ID: 927809817

View in Genome Browser
Species Human (GRCh38)
Location 2:26174602-26174624
Sequence ATTCAATCCATAATCTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927809817_927809821 11 Left 927809817 2:26174602-26174624 CCAATAAAGATTATGGATTGAAT 0: 1
1: 0
2: 1
3: 20
4: 241
Right 927809821 2:26174636-26174658 TGAATGAACAACTGGTGTGATGG 0: 1
1: 0
2: 2
3: 17
4: 202
927809817_927809820 3 Left 927809817 2:26174602-26174624 CCAATAAAGATTATGGATTGAAT 0: 1
1: 0
2: 1
3: 20
4: 241
Right 927809820 2:26174628-26174650 TGGGTGAGTGAATGAACAACTGG 0: 1
1: 0
2: 6
3: 69
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927809817 Original CRISPR ATTCAATCCATAATCTTTAT TGG (reversed) Intronic
905544897 1:38789990-38790012 ACTCAATCCAAAATCTATGTGGG - Intergenic
908315090 1:62924608-62924630 CTTCAAGCCATAATTTTGATGGG - Intergenic
909609484 1:77537455-77537477 GCTCAATCCATCATCCTTATGGG + Intronic
909821137 1:80062687-80062709 ATTCAACACAAAATTTTTATGGG + Intergenic
909952019 1:81731809-81731831 GATCAATCAATAATCTTTAATGG - Intronic
912749896 1:112278196-112278218 GTTCAATCCATACTCTTTTGTGG - Intergenic
913227391 1:116712222-116712244 GTTCTATCAATAATCTTTGTGGG + Intergenic
913573855 1:120149455-120149477 ATTGAATCCATAAACTGCATTGG + Intergenic
914616677 1:149365191-149365213 ATTGAATCCATAAACTGCATTGG - Intergenic
915380743 1:155437770-155437792 ATAAAATACATAATCTTTCTGGG + Intronic
915386155 1:155494410-155494432 ATTCATTCAACAATATTTATGGG + Intronic
916221657 1:162450754-162450776 ATAGGATGCATAATCTTTATGGG + Intergenic
917004628 1:170399666-170399688 ATTCAATAGATATTATTTATTGG + Intergenic
918108638 1:181435672-181435694 ATTCATTCAATAATATATATTGG - Intronic
918268032 1:182865596-182865618 TTTCAATCTTTTATCTTTATGGG + Intronic
920714483 1:208326813-208326835 TTTCAATTCATCATCTTTTTTGG - Intergenic
921747788 1:218757214-218757236 TTTCAATTTTTAATCTTTATGGG - Intergenic
924113850 1:240726544-240726566 ATTCTATCAAAAATCTCTATGGG - Intergenic
1063824572 10:9879739-9879761 GTTAAAGCCAAAATCTTTATTGG - Intergenic
1069419410 10:68233171-68233193 GTTCAATCCAGAATCCTTACTGG + Intergenic
1070039581 10:72762573-72762595 CTTCAATCCAGAATCTTAATTGG - Intronic
1070425180 10:76280211-76280233 ATTTAATCCTTAGACTTTATAGG + Intronic
1071907250 10:90187791-90187813 TTTCAACACATAATCTTTAGGGG - Intergenic
1078768434 11:14322763-14322785 ATTTAATCCGGAATCTTGATGGG - Intronic
1079549625 11:21678029-21678051 ATTCAATCTTTAATTTTTAAAGG + Intergenic
1081553323 11:44134261-44134283 ATTGAATCCCTAATGTTTTTTGG + Intronic
1083980096 11:66160463-66160485 AATTAATGCATGATCTTTATAGG + Intronic
1085607674 11:77917209-77917231 ATTCAATTAATAATTTTTAGTGG - Intronic
1085945938 11:81273183-81273205 ATTCAATCTTTAATCTTTGGAGG + Intergenic
