ID: 927812236

View in Genome Browser
Species Human (GRCh38)
Location 2:26186511-26186533
Sequence CACTGCTGTCTGGGTGTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 330}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927812226_927812236 16 Left 927812226 2:26186472-26186494 CCGAGGGTGCAGCTCCCTGTGCA 0: 1
1: 0
2: 3
3: 18
4: 243
Right 927812236 2:26186511-26186533 CACTGCTGTCTGGGTGTCTTGGG 0: 1
1: 0
2: 3
3: 19
4: 330
927812225_927812236 17 Left 927812225 2:26186471-26186493 CCCGAGGGTGCAGCTCCCTGTGC 0: 1
1: 0
2: 1
3: 25
4: 214
Right 927812236 2:26186511-26186533 CACTGCTGTCTGGGTGTCTTGGG 0: 1
1: 0
2: 3
3: 19
4: 330
927812230_927812236 2 Left 927812230 2:26186486-26186508 CCCTGTGCAGTGGCTCAGGGATT 0: 1
1: 0
2: 2
3: 48
4: 1346
Right 927812236 2:26186511-26186533 CACTGCTGTCTGGGTGTCTTGGG 0: 1
1: 0
2: 3
3: 19
4: 330
927812231_927812236 1 Left 927812231 2:26186487-26186509 CCTGTGCAGTGGCTCAGGGATTG 0: 1
1: 0
2: 2
3: 19
4: 233
Right 927812236 2:26186511-26186533 CACTGCTGTCTGGGTGTCTTGGG 0: 1
1: 0
2: 3
3: 19
4: 330
927812224_927812236 28 Left 927812224 2:26186460-26186482 CCTGGGAGATTCCCGAGGGTGCA 0: 1
1: 0
2: 0
3: 7
4: 95
Right 927812236 2:26186511-26186533 CACTGCTGTCTGGGTGTCTTGGG 0: 1
1: 0
2: 3
3: 19
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927812236 Original CRISPR CACTGCTGTCTGGGTGTCTT GGG Intronic
900016385 1:153236-153258 CCCTGCTGTTTGGGTGTTTATGG - Intergenic
900046647 1:511828-511850 CCCTGCTGTTTGGGTGTTTATGG - Intergenic
900068852 1:753545-753567 CCCTGCTGTTTGGGTGTTTATGG - Intergenic
900578310 1:3395042-3395064 AGTTCCTGTCTGGGTGTCTTGGG + Intronic
901029569 1:6299113-6299135 CACTGCCGGCTGGGTGACCTTGG + Intronic
901131530 1:6964481-6964503 CACTGCAGTCTTTGTTTCTTGGG + Intronic
901376786 1:8845296-8845318 CACCGCTGGCTGTGTGGCTTTGG - Intergenic
901851880 1:12021018-12021040 CACTGCAGCCTGGGTCTCCTGGG + Intronic
901937628 1:12637458-12637480 CACTCCAGTCTGGGTGTCACAGG - Intergenic
902328110 1:15716002-15716024 GACTGCTGACTGGGTGCCTCTGG + Intronic
903274108 1:22209873-22209895 CACTGCTGTCTGGGAGGCACCGG - Intergenic
903665458 1:25004562-25004584 AGCTTCTGGCTGGGTGTCTTGGG + Intergenic
903789651 1:25884002-25884024 CACTGCTGTCTGGAATTCCTGGG - Intergenic
904177749 1:28642980-28643002 CGCTGCTGCCTGTGAGTCTTGGG - Exonic
905927967 1:41765470-41765492 CCCTGTTGTTTGAGTGTCTTTGG + Intronic
906440678 1:45841018-45841040 CACTGCAGTCTGGACCTCTTGGG + Intronic
908591538 1:65641455-65641477 CACTGCTTTCTCTGTGACTTTGG - Exonic
