ID: 927803832

View in Genome Browser
Species Human (GRCh38)
Location 2:26126907-26126929
Sequence TACTATTTCCTCCCTAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927803832_927803837 20 Left 927803832 2:26126907-26126929 CCTCCTTTAGGGAGGAAATAGTA 0: 1
1: 0
2: 0
3: 15
4: 174
Right 927803837 2:26126950-26126972 GGAATTGCGTTTCTTTTGCTAGG 0: 1
1: 0
2: 1
3: 12
4: 216
927803832_927803836 -1 Left 927803832 2:26126907-26126929 CCTCCTTTAGGGAGGAAATAGTA 0: 1
1: 0
2: 0
3: 15
4: 174
Right 927803836 2:26126929-26126951 ATTTGACATGGATATGTCTTGGG 0: 1
1: 0
2: 4
3: 28
4: 327
927803832_927803835 -2 Left 927803832 2:26126907-26126929 CCTCCTTTAGGGAGGAAATAGTA 0: 1
1: 0
2: 0
3: 15
4: 174
Right 927803835 2:26126928-26126950 TATTTGACATGGATATGTCTTGG 0: 1
1: 0
2: 1
3: 22
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927803832 Original CRISPR TACTATTTCCTCCCTAAAGG AGG (reversed) Intronic
905312899 1:37062770-37062792 AGCTCTTTTCTCCCTAAAGGAGG - Intergenic
907928757 1:58979405-58979427 TTGAATTTCCTCCTTAAAGGAGG + Intergenic
908681866 1:66670842-66670864 TACAATTTCCTACTTAAATGCGG + Intronic
909706703 1:78593949-78593971 GATTAATTCCTACCTAAAGGAGG + Intergenic
910339836 1:86173433-86173455 TACTGTTTTCTCCCTAAATCTGG + Intergenic
911800919 1:102136673-102136695 TCTTCTTTCTTCCCTAAAGGGGG - Intergenic
913675193 1:121133631-121133653 TACAATTTCTTGACTAAAGGAGG - Intergenic
914027031 1:143921251-143921273 TACAATTTCTTGACTAAAGGAGG - Intergenic
914432194 1:147628979-147629001 TACTTCTTCCTCCCTTAAAGAGG - Intergenic
916264212 1:162874155-162874177 TACTTTTTCCTCCATAAGGGTGG - Intergenic
918828646 1:189361763-189361785 TACTATTTCCACTGTAAAGATGG - Intergenic
920281395 1:204846392-204846414 TATTATTTCCTCCATAAAGATGG + Intronic
920406330 1:205715343-205715365 TTGCATTACCTCCCTAAAGGAGG + Exonic
920462555 1:206152469-206152491 TACAATTTCTTGACTAAAGGAGG - Intergenic
921077005 1:211707763-211707785 AGCTTTTTCCTCCCTAAACGGGG + Intergenic
921517016 1:216106471-216106493 TACTATTTCCTCTATTAATGTGG + Intronic
921535546 1:216344987-216345009 AGCTTTTTCCTCCCAAAAGGGGG + Intronic
922077493 1:222262130-222262152 TAGTATTGCCTCACTCAAGGTGG + Intergenic
1062881048 10:978072-978094 TACTGTTTCCAGCCTAGAGGTGG - Intergenic
1067823187 10:49549097-49549119 AGCTTTTTCCTCCCCAAAGGGGG - Intergenic
1068805060 10:61186004-61186026 TACTTTGTCCTCTCTAAAGCAGG - Intergenic
1070715510 10:78718119-78718141 TTCACTTTCCTCCCCAAAGGTGG - Intergenic
1071393415 10:85197953-85197975 TCCTATTTCCTCCTTCCAGGTGG - Intergenic
1072175185 10:92913586-92913608 TGCTTTTTCCTCCCAAAAGCGGG + Intronic
1074812057 10:117114549-117114571 TACTATGGCCTCCTCAAAGGAGG + Intronic
1075066768 10:119294111-119294133 TACGCTTTCCTCCCTGCAGGAGG - Intronic
1077777690 11:5289600-5289622 AAATATTTCCTCCAGAAAGGGGG + Intronic
