ID: 927798967

View in Genome Browser
Species Human (GRCh38)
Location 2:26079275-26079297
Sequence GCTCCTACCCCCACTCCGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927798967 Original CRISPR GCTCCTACCCCCACTCCGTG AGG (reversed) Intronic
900559419 1:3296388-3296410 TCTCCTTCCTCCACTCTGTGCGG + Intronic
902814501 1:18908466-18908488 GCTTCGAACCCCACTCCGAGGGG + Exonic
903336518 1:22627857-22627879 GCTATTACCCCCGCTCCCTGTGG - Intergenic
905535419 1:38717803-38717825 GGTCCCAGCCCCACTCAGTGAGG + Intergenic
915561712 1:156691806-156691828 GCTCCCACCCCCGCTGCTTGAGG - Intergenic
916920215 1:169458515-169458537 GTGCCTACCCCAACTCCATGGGG - Intronic
920171259 1:204073643-204073665 GCTCCTGCTCCTCCTCCGTGCGG - Exonic
923942696 1:238845006-238845028 GCTCTTCCTTCCACTCCGTGGGG + Intergenic
924493995 1:244568683-244568705 GCTCCTACCCCCACCAAGTTCGG + Intronic
1067549923 10:47227074-47227096 ACTCCTGCCCCCACTCCATCAGG + Intergenic
1068936198 10:62638011-62638033 TCTCCTCCCCCCACCCCATGTGG + Intronic
1070858674 10:79630219-79630241 GCTCCTACTCCCCCTCCTGGAGG - Intergenic
1072692122 10:97578644-97578666 GTTGCCACCCCCACTCCGTTCGG + Intronic
1072770622 10:98134599-98134621 GCTCCGCCCCCAACGCCGTGGGG - Intergenic
1073414190 10:103367921-103367943 GCTCCTCCCCGCCCTCCATGTGG + Intergenic
1075244718 10:120810851-120810873 GCTCTTTCCCCCACTCTATGTGG + Intergenic
1076014349 10:127015639-127015661 CCTCCTACCCCAACTCCCCGTGG + Intronic
1076250242 10:128979310-128979332 GCCCCTCCCCACACTCCATGTGG + Intergenic
1076335833 10:129705937-129705959 GCTCCAACCCCAGCTCTGTGCGG - Intronic
1076519299 10:131070759-131070781 GCTCCAACCAGCACTGCGTGGGG - Intergenic
1080963160 11:37183868-37183890 GCTGCTATCCCCACTCCCAGAGG + Intergenic
1092840948 12:12540710-12540732 TCTCCTACCCCAACTCCTTAGGG + Intronic
1094048691 12:26195777-26195799 CCTCCTCCCCGCACTCCTTGGGG - Exonic
1095825222 12:46524114-46524136 GCTCCCAGCCCCACCCTGTGAGG - Intergenic
1097187293 12:57202635-57202657 GCTCCTGCCCCCACCCTGGGAGG - Intronic
1103833337 12:123798367-123798389 GCTCCTGCTCCCACTGTGTGAGG - Intronic
1107545302 13:41428498-41428520 GCTCCCGCCCCCATACCGTGTGG + Intergenic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1122480631 14:102044872-102044894 GCTCCTAGCTCCACTCCGAGGGG + Intronic
1122551979 14:102555307-102555329 GGTCCTGCCCCCGCCCCGTGGGG + Intergenic
1122688441 14:103520846-103520868 GCTCCTACCCCCACTGTGGGGGG - Intronic
1122778986 14:104135765-104135787 GCCCCGACCCCGACTCCCTGAGG - Intergenic
1122899610 14:104776925-104776947 GGTCCTAGCCCCACTCTGTGAGG - Intronic
1125416193 15:39455578-39455600 GATCATACGCCCACTCAGTGGGG - Intergenic
1126841488 15:52721461-52721483 GCTCCAAACCCAACTCCTTGAGG + Intergenic
1129456832 15:75680567-75680589 GCTCCCACTCCCACTCCTGGGGG - Intronic