911153192 1:94615007-94615029 TGCTGCTCTCTGGGTCTCTTGGG - Intergenic
912021747 1:105114827-105114849 CACTGCTGTCAGAGTCTATTTGG - Intergenic
912705038 1:111905297-111905319 CCCTGCTGCCTGGGTGTTCTGGG - Intronic
914047789 1:144105194-144105216 CTTGGCTGTCTGGGTGGCTTGGG + Intergenic
916092818 1:161321586-161321608 CACTTCTTTCTGGGAGCCTTGGG + Intronic
916947888 1:169747466-169747488 GTCTGCTGACTGGGTGGCTTTGG + Intronic
917327204 1:173845505-173845527 CACTGCTGCCTTGATTTCTTAGG + Intronic
918834858 1:189449502-189449524 CACTCCTGTCTGGGTGACAGAGG - Intergenic
919161969 1:193841691-193841713 CACTGCAGTCTTAGTCTCTTGGG + Intergenic
920264442 1:204711359-204711381 CACCGCAGGCTGTGTGTCTTTGG + Intergenic
921496317 1:215846286-215846308 CACTGCAGCCTTGATGTCTTGGG + Intronic
921622691 1:217343604-217343626 CTGTGCTTTCTGAGTGTCTTTGG - Intergenic
922755476 1:228094262-228094284 CCCTGCTGACTTGGTGTCCTAGG + Intronic
923473210 1:234310380-234310402 CACTGCTGTTTGGGTAACTTAGG - Intronic
923576213 1:235161234-235161256 AGCTGCAGTCTGGGAGTCTTTGG - Exonic
1062767262 10:75271-75293 CACTGCAGCCTCGGTGTCCTGGG - Intergenic
1063260224 10:4379454-4379476 CACTCCTGTGTGAGTGTGTTTGG + Intergenic
1063549073 10:7011835-7011857 CACTGCTGCCTGAGTCTTTTTGG + Intergenic
1064115163 10:12571418-12571440 CACTGCAGTCTGGGTGACAGAGG + Intronic
1066064330 10:31751107-31751129 CACTGCAGTCTGGAACTCTTGGG - Intergenic
1066553252 10:36582632-36582654 CACTCCTGTCTGGGTGACATAGG + Intergenic
1068888958 10:62128368-62128390 CACTGCTTTCTGTGTGCCTTTGG - Intergenic
1069330845 10:67291069-67291091 CATTGCTCTCTGGCTGTTTTTGG + Intronic
1071415126 10:85433991-85434013 TACTGCTGCCTGGGTGTCTGGGG - Intergenic
1072346545 10:94513343-94513365 CACTGCTGTCTGGGAGTCCTGGG - Intronic
1074456882 10:113603230-113603252 CACTACTGGCTGGGTGACCTTGG - Intronic
1074973400 10:118561507-118561529 CACTGTGGTCAGGTTGTCTTGGG - Intergenic
1076889686 10:133277418-133277440 AGCTGCTGTCTGGGGATCTTAGG - Intergenic
1076896577 10:133316125-133316147 CACTGCTGGCTGGGTGGCGGAGG - Intronic
1076972976 11:148305-148327 CCCTGCTGTTTGGGTGTTTATGG - Intergenic
1077231928 11:1461607-1461629 CCCTGCCGTCTGCGTGTCTCAGG + Exonic
1077365464 11:2159752-2159774 CTGTGCCGTCTGTGTGTCTTGGG - Intronic
1077416761 11:2427561-2427583 CCTTGGTGTCTGGGTGGCTTTGG - Intergenic
1078869652 11:15331506-15331528 AAATCCTGGCTGGGTGTCTTTGG + Intergenic
1079100533 11:17538851-17538873 AGCTGCTGTCTGGGCCTCTTTGG + Intronic
1079649443 11:22908427-22908449 CACTCCAGTCTGGGTGTCAGAGG + Intergenic
