447 AAATATATAATAAAATTGGCCGG + Intergenic
1067863147 10:49874556-49874578 AAATATATAATAAAATTGGCCGG + Intronic
1068021167 10:51586315-51586337 GCATATGGATTAGAATTGGAAGG + Intronic
1069033049 10:63618150-63618172 GCATAAATACTTAAATTGTCAGG - Intronic
1070207873 10:74282404-74282426 GCATATGGATTAAAATTGCATGG + Intronic
1071194957 10:83147924-83147946 TGATACATACTAAAATTGGTGGG + Intergenic
1071295983 10:84220101-84220123 GCAGATATTTTAAAATTAGATGG - Intergenic
1071686065 10:87758491-87758513 GCAAATAGACTAAACTTGGCTGG + Intronic
1072598523 10:96900017-96900039 GGAAATATTCTAAAATTAGATGG - Intronic
1073966809 10:108999919-108999941 ACAGATTTACTGAAATTGGAAGG - Intergenic
1074845435 10:117393234-117393256 GAATATATACTTACATTGTAAGG - Intergenic
1078312925 11:10264436-10264458 GCAATTATACTAAGATGGGATGG - Intronic
1079483656 11:20910934-20910956 GCTTAAATACTAAAAAGGGATGG - Intronic
1079737754 11:24018410-24018432 GCATATAAACATACATTGGATGG + Intergenic
1080158414 11:29141396-29141418 ACATATTTACTAAAAGAGGAGGG + Intergenic
1080254764 11:30277714-30277736 GCATATATACTCAAAATGGTAGG - Intergenic
1082282889 11:50289346-50289368 ACATATATACTAAAATTGGGGGG + Intergenic
1083564661 11:63703436-63703458 ACACATATACTAAAACTGGAGGG - Intronic
1085062001 11:73455699-73455721 GAGTATATAACAAAATTGGAAGG + Intronic
1085681499 11:78579319-78579341 GCATATATACTAAAATTGAAAGG - Intergenic
1086018022 11:82191181-82191203 TCATATATTCTAATATTGTATGG - Intergenic
1087149037 11:94841767-94841789 GCATATGTAATAAACTTGGGTGG + Intronic
1088095301 11:106093003-106093025 GCATCTATACTAATATTCAAAGG + Intronic
1088137849 11:106578812-106578834 GCATTTATACAAAAATAGGCTGG - Intergenic
1088442743 11:109889536-109889558 GCACATATACTAAAATTGAAAGG - Intergenic
1089041623 11:115456323-115456345 GCATATAAAGTAAAATTAGGAGG + Intronic
1090552121 11:127831915-127831937 GCATATATATTAAAAGTATAGGG + Intergenic
1092284067 12:7118800-7118822 GCACATATACTCAAATTGGAAGG + Intergenic
1094114153 12:26892049-26892071 GCATAAATACAAAATTTGTATGG + Intergenic
1095043811 12:37475934-37475956 GAACATATATTAAAATTGGAAGG + Intergenic
1095579906 12:43785537-43785559 ACATAGATATAAAAATTGGAAGG + Intronic
1095606280 12:44071423-44071445 GCATAAATAATAAAATTAAAGGG + Intronic
1097997255 12:65901977-65901999 TCAAATATAATAAAAATGGATGG + Intronic
1098552839 12:71782913-71782935 GCATAAGTATTAAAAGTGGAAGG + Intronic
1099468873 12:83021905-83021927 GCATATACACTAAAAGGGAAAGG + Intronic
1099787267 12:87282274-87282296 GCAAATATTCTAAAATCTGAAGG + Intergenic
1100969616 12:100053668-100053690 GCATATACACCAAAAGTTGACGG + Intronic
1101281447 12:103261318-103261340 GTATATATACAAAAATTAGCTGG + Intronic
1102047453 12:109838669-109838691 GCAAATATTCTAAAATTGACTGG + Intergenic
1104800325 12:131550933-131550955 GAATAAATACAAAAATTAGATGG - Intergenic
1105500013 13:20963728-20963750 GCAAATATTCTAAAATTGGGGGG + Intergenic
1105937011 13:25110663-25110685 ACATATATTTTAAAATTGGGAGG + Intergenic
1107356564 13:39573757-39573779 TCATAAATATTAATATTGGAAGG - Intronic
1108166553 13:47699355-47699377 CTATATTTACTAAAACTGGAGGG + Intergenic
1108618185 13:52156440-52156462 GCATTTATACAAAAAAGGGAGGG - Intronic
