ID: 927808926

View in Genome Browser
Species Human (GRCh38)
Location 2:26171487-26171509
Sequence CTGGAATTACATATGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 145}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927808926_927808931 -1 Left 927808926 2:26171487-26171509 CCCAGCTACATATGTAATTCCAG 0: 1
1: 0
2: 0
3: 17
4: 145
Right 927808931 2:26171509-26171531 GCTACTCAGGAAGCTGAGGCAGG 0: 3177
1: 85803
2: 183745
3: 211993
4: 142434
927808926_927808933 20 Left 927808926 2:26171487-26171509 CCCAGCTACATATGTAATTCCAG 0: 1
1: 0
2: 0
3: 17
4: 145
Right 927808933 2:26171530-26171552 GGAGAATTGCTTGAACCTGCGGG 0: 12
1: 601
2: 2288
3: 5455
4: 7921
927808926_927808932 19 Left 927808926 2:26171487-26171509 CCCAGCTACATATGTAATTCCAG 0: 1
1: 0
2: 0
3: 17
4: 145
Right 927808932 2:26171529-26171551 AGGAGAATTGCTTGAACCTGCGG 0: 371
1: 1228
2: 3114
3: 4685
4: 6340
927808926_927808929 -5 Left 927808926 2:26171487-26171509 CCCAGCTACATATGTAATTCCAG 0: 1
1: 0
2: 0
3: 17
4: 145
Right 927808929 2:26171505-26171527 TCCAGCTACTCAGGAAGCTGAGG 0: 296
1: 10332
2: 115707
3: 217904
4: 238356
927808926_927808934 21 Left 927808926 2:26171487-26171509 CCCAGCTACATATGTAATTCCAG 0: 1
1: 0
2: 0
3: 17
4: 145
Right 927808934 2:26171531-26171553 GAGAATTGCTTGAACCTGCGGGG 0: 97
1: 21437
2: 65385
3: 137067
4: 183695
927808926_927808935 24 Left 927808926 2:26171487-26171509 CCCAGCTACATATGTAATTCCAG 0: 1
1: 0
2: 0
3: 17
4: 145
Right 927808935 2:26171534-26171556 AATTGCTTGAACCTGCGGGGCGG 0: 5
1: 238
2: 15332
3: 44344
4: 91182
927808926_927808936 27 Left 927808926 2:26171487-26171509 CCCAGCTACATATGTAATTCCAG 0: 1
1: 0
2: 0
3: 17
4: 145
Right 927808936 2:26171537-26171559 TGCTTGAACCTGCGGGGCGGAGG 0: 4
1: 120
2: 7621
3: 37959
4: 85476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927808926 Original CRISPR CTGGAATTACATATGTAGCT GGG (reversed) Intergenic
901278897 1:8016097-8016119 CTGAAATTACTTTTTTAGCTTGG - Intronic
901707057 1:11081919-11081941 CTGGAAATACAAAATTAGCTGGG + Intronic
908139408 1:61168488-61168510 CTAGAATTAAATATACAGCTGGG + Intronic
909396306 1:75174415-75174437 CTGGAATTACAGGTGTAGGGAGG - Intergenic
911785439 1:101940675-101940697 CTGGATATATATATATAGCTGGG - Intronic
912552982 1:110496480-110496502 CTGGAATTACATTTTGAGCTAGG + Intergenic
914773852 1:150717812-150717834 CTGGGATTACAAGAGTAGCTGGG - Intronic
915859189 1:159423946-159423968 CTGGGATTACAGATGTAGTGTGG - Intergenic
917393351 1:174563847-174563869 CTGGAGTTAAATGTGTAGCCTGG - Intronic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
920420437 1:205829562-205829584 TTGAGATTACATATGTAGTTTGG - Intronic
923833788 1:237586985-237587007 CTGGGATTACAAATGTCACTGGG + Intronic
924051066 1:240080014-240080036 TTGCAATTATTTATGTAGCTAGG - Intronic
1063586834 10:7359507-7359529 CTTAAATTACATATGTTGCTGGG + Intronic
1065160473 10:22915830-22915852 CTGCAATTACACATGGAACTTGG + Intergenic
1068060106 10:52057166-52057188 GGGGAATTTCATTTGTAGCTTGG - Intronic
1068798675 10:61114384-61114406 CTGAAATGTCTTATGTAGCTAGG - Intergenic
1075177120 10:120175465-120175487 TTGGAATTACATCTGTGGCTTGG + Intergenic
1076832289 10:133001873-133001895 CTGGAATTGCATGTGGTGCTGGG + Intergenic