1086115046 11:83240519-83240541 ACTGATTCCATAATTTTTATTGG - Intronic
1086227971 11:84535502-84535524 ACTCAAACAATAATCTTTACTGG - Intronic
1086272812 11:85088148-85088170 ATTCAACCCATCATCATTTTTGG - Intronic
1086354713 11:85983090-85983112 AGTCCATACATATTCTTTATAGG + Intronic
1086369856 11:86145694-86145716 ATCCACTGCATATTCTTTATTGG + Intergenic
1086809521 11:91290375-91290397 ATTCAATCCATCATTTGTGTTGG - Intergenic
1086862110 11:91936737-91936759 ATTGAATCCATTATCTTGAGAGG - Intergenic
1087883065 11:103441737-103441759 AGTTAAACCATAATATTTATGGG - Intronic
1088708465 11:112484626-112484648 ATTAAGTCTATTATCTTTATTGG - Intergenic
1089597690 11:119591877-119591899 ATTCAATTCACCATCTTTACTGG - Intergenic
1090445343 11:126760096-126760118 ATTCAATCACAAATATTTATTGG + Intronic
1091802231 12:3331515-3331537 AGTTAAGCCATAATCATTATGGG - Intergenic
1094402178 12:30074062-30074084 ATTCAATTCATATTATTTGTGGG + Intergenic
1098969786 12:76839903-76839925 ATTGTTTCCATAATATTTATTGG + Intronic
1099712978 12:86251361-86251383 ATTAAAACCAAAAACTTTATGGG - Intronic
1099713064 12:86253112-86253134 ATTAAAACCAAAAACTTTATGGG - Intronic
1100071248 12:90721189-90721211 AGTCAATCCCAAATCTCTATAGG + Intergenic
1101141757 12:101802535-101802557 ACTCTATCCATAGTCTTTAGGGG - Intronic
1104513833 12:129405442-129405464 GTTCAATCCCTAATAGTTATGGG - Intronic
1105972840 13:25446558-25446580 GTTCATTCCATTATCTTTTTTGG + Intronic
1106567382 13:30898074-30898096 ATTTAAGCCATAACCTTTGTTGG + Intergenic
1106843377 13:33710220-33710242 TTGCAAACTATAATCTTTATAGG + Intergenic
1106908488 13:34435876-34435898 GTTTAATACATAATATTTATAGG - Intergenic
1108117538 13:47145970-47145992 ATACAATCCAAAGTGTTTATGGG - Intergenic
1108625742 13:52227149-52227171 TTTTAATCCATAATGTTAATTGG - Intergenic
1108660321 13:52579269-52579291 TTTTAATCCATAATGTTAATTGG + Intergenic
1110116096 13:71818478-71818500 AGTAAATCCAAAGTCTTTATTGG - Intronic
1111190308 13:84798487-84798509 AATCCATTCATAATATTTATGGG + Intergenic
1111401995 13:87749900-87749922 ATTGAACCCATAATATTTCTGGG + Intergenic
1111410745 13:87873488-87873510 ATCCAATCCAATATCTTTATTGG - Intergenic
1112513948 13:100035361-100035383 ATTCAATACACAATTATTATTGG + Intergenic
1115706257 14:36002059-36002081 ATTAAAGCCAGGATCTTTATTGG + Intergenic
1116101797 14:40447645-40447667 TTTCAGTCCATTATATTTATTGG - Intergenic
1116526841 14:45916335-45916357 ATGCAAACCATAATCTTTGGTGG - Intergenic
1116755185 14:48939575-48939597 ATTCAATACACAATATTTTTAGG - Intergenic
1117378397 14:55136521-55136543 TTTTAATTCTTAATCTTTATGGG + Intronic
1118232742 14:63968691-63968713 ATTCAATTTTTAATTTTTATGGG + Intronic
1120321672 14:82969912-82969934 ATTTACTACATAATCTATATTGG + Intergenic