1108780363 13:53823104-53823126 GGAAACATACTAAAATTCGATGG + Intergenic
1109288402 13:60440517-60440539 GCATAGATACAAAAATTAGCTGG + Intronic
1109531697 13:63657802-63657824 ACAAATATACTATAAATGGAAGG + Intergenic
1110934294 13:81265762-81265784 GCACATATACTAAAATTGGAAGG + Intergenic
1112567585 13:100564558-100564580 GAATGTGTACTAAACTTGGAAGG - Intronic
1113831906 13:113302344-113302366 AAATATATACAAAAATTAGACGG - Intronic
1114176575 14:20325910-20325932 ACATATATACTAAAATACTAGGG - Intronic
1114263038 14:21052783-21052805 GCATGTATAATAATGTTGGATGG - Intronic
1116088363 14:40271116-40271138 GTATATATACAAAAATTAGCTGG + Intergenic
1118196409 14:63630693-63630715 GCACACATACTAAAATCAGAAGG + Intronic
1202942345 14_KI270725v1_random:163568-163590 GAACAAATATTAAAATTGGAAGG + Intergenic
1123796538 15:23777506-23777528 GGATATATATTAAAATTGGAAGG - Intergenic
1126291075 15:47079936-47079958 GAACAAATATTAAAATTGGAAGG - Intergenic
1126544831 15:49862025-49862047 GCATCTATACTAAATGTGGATGG - Intronic
1129067189 15:72915264-72915286 ACATATATACAAAAATTAGCTGG + Intergenic
1129931644 15:79415976-79415998 GCATATGAACAAGAATTGGAAGG - Intronic
1136505657 16:30701398-30701420 ACACATATACTAAAACTGGGAGG - Intronic
1137894815 16:52199848-52199870 ACAGATATATTAAAATGGGAGGG - Intergenic
1138326256 16:56172175-56172197 GAACATATACTAAAATTTGCAGG - Intergenic
1139600144 16:67981587-67981609 GCAAATATACAAAAATTAGCTGG - Intergenic
1139680927 16:68562104-68562126 ACATACATACTAAAAGTGTAGGG - Intronic
1143928659 17:10397236-10397258 ACATATATACAAAAATTAGCTGG - Intronic
1144166387 17:12615220-12615242 TCACATATACCAGAATTGGAGGG - Intergenic
1146067209 17:29645535-29645557 GAATAAATACTAAAATTGGCAGG + Intronic
1150740282 17:67773993-67774015 GCATATATATAAAAATTAGCTGG - Intergenic
1151026743 17:70685870-70685892 GCTTATTTTCTACAATTGGATGG - Intergenic
1155055630 18:22180181-22180203 ACACATATACTAAAATTGGAAGG - Intronic
1155188527 18:23409270-23409292 GCATATAGACAATGATTGGAAGG - Intronic
1155405529 18:25482937-25482959 ACATTTATACTAAATTTGGGTGG + Intergenic
1155523792 18:26696177-26696199 GCATAGATACAAAAAAGGGAGGG + Intergenic
1156820659 18:41368771-41368793 GGATATATATTAAAAATGCATGG - Intergenic
1157658541 18:49417532-49417554 GCATATATACCAAAATTAATTGG - Intronic
1158665171 18:59426148-59426170 GCATAGATTAGAAAATTGGATGG + Intergenic
1158922342 18:62207035-62207057 GTAAATATACTAAAAATGAATGG - Intronic
1159430376 18:68344549-68344571 TCAGTTATACTAAAAGTGGATGG - Intergenic
1162002512 19:7755750-7755772 ACATATAGACTAAAAGTGAAAGG - Intergenic
1163997581 19:21066193-21066215 GCATAGTTACTAAAGTTAGATGG + Intergenic
1165534651 19:36433283-36433305 GGATAATTTCTAAAATTGGATGG + Intergenic
1202701080 1_KI270712v1_random:164946-164968 GCATATATACTAAAAAACAAAGG + Intergenic
927795287 2:26042690-26042712 GCATATATACTAAAATTGGAAGG + Intronic
928040953 2:27876818-27876840 GCATATATAATAAAAATTGCAGG + Intronic
928553833 2:32401595-32401617 TCAGATATACCAAAATTGGAAGG + Exonic
931863256 2:66380020-66380042 GCATATATAGTAAAAAGCGAAGG - Intergenic
934172007 2:89548422-89548444 GCATATATACTAAAAAACAAAGG + Intergenic