1079755712 11:24258315-24258337 CACTACTATCTGTGTGTCTCTGG - Intergenic
1080212572 11:29803954-29803976 CACTTCTGTCTCTGTGTATTGGG + Intergenic
1081524610 11:43917722-43917744 CACTGCCCTCTGGTTGTCTGAGG + Intronic
1082049945 11:47762832-47762854 CACTGCAGTCTCTGTGTCCTGGG - Intronic
1082258685 11:50060958-50060980 CACTGCTGAAGGGCTGTCTTGGG + Intergenic
1083384555 11:62297921-62297943 CACTGCAGCCTGAATGTCTTGGG + Intronic
1083820661 11:65169664-65169686 CTCTGGTGTCTGGATGTCTGTGG - Intergenic
1084113101 11:67025934-67025956 CACCGCTGGCTGTGTGGCTTTGG + Intronic
1085119735 11:73959352-73959374 GCCTGCTGTCTGGCAGTCTTTGG - Intronic
1085709276 11:78814311-78814333 CACTGCTTCCTGGGTTTCCTGGG - Exonic
1085805056 11:79628317-79628339 CACTGCTCTCTATGTGACTTGGG - Intergenic
1087173019 11:95069775-95069797 GACTGCTCTGTGTGTGTCTTTGG - Exonic
1087565182 11:99846885-99846907 GGCTGCTATCTTGGTGTCTTTGG - Intronic
1088576716 11:111279313-111279335 CACCCCTGTATTGGTGTCTTAGG + Intronic
1088798632 11:113286064-113286086 CACTGCTGTGTGGCTGTCAAAGG - Intergenic
1088963085 11:114690555-114690577 CACTGATGACTGTGTGCCTTGGG + Intronic
1091987067 12:4919228-4919250 CACTGCTGTTGGGGTGTCTTGGG - Intronic
1092025093 12:5233215-5233237 TACTGCTGTCTGGCTGCCTGGGG - Intergenic
1093607498 12:21110583-21110605 CACTGCTGTCTCAGTATCCTAGG + Intronic
1094173676 12:27520942-27520964 CACTGGCCTCTGGGTGTCTTGGG - Intergenic
1094396809 12:30015755-30015777 CACTCCTGTCAGGGTTTCCTAGG + Intergenic
1094484266 12:30911908-30911930 CTCTGCTGCCCGGATGTCTTTGG - Intergenic
1095169229 12:39014059-39014081 TACTGCTGTCAGTTTGTCTTAGG - Intergenic
1096128968 12:49142141-49142163 CACTGCAGTCTCGGTCTCCTGGG + Intergenic
1097754033 12:63389443-63389465 CACTGCAGCCTCGGTGTCCTGGG + Intergenic
1097808905 12:63996797-63996819 CACTGCTAGCTGGTTCTCTTGGG + Intronic
1099463137 12:82948287-82948309 CACTGCAGCCTGAGTCTCTTGGG - Intronic
1099565006 12:84231265-84231287 CAATGCACTCTGGGTGTCTAAGG - Intergenic
1101048645 12:100837684-100837706 CACTCCAGTCTGGGTGGCTGAGG + Intronic
1104734532 12:131128843-131128865 CCCTGCTGTCTGGGTGTGGACGG + Intronic
1104734665 12:131129429-131129451 CCCTGCTGTCTGGGTGTGACAGG + Intronic
1105503737 13:20992715-20992737 CTCTGCTGTCTGGGTAACTGTGG - Intronic
1107290967 13:38852778-38852800 CACTGCAGTCTCCGTGTCTTAGG + Intronic
1107411145 13:40159833-40159855 GACTGTGCTCTGGGTGTCTTTGG - Intergenic
1108206284 13:48093737-48093759 TTCTGCTGTCTAGGTGTTTTCGG + Intronic
1108677154 13:52746951-52746973 CATTGATGTCTGGCTGTCATAGG + Intergenic