1078381509 11:10846279-10846301 TTCTAAATACTCCCTAAAGGAGG + Intronic
1079451154 11:20600900-20600922 TAATATTCCCTCCCTAGTGGAGG - Intronic
1086299396 11:85409383-85409405 CAGTTTTTCCTCCCTAAAAGGGG + Intronic
1087227182 11:95614361-95614383 AACTTTTCCCTCCCTAAAAGGGG - Intergenic
1087236355 11:95723293-95723315 TAGATTTTCCACCCTAAAGGAGG + Intergenic
1095602495 12:44029438-44029460 AACTTTTTCCTCCCTAAATGGGG + Intronic
1095799466 12:46257147-46257169 TGCTTTTTCCTCCCTAAAAGGGG - Intronic
1096106705 12:49000204-49000226 TACTCTGTCCTCCATAAAGCTGG - Intergenic
1098044240 12:66383486-66383508 TACTTATTCCTCCCCATAGGAGG + Intronic
1101042920 12:100775232-100775254 TATTTTTTCATCCCCAAAGGAGG + Intronic
1101780158 12:107828055-107828077 AACTTTTTTCTACCTAAAGGAGG - Intergenic
1110560068 13:76901739-76901761 TATTATTTTCTCCTCAAAGGAGG + Intergenic
1112485101 13:99812603-99812625 TTCTATGACCTCCCTATAGGAGG + Intronic
1113523924 13:110959125-110959147 GGCTTTTTGCTCCCTAAAGGGGG + Intergenic
1114391575 14:22314627-22314649 TACTTTTTTCCCCCTACAGGAGG + Intergenic
1115397818 14:32929058-32929080 AACTATTGACTCACTAAAGGAGG + Intergenic
1116969282 14:51048011-51048033 TACTTTTACATACCTAAAGGAGG - Intronic
1119989022 14:79173858-79173880 TTTTATTTCCTGCCTTAAGGTGG - Intronic
1120127898 14:80768540-80768562 TACTATTTCCTCCAAAAGAGGGG + Intronic
1122174263 14:99905580-99905602 AACTTTTTCCTCCCCAAAAGGGG - Intronic
1202889313 14_KI270722v1_random:140846-140868 TCCTTTTTCCTTCCCAAAGGTGG + Intergenic
1124920575 15:34022387-34022409 TATTTTTTCCTCCCTAATGTTGG - Intronic
1127933437 15:63613092-63613114 TTCTATTGCCTTCCTAAAGAAGG - Intronic
1128025517 15:64433319-64433341 TGATATTTCATCCCTAAAGGAGG - Intronic
1128974947 15:72145143-72145165 TTCTATTTTCTCTCTAAAGTAGG - Intergenic
1129781838 15:78277493-78277515 ACCCATTTCCTCCCTCAAGGAGG + Intronic
1130013598 15:80171008-80171030 TACTATTTGCTGCATGAAGGAGG + Intronic
1130417833 15:83710731-83710753 TACTGTTTCCATCCCAAAGGAGG + Intronic
1145114707 17:20198472-20198494 AACTTTTTCTTCCCTAAAAGGGG - Intronic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1148414966 17:47499295-47499317 TGCTCTCTCCTCCCTAAACGTGG - Intergenic
1148626796 17:49075626-49075648 AGCTTTTTTCTCCCTAAAGGGGG - Intergenic
1149294046 17:55244732-55244754 TACTCTTACCTGCCCAAAGGTGG + Intergenic
1150852642 17:68718976-68718998 TACCCTTTCCTCCCTAAAGAAGG - Intergenic
1157567455 18:48689212-48689234 TCCTTTTTCATCCCTGAAGGAGG + Intronic
1158040803 18:53090851-53090873 AAGTATTTCCACCTTAAAGGAGG + Intronic
1158040805 18:53090859-53090881 CACCATTTCCTCCTTTAAGGTGG - Intronic
1164041141 19:21493689-21493711 TACAATTTCCTCCTGAAAGCAGG - Intergenic
1164205608 19:23056186-23056208 TACAATTTCCTCCTAAAAGCAGG + Intergenic
1164206477 19:23063224-23063246 TACAATTTCCTCCTGAAAGCAGG + Intergenic