1077449382 11:2627518-2627540 TTAGAATTCCATATGTAACTGGG + Intronic
1078178124 11:8985982-8986004 CTGGAACAACATATGTAGGATGG - Intronic
1079419399 11:20272072-20272094 TTGAAATCACATATGTAGGTAGG + Intergenic
1079759816 11:24314853-24314875 CTGGGATTACTTGAGTAGCTTGG + Intergenic
1081763043 11:45590542-45590564 TTGGATTTTCATATGTAGCTGGG - Intergenic
1083627753 11:64080446-64080468 CTGGAATTACATAGGAATCATGG - Intronic
1084059429 11:66660607-66660629 CTGGGATTACAGGTGTAGGTAGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1090018469 11:123106355-123106377 ACAGAATTATATATGTAGCTGGG - Intronic
1091351234 11:134896925-134896947 TAGGAATTACATGTGTACCTGGG + Intergenic
1096025506 12:48357563-48357585 CTGGGACTACATGAGTAGCTGGG + Intergenic
1098145356 12:67491769-67491791 CTGTAATTGCATTTTTAGCTGGG - Intergenic
1099986815 12:89675772-89675794 CTGGAATTATAAATGTGTCTGGG - Intronic
1100799869 12:98219902-98219924 CTGGCATTCCCTATCTAGCTTGG - Intergenic
1101514489 12:105421618-105421640 CTGGGATTACAGGTATAGCTGGG + Intergenic
1105767431 13:23575538-23575560 CGGGAATTACTTAAATAGCTAGG + Intronic
1106650055 13:31680780-31680802 CTGGAATTACATATGGTTCTTGG - Intergenic
1107605848 13:42055852-42055874 CTGGAAACACATTTGTAGCTGGG + Intronic
1108119160 13:47164569-47164591 CTGGAAACACATATGTTGGTTGG - Intergenic
1111888584 13:94053672-94053694 CTGGAGTTACATATATAGATGGG - Intronic
1115603046 14:34973967-34973989 CTCAAATTACATATGTAGAGGGG + Intergenic
1115744171 14:36418915-36418937 CTGGAAATACACTTCTAGCTTGG + Intergenic
1119455601 14:74752768-74752790 CTGAAAATACACATTTAGCTAGG - Intergenic
1119471342 14:74901801-74901823 CTGGAATTGTATGTGTAGCTGGG - Intronic
1119915753 14:78399926-78399948 CTAGAATTAGCTATGTAACTAGG + Intronic
1122021966 14:98845488-98845510 CTGGATTTACATATGAATGTTGG - Intergenic
1124684762 15:31772534-31772556 TTAGAATTACTTAGGTAGCTTGG + Intronic
1127061142 15:55186817-55186839 CTGGAAATACATATTAAACTAGG + Intronic
1128879800 15:71232559-71232581 CTGGAAGTACAGAAGTAGGTAGG + Intronic
1131572776 15:93555897-93555919 GTGGAATTCCACGTGTAGCTGGG + Intergenic
1133976385 16:10602218-10602240 CTGGAATTGCATAAGCAGATGGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1139158214 16:64470415-64470437 CTGGAAATACAGATCTACCTTGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1143085699 17:4414318-4414340 CTGAGATTACAGGTGTAGCTGGG - Intergenic
1147248482 17:39138240-39138262 CTGGAATTACATTTGAGGCTAGG + Intronic
1147953991 17:44122443-44122465 CTGGGATTAGATTTGGAGCTTGG - Intronic
1149055887 17:52364628-52364650 CTTGAATTACATATATGTCTAGG - Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1153691539 18:7599656-7599678 CTGGAATGAAAAATGTAGCAGGG - Intronic
1154170129 18:12045612-12045634 TTGGAATTACATAACTTGCTTGG - Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1157598826 18:48880241-48880263 ATAGAATTACATATGTACTTAGG - Intergenic
1159447188 18:68555558-68555580 TTGCAATTACATTTGTAGCTTGG - Intergenic
1162696663 19:12482028-12482050 CTGGGATTACAGATGTGGCTTGG - Intronic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1166422426 19:42649201-42649223 TTGGATTTTCATATGTACCTTGG - Intronic
1166588979 19:43978660-43978682 CAGGTACTACATATGAAGCTAGG - Intronic