1110147201 13:72205949-72205971 TCCTGCTGTCTGGGTGGCTGTGG + Intergenic
1111201158 13:84939187-84939209 CATTGTTGTTTGTGTGTCTTGGG + Intergenic
1112588033 13:100737033-100737055 CACTCCTGCCTTGCTGTCTTGGG - Intergenic
1113941164 13:114019228-114019250 CACTGCTGGGTGTGGGTCTTAGG - Intronic
1115836311 14:37408593-37408615 CACTGCAGCCTGGGTGTCAGAGG + Intronic
1116805833 14:49493311-49493333 CACTTGTGTCTGTGTGTGTTGGG - Intergenic
1118523109 14:66609402-66609424 ATCTGATGTCTGTGTGTCTTGGG + Intronic
1119003012 14:70900058-70900080 CACTGCAGTCTGGACCTCTTGGG + Intergenic
1119690872 14:76671499-76671521 AACTGCTGGCAGGGTGACTTTGG - Intergenic
1119773022 14:77233245-77233267 CACTGCTGACTGGGGCTCTCGGG - Intronic
1121270925 14:92637886-92637908 TACTACTGGCTGGGGGTCTTGGG + Intronic
1121728796 14:96172145-96172167 CTCTGCTATGTGGGTGCCTTAGG + Intergenic
1122418913 14:101563445-101563467 AACTGCTTTCTGGTTGCCTTTGG + Exonic
1123708628 15:22969108-22969130 CACTGCTTTCAGAGTGTTTTGGG + Intronic
1125348116 15:38740308-38740330 CACTGCAGCCTGGGTGGCCTCGG - Intergenic
1125936397 15:43639834-43639856 CAATTCTGCCTGGGTGCCTTGGG - Intronic
1125949165 15:43736346-43736368 CAATTCTGCCTGGGTGCCTTGGG - Intergenic
1127968222 15:63939738-63939760 CACTGCTGTGTGGGTGTGAAAGG + Intronic
1129087532 15:73111652-73111674 CACTCCAGTCTGGGTGACTGAGG - Intronic
1129373705 15:75114277-75114299 TACTGCTGTCTGGGGGTTTGTGG + Intronic
1131727109 15:95238838-95238860 CACTCCTGTCTGGGTTTCGAAGG + Intergenic
1131762081 15:95635379-95635401 CATTTCTGTGTGGGTTTCTTAGG - Intergenic
1132930560 16:2456915-2456937 CACTGCTCTCCGGGGGACTTGGG - Exonic
1133537475 16:6715840-6715862 CAATACTGTCTGGGTTTCTTAGG + Intronic
1133698798 16:8289918-8289940 CACTGATGGCTGGGTGACCTTGG - Intergenic
1135134959 16:19880728-19880750 GTCTGCTCTCTGGGTGTCCTGGG - Intronic
1136390396 16:29960758-29960780 CGCTGCAGTCTGGACGTCTTGGG - Intronic
1138335188 16:56247232-56247254 CCCTGCTGTCTCCCTGTCTTGGG + Intronic
1139748825 16:69096138-69096160 CACTGCAGTCTCGGCCTCTTAGG - Intergenic
1139921726 16:70464800-70464822 CACTGCAGCCTTGGTCTCTTGGG - Intronic
1140078942 16:71726077-71726099 CACTGCAGTCTGGGTGACAGAGG + Intergenic
1140529866 16:75655694-75655716 CACTGCTGTATGAATGTATTAGG - Intronic
1141656334 16:85418606-85418628 CACTGCTGTCTGTGGGACGTTGG + Intergenic
1142110146 16:88326969-88326991 CCCTCCTGTCTGTCTGTCTTTGG + Intergenic
1142352197 16:89585641-89585663 CACTGCTGTCTGGGGGCCCCAGG - Intronic
1142447276 16:90149221-90149243 CCCTGCTGTTTGGGTGTTTATGG + Intergenic