1164470129 19:28523086-28523108 AGCTTTTTCCTCCCTAAAAGGGG + Intergenic
1164879419 19:31718901-31718923 TATTATATCTTCGCTAAAGGAGG + Intergenic
1166402722 19:42495586-42495608 AGCTTTTTTCTCCCTAAAGGGGG - Intergenic
1167888524 19:52521710-52521732 CACTATTTATTCCCTTAAGGCGG + Intergenic
1202664712 1_KI270708v1_random:107615-107637 TCCTTTTTCCTTCCCAAAGGTGG + Intergenic
926697863 2:15783354-15783376 TCCTATTTCCTCCCAAAAGATGG + Intergenic
927803832 2:26126907-26126929 TACTATTTCCTCCCTAAAGGAGG - Intronic
928155055 2:28869101-28869123 CTCTATTTCTTCCCTAAAAGGGG + Intronic
928791800 2:34965705-34965727 TACTTTTTCCTGCCACAAGGAGG - Intergenic
929889947 2:45910699-45910721 AACTATTTCCTACCTATTGGAGG + Intronic
931153440 2:59600617-59600639 TACAAATTCCTGCCTTAAGGGGG + Intergenic
931565798 2:63614595-63614617 TCCTTTTTCCTCCCCAAAGCAGG + Intronic
931866497 2:66417927-66417949 TACTATTGCCTCCCTCAAAATGG - Intergenic
932965770 2:76473115-76473137 AGCTTTTTCCTCCCTAAAAGGGG + Intergenic
933617335 2:84496060-84496082 TTCTATTTCCTCTCTGAAGCAGG - Intergenic
934888728 2:98047362-98047384 AGCTTTTTCCTCCCTAAAAGGGG + Intergenic
937062046 2:118988059-118988081 TACTTTCTCCTCTGTAAAGGAGG + Intronic
938705492 2:133920978-133921000 TGCTATTTCCTCCCAAAATCAGG + Intergenic
940097404 2:149993251-149993273 TCCTTTTTCTTCCCTAAAGCAGG - Intergenic
948389428 2:237601405-237601427 TATTATTTCCTCTCTGAAAGGGG - Intronic
1170125829 20:12963172-12963194 TGCTATTTCCCAACTAAAGGAGG - Intergenic
1178220632 21:30654226-30654248 TACTATTTCCTACCTACAATGGG - Intergenic
1178435913 21:32558395-32558417 AGCTTTTTCCTCCCTAAAAGGGG - Intergenic
1179335027 21:40442854-40442876 TATTATTTCCTTCATTAAGGGGG - Intronic
1180331442 22:11484535-11484557 TCCTTTTTCCTTCCCAAAGGTGG + Intergenic
1181928018 22:26375902-26375924 TACTATTCCTGCCCTCAAGGAGG + Intronic
1183139155 22:35919740-35919762 TAAAATTTCCTTCCCAAAGGAGG - Intronic
1183215378 22:36476209-36476231 TACGATCTACTTCCTAAAGGTGG + Intronic
1184346986 22:43919648-43919670 GTCTATTTCCTCTCTAAAGCTGG - Intergenic
1184516541 22:44965915-44965937 CACCACTTCCTCTCTAAAGGAGG + Intronic
1185023188 22:48392658-48392680 TATTAAATCCTCCCTAATGGAGG - Intergenic
1185164534 22:49253124-49253146 AACTATTTCCTCCCTGATTGTGG - Intergenic
950484181 3:13263387-13263409 TACTTTTTTCCCCCCAAAGGAGG - Intergenic
951119260 3:18905376-18905398 TACTATTTCCTTTTTAAAAGTGG - Intergenic
952126803 3:30310308-30310330 TAATCTTTCCTCCCTGAAAGAGG - Intergenic
953790785 3:45946366-45946388 GACTATTTGCCCCCTAAATGTGG + Exonic
955495711 3:59530134-59530156 TTCTATTTCTTCCTTAAAGAGGG + Intergenic
957091222 3:75732118-75732140 TCCTTTTTCCTTCCCAAAGGTGG - Intronic
958476807 3:94594531-94594553 TTCTTTTTACTCCCAAAAGGTGG - Intergenic
958597544 3:96247167-96247189 TATTATTTTCTCTCTGAAGGTGG - Intergenic
960152236 3:114262100-114262122 AGCTTCTTCCTCCCTAAAGGGGG - Intergenic