1132690010 16:1178077-1178099 TCTCCTGCCCCCTCTCCCTGGGG + Intronic
1133051228 16:3118601-3118623 GCTCCTACACCCACACCTGGAGG - Intronic
1136598023 16:31265387-31265409 GCTCCAACCACCACCCTGTGGGG - Exonic
1138451392 16:57095135-57095157 GATCCCACCTCCACTCCCTGAGG - Intronic
1139340773 16:66266730-66266752 GACCCCACCCCCACCCCGTGAGG + Intergenic
1142004883 16:87684966-87684988 GCTCCTAACCCCATTCTCTGGGG - Intronic
1142218109 16:88839736-88839758 GCTCCTGCTCCCACTCCTTGGGG + Intronic
1142251874 16:88995723-88995745 GCGGCCACCCCCACTCAGTGGGG + Intergenic
1143201822 17:5118556-5118578 GCCCCTAGCCCCATTGCGTGGGG + Intronic
1144171885 17:12665997-12666019 GCGCCTCCCCCCTCGCCGTGCGG - Exonic
1146786155 17:35723404-35723426 GCTTCTACCTCCATTCCATGTGG - Intronic
1151854175 17:76709969-76709991 CCTCCTACCCCCACTCCCCCGGG - Intronic
1152660525 17:81539938-81539960 GCTCCTACCCGCACTCATCGCGG + Exonic
1152694630 17:81737953-81737975 GCTCCCACCCACACTCCAGGTGG - Intergenic
1160152197 18:76403963-76403985 GCACCGACCACCACTCCCTGTGG + Intronic
1160216354 18:76935852-76935874 GCTCCCACCAGCACTCTGTGCGG + Intronic
1161850896 19:6737516-6737538 GCCGCTGCCCCCACTCCGCGGGG + Exonic
1161851812 19:6741033-6741055 GGTCCAGCCCCCACTGCGTGTGG - Exonic
1163527430 19:17830280-17830302 GCCCCTACCCCCACCACGGGTGG - Intronic
1165745851 19:38229267-38229289 ACCCCTACCCCCACTCTGGGTGG + Intronic
1166654905 19:44603877-44603899 GCTCCTAACCTCACTCCTTGTGG - Intergenic
925456475 2:4020781-4020803 GCTCATCCCCCCACTCCCTTCGG + Intergenic
927798967 2:26079275-26079297 GCTCCTACCCCCACTCCGTGAGG - Intronic
930611841 2:53553532-53553554 GCTCATAGCCCTACTCCATGTGG - Intronic
933984082 2:87576080-87576102 GCTCCAACTCCCACACTGTGAGG + Intergenic
936278751 2:111120848-111120870 GCTCCTACGCCCAATCACTGCGG - Intronic
941175593 2:162194310-162194332 CCCCCTACCCCCAATCCCTGAGG + Intronic
946408888 2:219506822-219506844 GCTCCTACCCACTCCCCTTGAGG + Exonic
948264143 2:236625225-236625247 GCTCCTGGCCCCATTCCATGAGG - Intergenic
948464345 2:238145047-238145069 GCAACTCCCCGCACTCCGTGGGG + Intronic
948788072 2:240363378-240363400 TCTCCTACCCCCACACCCAGAGG - Intergenic
1171767333 20:29297459-29297481 GTTCCTGCCCCCACAGCGTGGGG + Intergenic
1173960041 20:47063814-47063836 GCTGCTCCCACCACTCTGTGGGG + Intronic
1174343581 20:49913692-49913714 TCTCCTAGCCCCATTCGGTGTGG - Exonic
1179894014 21:44351346-44351368 GCCCCAACCCACACTCCCTGGGG + Intronic
1179928183 21:44550078-44550100 GCTTCTACCCACAGTGCGTGGGG + Intronic
1180879827 22:19195890-19195912 GCTCCCACCCCCACTTCCTGTGG - Intronic
1181456957 22:23065221-23065243 CCTTCTTCCCCCACTCCCTGAGG + Intronic
1182431813 22:30303446-30303468 GCACTTACCACCACTTCGTGGGG + Intronic
1184789408 22:46690098-46690120 GCTTCTTCCCCCCCTCCTTGAGG + Exonic
952015986 3:28958551-28958573 GCTCCTGCCCCAACTCCGAAGGG - Intergenic