1166936623 19:46337382-46337404 CTGGGACTACACTTGTAGCTGGG + Intronic
1168647579 19:58070290-58070312 CTGAAATTACAAAATTAGCTGGG + Intronic
925752212 2:7098989-7099011 CTGGAATCACTCATGTTGCTGGG - Intergenic
926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG + Intergenic
927808926 2:26171487-26171509 CTGGAATTACATATGTAGCTGGG - Intergenic
930684439 2:54292882-54292904 CTGGAATAACAAATCTAGATTGG - Intronic
930701689 2:54464171-54464193 CTGAAATCTCACATGTAGCTTGG + Intronic
931366713 2:61625624-61625646 CTGGAATTCCCTATGTGGCCTGG - Intergenic
931969983 2:67575443-67575465 CTGAAATTTCATATGTATTTAGG + Intergenic
932931340 2:76043290-76043312 CTAAAATAAAATATGTAGCTGGG + Intergenic
933575821 2:84066210-84066232 CTAGAATTACATTAGAAGCTGGG + Intergenic
936041333 2:109152146-109152168 CTGGAATTACATTTCTTCCTAGG + Intronic
936263642 2:110982684-110982706 CCTGAAATACAAATGTAGCTGGG - Intronic
941442087 2:165551106-165551128 TTGGAATTACATCTAAAGCTCGG - Intronic
942949632 2:181707780-181707802 CTGGAATTAAATTTGTACCTGGG - Intergenic
946411539 2:219517583-219517605 CTGGAATTACAGATTGGGCTGGG + Intronic
947084083 2:226431413-226431435 CTTGATTTACATATGTACCCTGG + Intergenic
1169440355 20:5628683-5628705 CTAAAATTACAAAAGTAGCTGGG + Intergenic
1170688673 20:18592313-18592335 CTTGAAATACAGATTTAGCTGGG + Intronic
1171005426 20:21460885-21460907 CTGAAAATACAAAAGTAGCTGGG + Intergenic
1172294288 20:33797477-33797499 CTGGACATACATATGTATGTCGG - Intergenic
1173629741 20:44503223-44503245 CTGCAAAAAAATATGTAGCTGGG - Intronic
1173694491 20:44997077-44997099 GTGGAATTACATTTGAAGCTTGG - Intronic
1177455630 21:21333841-21333863 CTAGAATTTAATATGTAGATAGG - Intronic
1177996013 21:28098720-28098742 CTGAAAATACAAAAGTAGCTGGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183134830 22:35877117-35877139 CTAGAATTACATTTGTATCAGGG - Intronic
1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG + Intergenic
949271585 3:2223831-2223853 CTGCACTTACATATGTAATTAGG - Intronic
949562073 3:5212407-5212429 CTGGATGGAAATATGTAGCTAGG - Intronic
954160779 3:48720235-48720257 CTGGGACTACAGGTGTAGCTGGG - Intronic
954226691 3:49186265-49186287 CTGGGATTACAGGTGTAGCCTGG + Intronic
955909243 3:63843277-63843299 CTGGAAATACAAAATTAGCTGGG - Intronic
958155819 3:89754515-89754537 GTGTAAGTACATATGTAGGTAGG - Intergenic
960299943 3:115990577-115990599 CAGGAATTCCAAATGTAGCTTGG + Intronic
960421224 3:117447846-117447868 CTGGAAATAGATATGTGGATTGG - Intergenic
960914288 3:122680957-122680979 CTGGAAGTACATCTGCAACTTGG - Exonic
963155800 3:142095149-142095171 CTGAAAATACATAATTAGCTGGG - Intronic
967576448 3:191099863-191099885 CCAGAAATAAATATGTAGCTAGG + Intergenic
967757478 3:193186066-193186088 CTCTAGTTACATAGGTAGCTTGG + Intergenic
968004137 3:195227922-195227944 CTGGTATCACATGTGAAGCTGGG - Intronic
971534438 4:27730932-27730954 CTGGAATTACATAATTAAATAGG - Intergenic
971772906 4:30921871-30921893 ATGTAATTACATATGTAATTTGG + Intronic
972826491 4:42765822-42765844 TTTGAATTCCAAATGTAGCTCGG + Intergenic
973004553 4:44991423-44991445 CTGGAATTACATATGCATTGGGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974255608 4:59450531-59450553 CAGGAGTTCCATATGTAGTTGGG + Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981326610 4:143455673-143455695 CTGAATTTACAGATGTGGCTTGG - Intronic