1120328832 14:83061441-83061463 ATGCAACCCATGATCTTCATGGG - Intergenic
1120716761 14:87848901-87848923 ATTCTATCCATCATTCTTATTGG + Intronic
1120770521 14:88374449-88374471 ATTGAATCCATAAACTATTTTGG - Intergenic
1120802713 14:88710555-88710577 AATTAATACATAATCTTTTTTGG + Intronic
1123959588 15:25382916-25382938 ATTCAATCTCTAATAGTTATAGG - Intronic
1127160507 15:56179420-56179442 CTACAATCCCTAATCTTAATAGG - Intronic
1127354008 15:58180818-58180840 ATTCAGTCCAAAATGTTAATAGG + Intronic
1127537662 15:59904917-59904939 TCTCAATCCATAACCTTTACTGG + Intergenic
1128596256 15:68952998-68953020 ATACAGTACATAATCTTTTTGGG + Intronic
1128695044 15:69755498-69755520 CTTCAATCCATCATCTTTCTAGG - Intergenic
1131318479 15:91363443-91363465 AGACAATCCACAATTTTTATTGG + Intergenic
1131907533 15:97159568-97159590 TTTCAATGGATAACCTTTATAGG - Intergenic
1132426559 15:101722991-101723013 ATTTAATCAGTAATTTTTATTGG + Intronic
1134311078 16:13075613-13075635 ATTCCATTCATAATATCTATTGG + Intronic
1136956186 16:34789141-34789163 ATTCAATCTATATTCATTAATGG + Intergenic
1137380461 16:47993994-47994016 ATTCAAACCATAAACTTTTTAGG + Intergenic
1137961427 16:52885500-52885522 ATTCAATCATGAATGTTTATTGG - Intergenic
1138193872 16:55038068-55038090 ATTCTATCATTAATCATTATGGG - Intergenic
1138437594 16:57013128-57013150 ATTCAACTCAAAATCTTCATAGG + Intronic
1139002085 16:62524322-62524344 ATTTAATCCATTAAATTTATTGG - Intergenic
1140533384 16:75686472-75686494 ATTCAATCAATAATTTGAATTGG + Intronic
1146729112 17:35179121-35179143 ATTGAATCCATAAACTATCTTGG + Intronic
1149766959 17:59287061-59287083 ATTTAATCCAAAATCTTACTTGG - Intergenic
1156246871 18:35309063-35309085 ATGCAGCCCATAAACTTTATTGG + Intergenic
1157025995 18:43844400-43844422 ATTCATTCCAAAATACTTATTGG - Intergenic
1158789212 18:60755670-60755692 ATGCTATACATAATATTTATAGG - Intergenic
1159588685 18:70307510-70307532 ATTCATTCCTTACTCGTTATAGG + Intronic
1159899168 18:74026984-74027006 AATCAATCAATAAACTGTATAGG + Intergenic
1160206913 18:76842210-76842232 ATAAAATAAATAATCTTTATGGG - Intronic
1162663378 19:12189292-12189314 ATACATTCCATCATATTTATTGG + Exonic
926796243 2:16621448-16621470 ATTCATTCAAAAATCTTTACTGG - Intronic
927809817 2:26174602-26174624 ATTCAATCCATAATCTTTATTGG - Intronic
928635132 2:33237784-33237806 TGTCAATCCAGAATCTTTCTAGG - Intronic
929846427 2:45533878-45533900 AAACAATCAAGAATCTTTATTGG + Intronic
929875278 2:45791647-45791669 TTTCACTCTAGAATCTTTATGGG + Intronic
930419418 2:51132310-51132332 ATTCATTCCTTATTCTTCATAGG + Intergenic
930905419 2:56560360-56560382 ATTAAAACGATAATTTTTATAGG - Intergenic
931174313 2:59837541-59837563 AATCAATCCCTTATCTTTAAGGG + Intergenic
933510685 2:83237734-83237756 AGTCAAGTCATAATCTGTATGGG - Intergenic