954615678 3:51967690-51967712 GCCCCTACCCCCAACCCGTGGGG - Intronic
968385891 4:137099-137121 GCTCCTGCTCCCACTATGTGAGG + Intronic
968483433 4:847436-847458 GCTCCCACCCAGACTGCGTGAGG + Intergenic
968908785 4:3466320-3466342 GCTCCTGCGCCGTCTCCGTGGGG - Intronic
975948562 4:79739381-79739403 GCTCCTACCCTCCCTTAGTGAGG - Intergenic
983205130 4:164903160-164903182 GTCCCTAACCCCACTCAGTGAGG - Intergenic
985666770 5:1185015-1185037 GCTCCTCCCCCAACTCCCAGAGG + Intergenic
985754026 5:1702479-1702501 GCTCCCACCCCCACACAGAGAGG - Intergenic
988800560 5:34692656-34692678 TCTCCTACCTCCACCCAGTGGGG - Intronic
989667141 5:43867597-43867619 GCTCCTAATCCCACTCCAGGAGG - Intergenic
992171166 5:74103450-74103472 GCGCCTACTCCCACCCTGTGGGG + Intergenic
992529301 5:77639368-77639390 GCTCGAACCCACACTCCGCGAGG - Exonic
997525179 5:134548414-134548436 GCCCCTCCACCCACTCTGTGAGG - Intronic
999030368 5:148284007-148284029 GCTGCTAACACCATTCCGTGAGG - Intronic
1003958056 6:11184189-11184211 GCTACTACCCCCATTACCTGAGG - Exonic
1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG + Intronic
1006335781 6:33419977-33419999 GCCCCCACCCCTACTCCGGGAGG - Intergenic
1008765707 6:54911399-54911421 GCTCCTAACCCCACTTCCTGAGG - Intronic
1016753035 6:147651920-147651942 ACTCCGACCCCCACTCTGTGCGG - Intronic
1017759170 6:157554968-157554990 GCTCCCACTCCCACTTCGGGTGG - Intronic
1022501895 7:30887130-30887152 TCAGCTACCCCCACTCCCTGCGG + Intronic
1024003767 7:45210429-45210451 CCTCCTAGACCCACTCAGTGAGG + Intergenic
1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG + Intronic
1029482675 7:100822692-100822714 GCTGCTGTCCCCACTCCCTGAGG + Intronic
1034679651 7:152918981-152919003 GCCTCCACCCCCACTCCGGGTGG - Intergenic
1034872556 7:154696833-154696855 GCTCCTAACTCCACTCTGGGTGG - Intronic
1040554770 8:48468965-48468987 GCTCCTAGCCCCAGTCATTGAGG + Intergenic
1041124093 8:54617666-54617688 ACTCCTACCCCCAATCCCTGAGG + Intronic
1042365959 8:67936638-67936660 CCTCCCAGCCCCACTCTGTGAGG - Intergenic
1045111065 8:98940124-98940146 GCTCCTACCCCCTCGGCGTGCGG + Intronic
1060059264 9:120444462-120444484 TCTCCTACCCCCAGTGCATGAGG + Intronic
1060188763 9:121579318-121579340 TCTCCTACCCCCCCACCCTGAGG + Intronic
1062136016 9:134928930-134928952 GTTCCAACCCCCACTCCGGAGGG - Intergenic
1062560021 9:137137373-137137395 CCACCCACCCCCACCCCGTGGGG - Intergenic
1185810982 X:3110211-3110233 GCTCCTACCTGCACGCCGTGCGG + Exonic
1190152435 X:47959193-47959215 GCTCCCACCTCCTCTCTGTGAGG + Intronic
1190730350 X:53221759-53221781 GCACTTACCCCCACCCCCTGGGG - Intronic
1190862957 X:54360841-54360863 CCTCCTACCCCCACTCCTGTGGG - Intergenic
1193311104 X:80011807-80011829 GCTCCTGCCCCAAGTCCCTGCGG - Intergenic
1194558808 X:95395636-95395658 GCTCCTGCCCTCACTAAGTGAGG + Intergenic