1142460217 17:86110-86132 CCCTGCTGTTTGGGTGTTTATGG - Intergenic
1144624853 17:16839442-16839464 CACTGGGGTATGGGTGACTTTGG - Intergenic
1144881577 17:18433279-18433301 CACTGGGGTATGGGTGACTTTGG + Intergenic
1145150656 17:20511107-20511129 CACTGGGGTATGGGTGACTTTGG - Intergenic
1145257331 17:21333601-21333623 CTCTTCTGCCTGGGTATCTTGGG - Intergenic
1145319309 17:21754434-21754456 CTCTTCTGCCTGGGTATCTTGGG + Intergenic
1146603955 17:34242216-34242238 CACTGCTTTCTCTGTGTTTTAGG + Intergenic
1147201856 17:38807678-38807700 CACTGCTGTCTTGACCTCTTAGG - Intronic
1147537515 17:41330293-41330315 CACTGCTTCCTGGATCTCTTGGG - Intergenic
1147578998 17:41618137-41618159 CACTGGGGTATGGGTGACTTTGG - Intergenic
1147867962 17:43566130-43566152 CACTGCTGGCTGGAACTCTTGGG + Intronic
1148845417 17:50527144-50527166 GAGAGCTGTCTGGGTGCCTTTGG - Intronic
1149387613 17:56157361-56157383 CACTGCTGAGTGGGTCTCTCTGG + Intronic
1150531452 17:65987634-65987656 CAGTGCTGTCTGTTTGTTTTTGG - Intronic
1152347201 17:79760462-79760484 CACTGCTGCCTGGGGGGCTGAGG - Intergenic
1152640790 17:81448377-81448399 CACTGTTGTCCGGCTGTCCTTGG - Intronic
1153564344 18:6404760-6404782 CACTGCTGCCTCGGTCTCCTGGG + Intronic
1155265217 18:24085905-24085927 CGCTGCTGTCTGGGCACCTTGGG - Intronic
1155508715 18:26555939-26555961 AACTGGTATCTGGGTGTATTGGG + Intronic
1156279910 18:35627099-35627121 CAGTGCTGTGTAGGTGTCTTTGG + Intronic
1157755790 18:50216354-50216376 CACTGCTGCTTGGGTTTTTTTGG - Intergenic
1157799226 18:50605466-50605488 CACTGCTGACTGGTTTTGTTGGG - Intronic
1158402758 18:57135918-57135940 TACTGCTATCTGCCTGTCTTGGG - Intergenic
1158670463 18:59469463-59469485 CCATACTGTCTGGGTGTGTTGGG - Exonic
1160411960 18:78681177-78681199 CACTGCAGTGTGTGTGTGTTGGG + Intergenic
1160507530 18:79435633-79435655 TTCTGCCATCTGGGTGTCTTGGG + Intronic
1160649932 19:218610-218632 CCCTGCTGTTTGGGTGTTTATGG - Intergenic
1160987144 19:1844299-1844321 CACTGCTGTTTGGGGGTCACAGG + Intronic
1161252790 19:3290091-3290113 CCCTTCTTTCTGGGTGTCTGAGG + Intronic
1161320101 19:3637185-3637207 CTCTCGTGTCAGGGTGTCTTGGG - Intronic
1161988981 19:7673218-7673240 TACTGCTGTGTGTGTGTGTTGGG + Intergenic
1162395194 19:10414150-10414172 CACTGCAGCCTGGGTGACCTGGG - Intronic
1163161229 19:15465251-15465273 CACTCCAGTCTGGGTGACATAGG + Intergenic
1163670800 19:18627284-18627306 CTCTGCTGTCTGGGAATGTTTGG - Intergenic
1164753832 19:30675026-30675048 CACTGTTATCTGTGTCTCTTGGG - Intronic
1165412326 19:35669826-35669848 CAGTGCTGTCTCTGTGTCATTGG - Intronic