933995591 2:87666593-87666615 ATTCTATCCAAAATCTTGAAGGG + Intergenic
934803903 2:97198596-97198618 ATTCAAAACAGAATCTTTCTCGG - Exonic
934804595 2:97207944-97207966 ATTCAAAACAGAATCTTTCTCGG - Exonic
936298266 2:111284319-111284341 ATTCTATCCAAAATCTTGAAGGG - Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
936599651 2:113883325-113883347 ATAAAATCCATACTCCTTATTGG - Intergenic
937467278 2:122145528-122145550 CATTAATCCATAAGCTTTATGGG - Intergenic
941521146 2:166545003-166545025 ATTCAGACCATTCTCTTTATTGG + Intergenic
941641204 2:167990748-167990770 ATTCACTCAATAATATTTATCGG + Intronic
941809308 2:169739358-169739380 ATTAAATCCAGATTCTTTGTTGG + Intronic
942583648 2:177449793-177449815 TTGCCATCCATATTCTTTATTGG + Intronic
942584020 2:177454519-177454541 ATTCACCCCATAATGATTATGGG + Intronic
944451939 2:199852116-199852138 ATTCATCCCATAATTTTAATTGG + Intergenic
944490922 2:200256894-200256916 AAACAATCTATAATATTTATGGG - Intergenic
945142910 2:206706080-206706102 ATTCACTCCAAAATATGTATTGG + Intronic
945800520 2:214423515-214423537 ATTGAATCCAACATATTTATTGG - Intronic
947936063 2:234004687-234004709 AAGCAATCCATATTCATTATAGG + Intronic
1169612051 20:7392572-7392594 TTTCAATCCATAAGCATCATGGG + Intergenic
1169962708 20:11179592-11179614 ATTAAATATATAATCTTTAGAGG + Intergenic
1170426163 20:16237389-16237411 ATTTAATACTTAATCTTGATTGG - Intergenic
1171102590 20:22399552-22399574 ATGCAATCCAGAATCTTGCTAGG + Intergenic
1173535383 20:43807338-43807360 ATTCCATCCATTATCATAATGGG + Intergenic
1173722594 20:45272673-45272695 ATTCAATGCATAATCTTGAATGG + Intergenic
1173902230 20:46599239-46599261 ATTCATTCACTAATATTTATTGG - Intronic
1174211133 20:48878840-48878862 ATTCAATCCTGAACCTTTATTGG + Intergenic
1177083253 21:16668656-16668678 ATCCAATCCAGTATCTTTACAGG - Intergenic
1177745133 21:25203294-25203316 ATTAAATCAATAATATTTATTGG + Intergenic
1177844138 21:26268904-26268926 ATTCAATAAATAATCATTACAGG - Intergenic
1182012054 22:27009290-27009312 ATTCAATCAACAAACTTTATTGG + Intergenic
1183137676 22:35905051-35905073 ATTCATTCCAAAATTTTCATCGG + Intronic
1183283446 22:36947149-36947171 ATTCATTTCATAAAGTTTATAGG - Intergenic
949118372 3:356397-356419 GTTCATTCAATAATATTTATGGG + Intronic
951526680 3:23659669-23659691 ATTCAATTTAGAATGTTTATAGG - Intergenic
951582590 3:24181790-24181812 ATTCTTTCCATTGTCTTTATTGG + Intronic
952068910 3:29608947-29608969 ATTTCATTCATATTCTTTATGGG + Intronic
952228252 3:31401647-31401669 ATTGAATCCATAAACTGTTTTGG + Intergenic
953073932 3:39550699-39550721 ACGCAATCCATCATTTTTATTGG - Intergenic
953754798 3:45636836-45636858 ATTCAATCCAGACTCCTGATGGG - Intronic
957715147 3:83918580-83918602 GTTCAATACATAATCTGTAATGG - Intergenic
960347889 3:116557153-116557175 ATCTGATCCATAACCTTTATTGG - Intronic
964901869 3:161670061-161670083 ATTCAATCCATAATTTCTTTTGG + Intergenic
965430993 3:168588434-168588456 ATTCAAACCAGGAACTTTATAGG + Intergenic
966572143 3:181455977-181455999 ATTCAATCCAGAATTGTTTTAGG + Intergenic
966895222 3:184439830-184439852 ATTCATGCCAAAATCTTTAGTGG - Intronic
968261621 3:197329660-197329682 AGCCAATCCATAATCTTGATAGG + Intergenic
970035156 4:11724841-11724863 AGTTAGTCCATAATCTGTATTGG + Intergenic
970467913 4:16346188-16346210 ATAGGATGCATAATCTTTATAGG + Intergenic
971309129 4:25508808-25508830 ATTCAATGCAAAATTTTTATTGG + Intergenic
971591629 4:28476150-28476172 AATCAATCCAAAATCTTTTTTGG - Intergenic
972976096 4:44638257-44638279 ATTCAATCTTGAATCATTATTGG + Intronic
973615677 4:52675605-52675627 ACTCAAACCATAAACCTTATAGG - Intergenic
974206311 4:58707286-58707308 ATATAATCAATAATCTATATGGG + Intergenic
974907209 4:68073127-68073149 TTTCATTTCATAATCTTGATTGG + Intronic
979132024 4:117059144-117059166 ATGCAATCCATACTATTTTTTGG + Intergenic
979768462 4:124492066-124492088 ATTAAATTCTTAATCTCTATAGG - Intergenic
980275533 4:130645719-130645741 ATTCCATCCACAATTGTTATTGG - Intergenic
981248127 4:142564530-142564552 CTTCAATCCAAGATATTTATGGG - Intronic
981638297 4:146906627-146906649 ATTCAACACATGAACTTTATTGG - Intronic
983566766 4:169161414-169161436 ATTTAATCAAAAATATTTATAGG - Intronic
984274436 4:177592853-177592875 ATTTAAACCTTAATTTTTATGGG + Intergenic
984439989 4:179756084-179756106 ATTCAATTTATACTCATTATTGG - Intergenic
985369829 4:189274877-189274899 TTTTAATCCAAAATCCTTATGGG + Intergenic
985382660 4:189411867-189411889 CTTCAATCTATAATTTTTCTTGG + Intergenic
986160523 5:5224250-5224272 ATTTAATCCATAATATGTAATGG + Intronic
988120940 5:26961482-26961504 ATTCTATCCATAATTTTAAGAGG - Intronic
988458239 5:31407605-31407627 GTTCATTCCATTATCTTTGTTGG - Intronic
990909343 5:60838127-60838149 ATAAAATCCAAAACCTTTATGGG + Intronic
993341800 5:86733327-86733349 ATTAAATGCATTTTCTTTATTGG + Intergenic
993751898 5:91679786-91679808 ATTTACTCCATAATCTGTCTTGG - Intergenic
994111687 5:96012541-96012563 ATTCAATTCATGATCCATATAGG + Intergenic
995092195 5:108191064-108191086 AATTAATCCTTAATGTTTATAGG - Intronic
996430606 5:123371854-123371876 ATTAAATCCTTAAACTTTAAAGG + Intronic
1001321089 5:170682204-170682226 TTTCTATCCATAATCTGTCTCGG + Intronic
1002629798 5:180564276-180564298 ATTCAAAACATAATGTTAATGGG - Intronic
1003747597 6:9020680-9020702 TTTCAATGTATAATTTTTATTGG + Intergenic
1004597911 6:17118050-17118072 ATTCAACTCATTATGTTTATGGG + Intronic
1005028636 6:21488652-21488674 ATTCAAACCTGAATCTTTCTGGG - Intergenic
1005143095 6:22656596-22656618 ATTCAAACCATTATTTTTAAGGG - Intergenic
1008287879 6:49676269-49676291 ATTCAGTTTATCATCTTTATTGG - Intergenic