983366830 4:166801831-166801853 CAGGAATTACATATTAATCTAGG + Intronic
984647726 4:182237521-182237543 CTGGGATTACAGACGTAGCCAGG - Intronic
988427052 5:31075857-31075879 GTGAAATTACATATGCAACTTGG - Intergenic
992586583 5:78246088-78246110 CTGGAATTCCATCTCTACCTTGG - Intronic
994453999 5:99982347-99982369 CTTGAATTGCATATTTAGATGGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994981397 5:106878820-106878842 CTGTCATAACATATGTAGTTGGG + Intergenic
998770774 5:145542315-145542337 CTGGAAATACAATTGTAACTAGG - Intronic
1004279200 6:14266187-14266209 CTGGATTTACCTATTCAGCTTGG + Intergenic
1007210956 6:40193068-40193090 CAGGAATTACAGATGTACCCTGG - Intergenic
1007438131 6:41832375-41832397 CAGTACATACATATGTAGCTAGG - Intronic
1009269152 6:61596943-61596965 TTGGAAGTACAAATGTGGCTGGG - Intergenic
1013373832 6:109495061-109495083 TTTGAATTAGATATGTAGTTTGG - Intronic
1014585303 6:123190812-123190834 ATGTAATTACATTTGTAGATAGG + Intergenic
1015757124 6:136619051-136619073 CTGGACTGACATATGGAGCCTGG + Intronic
1015898532 6:138040285-138040307 CTGGTATTACATCAGAAGCTGGG + Intergenic
1021090487 7:16477367-16477389 CTGGAATTACATATCCTTCTGGG - Intronic
1022149610 7:27587796-27587818 TTGGAATTACAGCTGTACCTTGG - Intronic
1022200809 7:28115194-28115216 TTAAAATTACATATGTGGCTTGG - Intronic
1025220321 7:57102381-57102403 CTAGAACTACAAATTTAGCTGGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1027764993 7:82328307-82328329 TTTGAAATTCATATGTAGCTTGG + Intronic
1028712111 7:93921491-93921513 CTCTAATTACATATATAGGTTGG - Intergenic
1033947298 7:146736221-146736243 CTGGAGTTTCATATGGAGCAGGG + Intronic
1035865945 8:3082018-3082040 CTGGGATGACATATGTTGGTGGG - Intronic
1036038142 8:5042711-5042733 GAGGAATTTAATATGTAGCTAGG - Intergenic
1036965313 8:13290855-13290877 CTGGAATGAGATGCGTAGCTTGG + Intronic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1040940923 8:52832571-52832593 CTGTAATTACATATATAGAGGGG + Intergenic
1041290551 8:56304261-56304283 ATGGAATTGCACATGGAGCTGGG + Intronic
1043049564 8:75368028-75368050 CTTTAATTACATCTCTAGCTAGG - Intergenic
1044856375 8:96480254-96480276 CTGGAATACCAGATGCAGCTGGG - Intergenic
1045287142 8:100801668-100801690 CTGCAATTTCATATGAGGCTTGG - Intergenic
1045888936 8:107131448-107131470 CTGGAATTGTATATATACCTTGG + Intergenic
1046331855 8:112726600-112726622 GTTAAATTACATATGGAGCTTGG + Intronic
1050169090 9:2796758-2796780 CTGGAACTGCATTTGAAGCTTGG - Intronic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051583762 9:18705601-18705623 GTGGATTTACATGTGTAGCACGG + Intronic
1051964483 9:22810935-22810957 CTGGAATGACATAAATAGATGGG + Intergenic
1052980733 9:34447204-34447226 CTGGAATCACATCTTGAGCTAGG - Intronic
1060564694 9:124579847-124579869 CTGAAAATACATAATTAGCTGGG + Intronic
1062252650 9:135606019-135606041 CTGGGATTACAGGTGTAGCTGGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1189739398 X:44102702-44102724 ATTTAATTACATATGTAGATGGG - Intergenic
1194812885 X:98407383-98407405 ATGGAATTACATTAGTAACTTGG + Intergenic
1196001119 X:110787311-110787333 CTTGACTTACTTATGTACCTTGG - Intronic