1165535430 19:36440332-36440354 CACTGCAGTCTTGATGTCCTGGG - Intergenic
1165877923 19:39022730-39022752 CCCAGCTGTCTGGGAGTCTGAGG - Intronic
1166609944 19:44182411-44182433 CACTGCTGTCTGGCAGTGTCTGG - Intergenic
1167331387 19:48858762-48858784 CATTGCTCCCTGGGTGTCATGGG - Intronic
1167645021 19:50700958-50700980 CACTGGTCTCTGGGTCTCTAGGG - Intronic
1167665611 19:50821520-50821542 CAAGGCTGCCTGGGTCTCTTGGG - Intronic
1167708782 19:51097929-51097951 CCCTTCCGACTGGGTGTCTTAGG + Exonic
926063768 2:9821248-9821270 CACAGCTGTCTGGGAGGCTGAGG + Intergenic
927812236 2:26186511-26186533 CACTGCTGTCTGGGTGTCTTGGG + Intronic
928214846 2:29352681-29352703 CACTACAGCCTAGGTGTCTTGGG - Intronic
928808216 2:35188253-35188275 CACTTATATCTGTGTGTCTTTGG + Intergenic
928835600 2:35541122-35541144 CACTCCAGTCTGGGTGACCTGGG - Intergenic
928876741 2:36048913-36048935 CACTTCTGGCTGGGTGTTATAGG + Intergenic
929298204 2:40271940-40271962 CACTGCAGCCTCGATGTCTTGGG + Intronic
931404651 2:61964294-61964316 CACTGCAGTCTTGATCTCTTGGG + Intronic
931639518 2:64369723-64369745 CAATGATGTCTTGGTGTCTCAGG - Intergenic
931819590 2:65937935-65937957 CTTTGCTGTGTGGGTGTGTTTGG - Intergenic
932618755 2:73253239-73253261 CACTGCTCTCAGGGTTTCTCTGG + Intergenic
933290080 2:80428116-80428138 CACTGCTGCCCTGGGGTCTTTGG - Intronic
937023515 2:118679435-118679457 TACTGCTGTCTTGGTGTGTGGGG - Intergenic
937078360 2:119123491-119123513 CGCTGCTGCCTGGCTTTCTTGGG - Intergenic
939659227 2:144867455-144867477 CACTGCAGCCTGGGTGACATAGG + Intergenic
940854538 2:158719554-158719576 CACTCCTTTCCTGGTGTCTTGGG + Intergenic
941214831 2:162693626-162693648 CACTGATGGCTGGATGTCTCAGG + Intronic
942164518 2:173229147-173229169 CTCTGCAGCCTGGGTTTCTTAGG + Intronic
945149132 2:206769551-206769573 CACTGCTATCTGGGTCTCAAGGG - Intronic
946096799 2:217281496-217281518 GACTGCTGGCTGGGTGTGGTGGG - Intergenic
946104801 2:217359793-217359815 CCCTGGTGTCTGGCTGCCTTCGG - Intronic
946295713 2:218782115-218782137 CACTGCTGTCTGGGCGGGTCCGG + Exonic
946829234 2:223711199-223711221 CACTCCAGCCTGGGTGTCTGAGG + Intergenic
947103957 2:226649171-226649193 TTCTGCTGTTTGGGTGTGTTCGG - Intergenic
948614106 2:239187273-239187295 GACTGCTGTCAGGGAGTCCTCGG + Intronic
948760078 2:240184875-240184897 CACAGCTGTGTGGGTGCCTCTGG - Intergenic
1169374141 20:5052866-5052888 CACTGCTGTCTTGGCCTCCTGGG + Intergenic
1170640284 20:18145800-18145822 CACTGCTGACTTGGTGAATTGGG + Intronic
1170892279 20:20386297-20386319 CACTGCTGTTTGTGTGTGTTGGG + Intergenic