1008955309 6:57209335-57209357 AGTCAATCCTTATTGTTTATAGG - Intronic
1009354407 6:62723724-62723746 ATTCAATACATAATTTTTGAAGG - Intergenic
1009765765 6:68073415-68073437 GTTCCATACATTATCTTTATTGG + Intergenic
1009957652 6:70474595-70474617 ATTCAAATCAGAATCTGTATAGG + Intronic
1010076706 6:71806581-71806603 AATTAATACAAAATCTTTATGGG + Intergenic
1010416997 6:75623664-75623686 ATTCAGTTAATAATTTTTATTGG + Intronic
1010603361 6:77858401-77858423 ATTTAATGCATAATCCTTTTTGG - Intronic
1011870857 6:91890681-91890703 ATTCAAACAATACCCTTTATAGG - Intergenic
1011891679 6:92170577-92170599 ATTCAATCCATAATGTTTGATGG + Intergenic
1012100107 6:95073148-95073170 ATCCAATATATAATCTATATTGG + Intergenic
1012545381 6:100413174-100413196 ATTGAATCCATAAGCTCTCTGGG + Intronic
1012593540 6:101013317-101013339 ATCCAAACCAAAATCTTTAATGG + Intergenic
1013446913 6:110238739-110238761 ATTTAAACCATAGTTTTTATAGG - Intronic
1013724039 6:113070458-113070480 ATTCAAACAAAAATCTGTATGGG + Intergenic
1015321396 6:131879667-131879689 ATTGATTTCAGAATCTTTATAGG + Intronic
1016535381 6:145103972-145103994 AGTAAATAAATAATCTTTATTGG - Intergenic
1016599014 6:145835399-145835421 ATTCAATCAACAATTTTTGTGGG - Intergenic
1017081856 6:150677194-150677216 ATTCAGTCCAAAGTCTTTACTGG + Intronic
1018406633 6:163491175-163491197 ATTCAATCCATTATATCTTTTGG + Intronic
1019897570 7:3994711-3994733 AATCAATCAATAAATTTTATAGG + Intronic
1021682691 7:23150480-23150502 TTTCATTCCATATTATTTATTGG + Intronic
1021979665 7:26041811-26041833 ATTCAAACCATACACTATATCGG - Intergenic
1022353992 7:29594357-29594379 ATTAAATCCATAATATTTATAGG + Intergenic
1022612696 7:31892976-31892998 AATCACTCCACAATCTATATAGG + Intronic
1023305442 7:38821265-38821287 ATACAATCCATTTTCTTTGTAGG - Exonic
1026617325 7:71917037-71917059 GTTAAATCCATTATCTTTAGAGG - Intronic
1027381110 7:77610394-77610416 ATTCAATGTATAATCTATGTGGG - Intronic
1031468310 7:122140992-122141014 ATCCAAACCATAATATTTTTTGG + Intronic
1031609903 7:123813426-123813448 ATACAATCCAGTTTCTTTATAGG + Intergenic
1032376604 7:131425847-131425869 ATTATATCCATAATTTTTAAAGG + Intronic
1032610747 7:133409991-133410013 ACTCAGTCTCTAATCTTTATTGG - Intronic
1032969364 7:137141589-137141611 ATTCTATCCATAAAGTTTAAAGG + Intergenic
1034572243 7:151965396-151965418 ATTCAATCTATCATCTTTAAAGG + Intronic
1034587979 7:152112810-152112832 ATACAATGCATATTCTTTTTTGG - Intronic
1034606493 7:152320676-152320698 GTTCAATACTTAATTTTTATTGG - Intronic
1036341638 8:7920264-7920286 ATTTTATCCATATTGTTTATGGG + Intergenic
1037350969 8:17955031-17955053 ACTCAATCTGTAATCTTTACAGG - Intronic
1037394175 8:18424516-18424538 TTTCAATCCATAATCTTGTCTGG + Intergenic
1037718454 8:21420368-21420390 ATTCAAGCCATAAACATTTTGGG + Intergenic