934282315 2:91622739-91622761 GCATATATACTAAAAAACAAAGG + Intergenic
935094204 2:99928236-99928258 GCAGATGTACTAATATGGGAAGG + Intronic
935680275 2:105629965-105629987 GCATACACACTAAAAAGGGATGG + Intergenic
936256113 2:110914053-110914075 GAAAATATTCTAAAATTAGATGG + Intronic
937035747 2:118780357-118780379 GCACTTATACCAAAATTGAAGGG - Intergenic
939308641 2:140442984-140443006 TGAAAAATACTAAAATTGGAAGG + Intronic
939331879 2:140773833-140773855 GAAAATATAGTAAAATTGAAAGG + Intronic
939463174 2:142524100-142524122 GCATTTATACCAGAAATGGATGG - Intergenic
939618210 2:144384913-144384935 CCTAATATACTAAAATGGGAAGG - Intergenic
940589595 2:155704504-155704526 ACTTAAATACTAAATTTGGAAGG - Intergenic
941701273 2:168606459-168606481 GCAAATATACTAAAACAGGAAGG - Intronic
942243201 2:173983109-173983131 GCATTTACACTGAAACTGGATGG - Intergenic
942253954 2:174073149-174073171 ACATATATACAAAAATTAGCTGG - Exonic
944396327 2:199271755-199271777 ATATATATATTAAAATTGCATGG - Exonic
944603928 2:201332408-201332430 GCAAAAATACAAAAATTGGTTGG - Intronic
945918160 2:215726412-215726434 CCATCTATACTAGAAATGGAGGG + Intergenic
946480749 2:220054071-220054093 GCCAATATACTAAAATTGCAGGG - Intergenic
946635276 2:221718289-221718311 GCATATATACTGCAATAGCAGGG - Intergenic
947044175 2:225959656-225959678 ACATAAATATTAAAATTGAATGG + Intergenic
947413482 2:229868497-229868519 GTATTTATACTAGAATTGGTTGG - Intronic
947870095 2:233430518-233430540 GCATGTATCTTAAAAATGGAAGG + Intronic
1168746003 20:241199-241221 GGATATATACAAAAATTTAATGG - Intergenic
1169158979 20:3360051-3360073 GCACATATACTAAAATTGGAAGG + Intronic
1170244918 20:14209866-14209888 GAATATATACTGTATTTGGATGG + Intronic
1171538272 20:25918660-25918682 GAACAAATATTAAAATTGGAAGG + Intergenic
1171841219 20:30213966-30213988 GAACAAATATTAAAATTGGAAGG + Intergenic
1172224891 20:33299057-33299079 GCACATGTACTAAAATCGGAAGG - Intronic
1172877247 20:38172190-38172212 GAAAACATTCTAAAATTGGATGG + Intergenic
1176580825 21:8523359-8523381 GAACAAATATTAAAATTGGAAGG - Intergenic
1176886357 21:14260025-14260047 GCCTATATATTGAAACTGGATGG + Intergenic
1177533986 21:22400785-22400807 GAATATATTCCAAAATTGTATGG + Intergenic
1178526487 21:33333954-33333976 ACATATAAACTGAAATTGAAGGG + Intronic
1178785506 21:35649617-35649639 GCAAAAACACTAAATTTGGAGGG + Intronic
1183803447 22:40187786-40187808 GCATATTTACTAAATATGGGTGG + Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
953456694 3:43047966-43047988 GCACATAACCTAAAATTGGCAGG + Intronic
954891079 3:53928990-53929012 GCATATAGGCTAAAATGTGAAGG - Intergenic
956184076 3:66545749-66545771 GTATATATACTTAAAATGGGAGG - Intergenic
956247493 3:67200081-67200103 GCATATCAACTAAAATGTGAAGG + Intergenic
957288573 3:78248344-78248366 ACATATATTCTAAAATTGTATGG + Intergenic
958561538 3:95754156-95754178 ACATATAGACTAAAAGTGAAGGG + Intergenic
958592284 3:96173379-96173401 ATATATATTCTAAAATTGTATGG + Intergenic
958827182 3:99044746-99044768 GGATTTATACTAAAAATGCAAGG + Intergenic
959164086 3:102755133-102755155 GCAGATATACTAAAATTGGAAGG - Intergenic
959180001 3:102966882-102966904 ACAAATATACAAAGATTGGAAGG - Intergenic