1171158096 20:22895280-22895302 GACTCCTGTCTGTGTGTTTTGGG - Intergenic
1172935913 20:38619994-38620016 CACTGCTGCCTCGAAGTCTTGGG - Intronic
1173569118 20:44065595-44065617 GGCTGCTGGCTGGCTGTCTTGGG - Intronic
1174212766 20:48892839-48892861 CACTGGTTTCTGGGTGGGTTTGG + Intergenic
1178445745 21:32640106-32640128 CTCTGCTTTCTGTGTGGCTTTGG - Intronic
1178761337 21:35405509-35405531 CACAGCTGTGTGTGTTTCTTGGG - Intronic
1179643144 21:42760249-42760271 CACAGCCTTCTGGGTGGCTTTGG + Intronic
1180554587 22:16564236-16564258 CATGGCTGGCTGGCTGTCTTGGG - Intergenic
1180554822 22:16565267-16565289 CATGGCTGGCTGGCTGTCTTGGG - Intergenic
1181392441 22:22593531-22593553 CACTACTGTCTGGGGAACTTGGG + Intergenic
1181926603 22:26364556-26364578 CACTCCAGCCTGGGTGTCTTAGG + Intronic
1181973976 22:26714962-26714984 AACTTCTGTCTGGCTGTGTTCGG + Intergenic
1182383403 22:29913170-29913192 CACTGCTGTCTTGATGTCCTGGG - Intronic
949305661 3:2637615-2637637 CTCTGCTGTCTGTGTCTCTTGGG + Intronic
949736662 3:7180394-7180416 GATTGCTGTTTGGGTGTGTTAGG - Intronic
949904727 3:8849665-8849687 CACTGCTGCCTCGATCTCTTGGG + Intronic
950004780 3:9684697-9684719 CTCTGCTCTTTGGGTGTGTTAGG + Intronic
950101103 3:10357565-10357587 CACTGTTCTCTGGGGGTCTCTGG - Intronic
952763364 3:36934797-36934819 AACAGCTGACTGTGTGTCTTTGG - Intronic
952976596 3:38701785-38701807 CACCTCTGTTTGGGGGTCTTTGG - Intronic
954047652 3:47946618-47946640 CACTCCTGTCTGGGTGACAAAGG + Intronic
954318592 3:49815283-49815305 CACTGCAGCCTCAGTGTCTTGGG + Intergenic
954751780 3:52818014-52818036 CAGTGGTGTCTGGGTCTCTCTGG + Intronic
955301128 3:57780717-57780739 CACTGCAGTCTTGATTTCTTGGG + Intronic
955632698 3:60991464-60991486 TACAGCTGTCTGGGCGTCATGGG + Intronic
958920883 3:100104100-100104122 AACTGCTCTCTGTGTGTGTTTGG + Intronic
959889037 3:111533705-111533727 CACTGTTGTCTGGGTCCCTCTGG + Intronic
961413975 3:126744094-126744116 TACTGCTGTCAGGTTGTCCTAGG - Intronic
962808418 3:138943004-138943026 GCCTGGTGTCTGGGTGCCTTTGG - Intergenic
963057147 3:141194767-141194789 CTTTGCTGTTTGGGTGACTTAGG + Intergenic
964634862 3:158847678-158847700 CTCTGCTTTCTGGGTGACTCAGG - Intergenic
967315801 3:188151308-188151330 AACTGTTGTATGGGTGTGTTGGG - Intergenic
967384454 3:188897888-188897910 CACTGCTGCCTGGGTGACAGAGG - Intergenic
968367914 3:198201519-198201541 CCCTGCTGTTTGGGTGTTTATGG + Intergenic
971640011 4:29118620-29118642 CACTACTGTGTGGGTTTCTGTGG + Intergenic
971798013 4:31253784-31253806 CACTGATGTCTGGGTCTGTTGGG + Intergenic
972506783 4:39727392-39727414 CACTCCTGCCTGGGTGACTGTGG - Intronic