1038402695 8:27297497-27297519 ATTCAATCAACAATTTTTATTGG + Intronic
1040463281 8:47670478-47670500 AATCGATCCACAAACTTTATGGG - Intronic
1040509699 8:48083468-48083490 ATTCAATCCATCACCTTAAATGG + Intergenic
1040841693 8:51791793-51791815 CTTCAATGCTTAATCATTATAGG + Intronic
1042493139 8:69425164-69425186 ATTTAAGCCATAGTCTTTGTTGG - Intergenic
1042516993 8:69670020-69670042 ATTAAGTCCTTATTCTTTATAGG - Exonic
1042702436 8:71630482-71630504 ACACAATCCAGAGTCTTTATTGG - Intergenic
1044245923 8:89944945-89944967 ATCCAATCCAAAATTTCTATAGG - Intronic
1044833524 8:96273931-96273953 ACTCACTCCATAATCATGATGGG - Intronic
1045140874 8:99280937-99280959 ATTCAATCCTTAGTCTCTTTTGG + Intronic
1045399972 8:101804913-101804935 ATTCAGTTCAAAATGTTTATAGG - Intronic
1045446962 8:102276541-102276563 ATTCAATCCATATTGCTTCTAGG + Intronic
1045627561 8:104073394-104073416 ATTCAACAAATAATGTTTATTGG + Intronic
1045639015 8:104226465-104226487 ATTCATTCAAAAATATTTATTGG + Intronic
1045682324 8:104676027-104676049 GTTCAATCCTTTACCTTTATCGG - Intronic
1045762112 8:105621779-105621801 ATTCATTCAATAATATTTATAGG - Intronic
1045798385 8:106073135-106073157 ATTAAATAAATAATCTTTCTAGG + Intergenic
1046217680 8:111171130-111171152 ATTCCTTCAATAAGCTTTATAGG - Intergenic
1046652282 8:116849868-116849890 ATCCAATCCATAACCTTTTTTGG + Intronic
1047670909 8:127145832-127145854 ATTCAATCAATAATTTGAATCGG - Intergenic
1048937853 8:139371694-139371716 AATAAATCAACAATCTTTATTGG - Intergenic
1050199741 9:3131630-3131652 ATTCAATACATACTATGTATGGG - Intergenic
1051774369 9:20619549-20619571 ATTTGATCCGTAATCTTTATTGG - Intronic
1055396336 9:75878722-75878744 ATTCAGTTCACAATATTTATTGG + Intergenic
1055896600 9:81184132-81184154 ATTGAATTCATGATCTTTCTTGG - Intergenic
1055960185 9:81813119-81813141 TTTCACTCAATAATATTTATTGG + Intergenic
1056030649 9:82549756-82549778 ATTCAATCAATAATAGATATAGG + Intergenic
1058601095 9:106671159-106671181 TTTCAATGAATAATATTTATTGG + Intergenic
1186390644 X:9155332-9155354 ATTCATTCAACAATGTTTATTGG + Intronic
1186804624 X:13127574-13127596 ACTCTATCCATGATCTTTATGGG + Intergenic
1187649066 X:21380193-21380215 ATTCAATACACATTCTTTGTGGG - Intronic
1188216047 X:27478456-27478478 ATGTAATCCAAACTCTTTATGGG - Intergenic
1188927087 X:36057036-36057058 ATTCAATCCCTAATTGTCATAGG - Intronic
1189632345 X:42968396-42968418 ATTTAAGCCATAATTTTTTTGGG - Intergenic
1189704510 X:43746622-43746644 CTTCAATCCATACTCTTCAGTGG - Exonic
1195390630 X:104358470-104358492 ATTAACTCCATAAAGTTTATAGG + Intergenic
1196924425 X:120619635-120619657 ATTCAAATCACCATCTTTATGGG + Intronic
1197463906 X:126780212-126780234 TTGCAATCAATAATCTTTAAAGG + Intergenic
1198131597 X:133701050-133701072 ATTCATTCAAAAATATTTATTGG + Intronic