959931646 3:111990379-111990401 ACATATAGACAAATATTGGAAGG + Intronic
963253817 3:143124457-143124479 AAATAAATACTAATATTGGATGG + Intergenic
963374260 3:144443509-144443531 GCATCTAAACTAAAATTTTATGG + Intergenic
964519606 3:157550012-157550034 ACATATATACTGAAAGTGAAGGG - Intronic
964629995 3:158800192-158800214 GTATATATATTAAAACTGGCCGG - Intronic
964818341 3:160741307-160741329 GCATGTATAAGAGAATTGGATGG - Intergenic
967791657 3:193556047-193556069 GCATATACACTAAATTTGGAAGG + Intronic
969027744 4:4187453-4187475 GCATATATACTAAAAAACAAAGG - Intergenic
971131632 4:23817528-23817550 GCATATACACTTAAAATTGATGG + Intronic
971640914 4:29131716-29131738 GAATTTAGACTAAAATTGTACGG + Intergenic
972846307 4:42994968-42994990 GCATGTATATACAAATTGGAAGG - Intronic
974521400 4:62985828-62985850 GTAAATATACTAATATTGGGGGG - Intergenic
975422977 4:74191060-74191082 GTAAAAATACTAAAATTAGATGG - Intronic
975756392 4:77575863-77575885 ACATATATTCCAAAATTGTATGG + Intronic
976345075 4:83990979-83991001 ACATATTGACTAAATTTGGAAGG + Intergenic
977547901 4:98407126-98407148 GCATATTCACACAAATTGGAAGG - Intronic
979748938 4:124252043-124252065 GTAGAAATACAAAAATTGGATGG + Intergenic
982044200 4:151425886-151425908 ACACATATACTAAAATTGGAGGG + Intronic
984232941 4:177121228-177121250 ACATTTATACTAAAAATGGAGGG + Intergenic
984984119 4:185310845-185310867 GCATTTATAATAAACTTGGTAGG - Intronic
987841950 5:23233577-23233599 ATATATATTCTAAAATTGTATGG - Intergenic
988564393 5:32309677-32309699 TCACATATACTAAAATTGGAAGG + Intronic
988660923 5:33267562-33267584 GAATCTGAACTAAAATTGGATGG + Intergenic
989524476 5:42437707-42437729 ACATATATACAAAAATTAGCTGG - Intronic
989975115 5:50576214-50576236 GCACATACACTAAAATTAAAGGG - Intergenic
990671340 5:58133429-58133451 GCATATGCAGTAAAAGTGGAAGG - Intergenic
991131950 5:63132655-63132677 GCATCTATACTAAAAATTCAGGG - Intergenic
991226220 5:64276133-64276155 GCATAAATAATAGATTTGGAAGG - Intronic
993252356 5:85545076-85545098 TCATGTATACTAAAATGGGATGG + Intergenic
995865971 5:116691372-116691394 GTATATATACTAAAATAGAATGG - Intergenic
996786501 5:127242393-127242415 GTATATATAATGAAATTGCAGGG + Intergenic
998472282 5:142392450-142392472 GTATTTTTACTAAAAATGGAGGG + Intergenic
998570459 5:143252221-143252243 ACATATATACTAAGAATGGTTGG + Intergenic
999104383 5:149057623-149057645 GCATGTATGCTAAAATCGGAAGG - Intronic
999305098 5:150514397-150514419 GCATATCTACAAAAATTAGCCGG + Intronic
999934190 5:156467690-156467712 ACACATATAATTAAATTGGAAGG + Intronic
1000358797 5:160428146-160428168 GCATATATAATAAACTTGCTTGG + Intronic
1000461950 5:161533908-161533930 GAAAATAGACTAAAACTGGAAGG + Intronic
1000500991 5:162049628-162049650 GCATATATATTTAAATTTCATGG - Intergenic
1005154578 6:22789943-22789965 GTATTTCTACTAAAATAGGATGG - Intergenic
1005334922 6:24786561-24786583 CCATATATACTAAGTTTTGAAGG + Intergenic
1007925426 6:45646119-45646141 GCACATATACTAAAATTGGAAGG + Intronic
1008009346 6:46447110-46447132 ACATATATACTAAAAGGGAAGGG + Intronic
1009726892 6:67546666-67546688 ACATACATACTAAAATTGGACGG + Intergenic
1010430019 6:75768121-75768143 GCACATATACTAAAATTGGAAGG - Intronic
1012487753 6:99741148-99741170 GGATCTTTACTAAATTTGGAGGG - Intergenic