973701802 4:53544868-53544890 AATTGCTGGCTGTGTGTCTTTGG - Intronic
973980557 4:56305143-56305165 CACTGCAGCCTGGATGTCCTGGG - Intronic
974462846 4:62210127-62210149 CTCTGCAGTCTAGTTGTCTTGGG + Intergenic
975168648 4:71207886-71207908 CACTGCAGTCTGCACGTCTTAGG + Intronic
975662469 4:76701160-76701182 GAATGCTGTCTGGGTGTCAGGGG + Intronic
976015196 4:80543873-80543895 AACTGATGACTGTGTGTCTTGGG - Intronic
977180797 4:93871070-93871092 CAATGCTCTCTGGGTGTGCTAGG + Intergenic
978326187 4:107559456-107559478 AAGTGCTGTATGGGTTTCTTAGG - Intergenic
978727182 4:111983161-111983183 AACTCCTCTCTTGGTGTCTTTGG - Intergenic
979433101 4:120656456-120656478 CACTTCTATCTTGATGTCTTGGG - Intergenic
981253056 4:142626899-142626921 CACAGCTTTATGGGTGTTTTTGG - Intronic
981516741 4:145618684-145618706 CACTGCTGCAGGGGTGTCCTCGG - Exonic
984403121 4:179292460-179292482 CATTACTGTGTGGGTGACTTTGG + Intergenic
984802723 4:183729643-183729665 CACTGCTGCCTGGGTGGATGAGG + Intergenic
985754471 5:1704861-1704883 CACTGCTCCCTGGGTGGCCTGGG + Intergenic
986181863 5:5400564-5400586 CACTGCTCTCTCAATGTCTTGGG - Intergenic
986594180 5:9403450-9403472 CCTTGCTGGCTGGGTGACTTTGG + Intronic
986706343 5:10457491-10457513 CAGTCCTGGCTGGGTGACTTGGG + Intronic
987562377 5:19540542-19540564 AACTTCTGTCTGGGTGTCCAGGG + Intronic
988299004 5:29397576-29397598 CACTGGAGTTTGGGTGTTTTTGG - Intergenic
990826368 5:59903719-59903741 CCTTGCTGTCTGTGTGTCCTTGG - Intronic
991063202 5:62400321-62400343 CACTGCTGCCTCGAAGTCTTGGG + Intronic
992695275 5:79279917-79279939 CACTGCAGTCTCGATGTCCTGGG + Intronic
994986700 5:106942450-106942472 CAATGGTGACTGGATGTCTTTGG - Intergenic
995419215 5:111944421-111944443 CCCAGCTGCCTGGGAGTCTTAGG - Intronic
996082714 5:119273114-119273136 CCCTGCTGGCTGTGTGGCTTTGG + Intronic
997384360 5:133460718-133460740 CACTGCTGGCTGTGTGACTTTGG + Intronic
997592589 5:135085081-135085103 CTTTGCTGCCTGGGTGTCATGGG + Intronic
1000743190 5:164995998-164996020 AACTGCTGTCTGTGTGTGTGGGG + Intergenic
1002727133 5:181306748-181306770 CCCTGCTGTTTGGGTGTTTATGG + Intergenic
1002774918 6:320541-320563 CACTGCAGCCTGGTTGCCTTTGG + Intronic
1002799411 6:507064-507086 CACTGCTGTGTGTGTGTGTGTGG - Intronic
1002799424 6:507192-507214 CACTGCTGTGTGTGTGTGTGGGG - Intronic
1003630021 6:7778437-7778459 CATTGCTGGCTGTGTGACTTCGG - Intronic
1004296613 6:14417600-14417622 CACTGCAGTCTCGGCTTCTTGGG + Intergenic
1005428308 6:25727186-25727208 CACTGCTGTCTGAATCTCTCTGG - Exonic
1005439362 6:25849124-25849146 CACAGCTGCATAGGTGTCTTGGG - