ID: 927805003

View in Genome Browser
Species Human (GRCh38)
Location 2:26139303-26139325
Sequence CGAGTTTACCATGACTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927805003_927805005 4 Left 927805003 2:26139303-26139325 CCTGGGGAGTCATGGTAAACTCG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 927805005 2:26139330-26139352 TGGCGAGAGCAGTGTGTTTGTGG 0: 1
1: 0
2: 1
3: 17
4: 186
927805003_927805006 21 Left 927805003 2:26139303-26139325 CCTGGGGAGTCATGGTAAACTCG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 927805006 2:26139347-26139369 TTGTGGAAAGCAAGTTTAGATGG 0: 1
1: 0
2: 0
3: 24
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927805003 Original CRISPR CGAGTTTACCATGACTCCCC AGG (reversed) Intergenic
902152920 1:14459601-14459623 CCAATTAACCATGTCTCCCCTGG + Intergenic
909521428 1:76573067-76573089 CTATTTCCCCATGACTCCCCTGG - Intronic
918529010 1:185496689-185496711 CGTGTTAACCAGGACTGCCCAGG + Intergenic
1063184210 10:3635939-3635961 CTGTTTTACCATGAATCCCCTGG + Intergenic
1066390564 10:34974636-34974658 CCAGTTTACCCTTTCTCCCCAGG + Intergenic
1070179472 10:73999423-73999445 CCAGTCTCCCAAGACTCCCCTGG + Intronic
1076034166 10:127185055-127185077 AGAGCCTACCCTGACTCCCCAGG - Intronic
1082141121 11:48610703-48610725 GGAGTTTAGGATGACTCCACAGG - Intergenic
1084484901 11:69442609-69442631 CCAGCCTTCCATGACTCCCCAGG + Intergenic
1097271097 12:57774720-57774742 CATGTCTACCATGACTCCCTGGG + Intronic
1114422792 14:22598516-22598538 CGCGTCTCCCATGGCTCCCCAGG - Intronic
1117591279 14:57270553-57270575 GGAGTTTACCATTTCCCCCCAGG + Intronic
1137761123 16:50941076-50941098 GGAGTTTACCATGCTTGCCCTGG - Intergenic
1139544309 16:67642505-67642527 CAAGTCTACCATGACAACCCAGG - Intergenic
1142208659 16:88796585-88796607 GAAGCTCACCATGACTCCCCAGG + Intergenic
1148216202 17:45835167-45835189 CGAGTTGCCCATGATGCCCCAGG - Exonic
1155455168 18:26004398-26004420 GGAGCTTTCAATGACTCCCCTGG + Intergenic
1161994057 19:7701727-7701749 AGAGTCTTCCATGGCTCCCCAGG + Intronic
1165274844 19:34739618-34739640 CTCGTTCACCATGACTCACCTGG - Exonic
925906535 2:8543134-8543156 CGAGTTTTACCTGACTCTCCGGG - Intergenic
927805003 2:26139303-26139325 CGAGTTTACCATGACTCCCCAGG - Intergenic
929670795 2:43875375-43875397 CAAGTTTATCATGAAGCCCCCGG - Exonic
930384410 2:50675534-50675556 CTAGTTTATCATCACTCCACTGG - Intronic
930765867 2:55084527-55084549 AGAGGTTCCCATGACCCCCCAGG - Intronic
940140459 2:150486405-150486427 CGACTTGACCACGACTCCGCGGG + Intronic
941086251 2:161121671-161121693 TGAGTTTGCCATGACTTTCCAGG + Intergenic
944358339 2:198820630-198820652 CCAGTTTACCAGCACACCCCTGG - Intergenic
948426139 2:237887528-237887550 TGAGTTTACCCTCACTGCCCAGG + Intronic
1173461720 20:43248378-43248400 CCAGTTTACCATGTCTCACAAGG - Intergenic
1175967880 20:62668728-62668750 CGAGTTTCCCATGATCTCCCAGG - Intronic
1179367359 21:40770998-40771020 CGTGTTTACCATGATCCCCTTGG - Intronic
953901415 3:46846050-46846072 CGAGTGGGCCATGCCTCCCCCGG + Intergenic
962129928 3:132661167-132661189 CGACATTACCAAGACTGCCCAGG + Intronic
962477714 3:135771074-135771096 CGAGTTTACCATCATACCCCAGG - Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
996545750 5:124677343-124677365 CCAGTTTCCCATGGCTCCTCAGG - Intronic
1002124228 5:177029801-177029823 CGAGGTTTCCATGACACCCCTGG - Intronic
1003644725 6:7905199-7905221 CAAGTTGGCCCTGACTCCCCGGG + Intronic
1010175314 6:73021107-73021129 AAAGTTTACCCTGACTCTCCAGG + Intronic
1011565505 6:88668120-88668142 CCAGTTTACCCTTTCTCCCCAGG + Intronic
1012427394 6:99129492-99129514 CGAGTATACCAAGAATCACCAGG + Intergenic
1015573600 6:134647520-134647542 GGAGTCTACCATGACAGCCCAGG - Intergenic
1017525062 6:155235138-155235160 CAGCTTTACCATGACTCTCCAGG - Intronic
1025049369 7:55721471-55721493 CAACTTTCCCATCACTCCCCTGG - Intergenic
1026205276 7:68251859-68251881 CTAGCTTTCCAGGACTCCCCTGG + Intergenic
1036932832 8:12972983-12973005 CCCTTTTACCCTGACTCCCCAGG + Intronic
1039624904 8:39039075-39039097 AGAGTTTAACATGACTACTCAGG + Intronic
1040658191 8:49537561-49537583 CGAGTTTGCCCTGATTCCCTTGG + Intronic
1051877429 9:21806816-21806838 GCAGTGTACCATGGCTCCCCTGG + Intronic
1058384560 9:104419109-104419131 CCAGTTTCCCATGGCTCCCTGGG - Intergenic
1061158163 9:128877658-128877680 CGAGGTGACCATGCCTTCCCAGG + Intronic
1062146608 9:134992856-134992878 CGAGTTCACAATGAGGCCCCTGG - Intergenic
1188344020 X:29041978-29042000 CGAGTTTACAATGTCTTCCTGGG + Intronic
1189633545 X:42980217-42980239 GGAGTTTCTCATGACCCCCCTGG - Intergenic
1190362563 X:49662840-49662862 CCAGTTCATCATGACCCCCCTGG + Intergenic
1198515430 X:137401769-137401791 CCAGTTTACCAGTACTCCACTGG - Intergenic