1012822704 6:104107166-104107188 GCATAAATGCAAAAATAGGATGG + Intergenic
1017285515 6:152670894-152670916 CAATATATACTAAATCTGGAGGG + Intergenic
1017368921 6:153681462-153681484 GCACATATACTAAAATTGGAAGG + Intergenic
1018412261 6:163562578-163562600 GCATAAAAACAAAAATAGGACGG - Intronic
1021209584 7:17830918-17830940 GCATTTAGAGTAAATTTGGAAGG - Intronic
1021471365 7:21005717-21005739 ACATATAGACTAAAAGTGAAGGG + Intergenic
1023006665 7:35877440-35877462 ACATATATATTAAAACTGGGGGG - Intronic
1024067542 7:45753536-45753558 ACATATATATTAAAATTGGGGGG + Intergenic
1024236705 7:47404064-47404086 GCAGATATTCTAAAATCTGAAGG - Intronic
1025153578 7:56582275-56582297 ACATATAGACTAAAAGTGAAGGG - Intergenic
1025289729 7:57705493-57705515 GAACAAATACTAAAATTGGAAGG + Intergenic
1026114768 7:67486932-67486954 GCATATATACAAAAATTAGTGGG - Intergenic
1027837054 7:83257655-83257677 TCAAATCTACTAAAATAGGAGGG - Intergenic
1030281914 7:107784995-107785017 GCAAATAGACTATAACTGGAAGG - Intronic
1031046176 7:116890612-116890634 ACATATATACAAAAATTAGCAGG + Intronic
1031345369 7:120659133-120659155 GCAAATATACTACCAATGGAGGG + Intronic
1031421577 7:121558181-121558203 GGATGTATGCTAAAATTGAAAGG - Intergenic
1033146623 7:138876428-138876450 GCATATAGACTAAAATTGAAAGG - Intronic
1033412790 7:141134797-141134819 ACATATAGACTAAAAGTGGAGGG + Intronic
1038958259 8:32490409-32490431 GCATCAATTCTAAAACTGGAGGG - Intronic
1041497364 8:58501966-58501988 GCAAATATACAAAAATGGAAAGG + Intergenic
1042842762 8:73140780-73140802 GCAGATAAACTAATCTTGGAAGG - Intergenic
1044437016 8:92176487-92176509 GCATATAGACTATAAATGGATGG + Intergenic
1045564687 8:103301111-103301133 GTATATATATTAAATTTGTAGGG - Intronic
1046880639 8:119303395-119303417 ACATATAAACTAACAGTGGATGG + Intergenic
1051901422 9:22046541-22046563 GCATCTGTACTAGAATTGAAAGG + Intergenic
1055304311 9:74913035-74913057 ACATATAGACTGAAAGTGGAGGG + Intergenic
1056038931 9:82639768-82639790 GCATATAGACTGAAAGTGAAGGG + Intergenic
1057902260 9:98958625-98958647 GCTCATATACTAAAAGGGGAGGG - Intronic
1058235215 9:102481614-102481636 GCATATATTAGAAAAGTGGAAGG + Intergenic
1059796939 9:117708065-117708087 GCACATACACTAAAATTGGAAGG - Intronic
1185914100 X:4016092-4016114 GCAAATAAACTAAAAGTGCATGG + Intergenic
1187622372 X:21072006-21072028 GTATATATGCTAAATTTGCAAGG - Intergenic
1187634722 X:21214652-21214674 GCACATATACTATAACTGGAAGG + Intergenic
1190343068 X:49312706-49312728 GAAAATATATTAAAAATGGATGG + Intronic
1193375018 X:80749332-80749354 GCATATATAATAAAAACTGAAGG - Intronic
1195205220 X:102592722-102592744 GCAAATATACAAAAACTGGCCGG - Intergenic
1195798707 X:108682398-108682420 GGGTATATACCAAAATGGGATGG + Intronic
1196334870 X:114520577-114520599 ACATATATACTAAATATGAAGGG + Intergenic
1196484916 X:116195654-116195676 GCACATATAATAATATTGGCTGG + Intergenic
1198010207 X:132544824-132544846 GGATTTATAATAAAATTGAAGGG + Intergenic
1198755937 X:139982601-139982623 ACATATATACAAAAATTAGCCGG - Intergenic
1199149468 X:144413518-144413540 ACATATATACTAAAAATAAAGGG - Intergenic
1199437304 X:147827294-147827316 GCATATATACTAAAATGGAATGG + Intergenic