960666192 3:120111402-120111424 TACTATCTCCTCCCTCAGGTGGG + Intergenic
961510829 3:127402503-127402525 AACTTTTTCCTCCCTAAAAGGGG - Intergenic
968760863 4:2442299-2442321 TACTGCTTCCTCCCTCAAGGGGG - Intronic
969420243 4:7090220-7090242 AGCTTTTTCCTCCCTAAACGGGG - Intergenic
970712100 4:18875926-18875948 AACTTTTTCCTCCCTAAAATGGG - Intergenic
971775953 4:30964632-30964654 TACTATTTCTGCCCTCAGGGAGG - Intronic
973052810 4:45615301-45615323 TTCTATTTCCTTCTTAAAGGAGG - Intergenic
973274057 4:48290575-48290597 TACAATGCCCTGCCTAAAGGGGG - Intergenic
976789494 4:88861854-88861876 TACTATTTCCATTTTAAAGGTGG + Intronic
978190973 4:105911676-105911698 TTATATTTCCTCCCCAAAGTTGG + Intronic
982578073 4:157142990-157143012 TACTATTTTCTTTCTCAAGGCGG + Intronic
985319347 4:188692113-188692135 AACTATTTCCCCACTAAAGGGGG + Intergenic
987166312 5:15202024-15202046 AGCTTTTTCCTCCCTAAAAGGGG - Intergenic
988965658 5:36414947-36414969 TTATATTTCCTTCCTGAAGGTGG + Intergenic
989337147 5:40331159-40331181 AGCTTTTTCCTCCCTAAAAGGGG - Intergenic
990070887 5:51781624-51781646 AGCTTTTTCCTCCCTAAAAGGGG - Intergenic
993818731 5:92586826-92586848 TACTATTTGCTACCTATAGTAGG - Intergenic
993939363 5:94040266-94040288 AGCTTTTTCCTCCCTAAAAGGGG + Intronic
996487347 5:124052431-124052453 TACTATTTCCTCCAGAGGGGAGG - Intergenic
998081445 5:139278355-139278377 CACTATTTCCTCCCTTCAGATGG - Exonic
1000988802 5:167890305-167890327 AACTTTTTCCTCCCAAAGGGAGG + Intronic
1001013014 5:168115510-168115532 TCCTCCTTCCTCCCAAAAGGTGG - Intronic
1005177875 6:23068740-23068762 TTCAATCTCCTCCCTATAGGGGG + Intergenic
1005263031 6:24082221-24082243 TATTAAGTCCTCCCTATAGGAGG - Intergenic
1007891480 6:45297116-45297138 TACTATTTGCTCTGTAATGGGGG - Intronic
1008291491 6:49721595-49721617 AACTTTTTCCTCCATAAAAGGGG - Intergenic
1008355958 6:50553451-50553473 TCCTTTTTCCTCCCTAATGCAGG + Intergenic
1013473824 6:110489019-110489041 AGCTTTTTCCTCCCTAAAGGAGG + Intergenic
1014046630 6:116896272-116896294 TACTTTTTCCTCCTTAGAAGAGG + Intronic
1015689661 6:135907863-135907885 GCCCATTTCCTCCCTATAGGAGG - Intronic
1016482439 6:144496208-144496230 TAATATTTCCTAACTGAAGGAGG - Intronic
1017348697 6:153414904-153414926 AGCTTTTTCCTCCCTAAAAGGGG - Intergenic
1017404896 6:154108529-154108551 AGCTTTTTCCTCCCTAAAAGGGG - Intronic
1019973011 7:4557453-4557475 AACTGTTTCCTCCCTAACGTGGG + Intergenic
1023512438 7:40967905-40967927 TACTATTTCTTCCCTAATAGAGG + Intergenic
1023771517 7:43560894-43560916 TGCCTTTTCCTCCCTAAGGGTGG - Intronic
1024386157 7:48754210-48754232 TCCTTTTTCTTCCCTAAAGTGGG - Intergenic
1025740826 7:64193987-64194009 AGCTTTTTCCTCCCTAAAGTGGG + Intronic
1025741783 7:64203671-64203693 AGCTTTTTCCTCCCTAAAGTGGG - Intronic
1025746255 7:64245616-64245638 AGCTTTTTCCTCCCTAAAGTGGG - Intronic
1028389137 7:90295065-90295087 AGCTTTTTCCTCCCTAAAAGGGG - Intronic
1028998835 7:97130788-97130810 TAGTATTCCCTACCTGAAGGGGG + Intronic
1033161690 7:139002360-139002382 AGCTTTTTCCTCCCTAAAAGGGG + Intergenic
1033763723 7:144464811-144464833 AGCTTTTTCCTCCCTAAAAGGGG + Intronic
1035591773 8:821822-821844 TACTATTTCCATTCTAAAGCAGG - Intergenic
1035687561 8:1536830-1536852 AACTAATTCCTCCCTGTAGGAGG + Intronic
1038377315 8:27054453-27054475 TATTATTTCTGCCCTGAAGGAGG + Intergenic
1038502198 8:28054536-28054558 TACTATTTTATCACTAAAGTAGG - Intronic
1038515538 8:28184441-28184463 TACTTTTTCCTTTCTACAGGGGG - Intronic
1038818297 8:30929203-30929225 TTCTATTTCCTCCCCAAGTGTGG + Intergenic
1039278659 8:35958301-35958323 TACTCTTTCCTTTTTAAAGGTGG - Intergenic
1040857092 8:51959621-51959643 TACTATTTCCTGACTACAAGTGG - Intergenic
1041180399 8:55241560-55241582 TGTTGTTTCCTGCCTAAAGGAGG + Intronic
1041754094 8:61294060-61294082 TTCTATTTCCTCCCCAAATTTGG + Intronic
1042817202 8:72890584-72890606 TACTTTTTCCTCCATAAGGCAGG - Intronic
1046768040 8:118091344-118091366 TACTATTTCGAACCTCAAGGAGG + Intronic
1050168584 9:2791980-2792002 TAATAGTCCCTCCCTAAAGCTGG - Intronic
1050414507 9:5401816-5401838 TATTTTTTCCTTCCCAAAGGCGG + Intronic
1052182813 9:25551293-25551315 TACTAATTCTTCTCTAAAGAGGG - Intergenic
1055164637 9:73176266-73176288 AGCTTTTTCCTCCCCAAAGGGGG + Intergenic
1055257254 9:74386124-74386146 CCCTATTTTCTGCCTAAAGGAGG + Intergenic
1055362757 9:75511950-75511972 TACTTTTTACTTTCTAAAGGAGG + Intergenic
1057015276 9:91645501-91645523 TACGGCTTCCTCCCTAATGGCGG + Intronic
1057580348 9:96281704-96281726 AACTTTTTCCTCCCTAAAAGGGG + Intronic
1059217021 9:112573791-112573813 TAATAATTCCTGCCTAAGGGGGG - Intronic
1186611971 X:11146313-11146335 CACTGTTTCCTCCCTGATGGAGG - Intronic
1187032910 X:15506524-15506546 TGATATTGCCTCCCCAAAGGAGG + Intronic
1188133925 X:26471139-26471161 AACTTTTTCCTTCCTAAAAGGGG - Intergenic
1188484102 X:30663638-30663660 TATTATTTCCTCCAGAAAAGAGG + Intronic
1190808610 X:53862675-53862697 TTCTATTTTCTCCGTGAAGGAGG - Intergenic
1190920953 X:54852053-54852075 AGCTTTTTCCTCCCTAAAAGGGG - Intergenic
1190947430 X:55109440-55109462 AGCTTTTTCCTCCCTAAAAGGGG + Intronic
1191119423 X:56887944-56887966 AATTTTTTCCTCCCTAAAAGTGG + Intergenic
1191608739 X:63088814-63088836 TACTGTTTCCTGCTGAAAGGCGG - Intergenic
1192199681 X:69058664-69058686 TATTATCTCCCCCCTCAAGGGGG - Intergenic
1192542645 X:71988291-71988313 AGCTTTTTCCTCCCTAAAGGGGG - Intergenic
1194109678 X:89817994-89818016 AACTTTTTTCTCCCCAAAGGGGG + Intergenic
1195887273 X:109652785-109652807 TAATATTTCCTTCTTCAAGGTGG - Intronic
1198337909 X:135686029-135686051 TTCTATTTCCGCCCTAATTGTGG - Intergenic
1200462345 Y:3472732-3472754 AACTTTTTTCTCCCCAAAGGGGG + Intergenic
1200866452 Y:8048695-8048717 TACTAGGTCCTGCCTAAAGAGGG + Intergenic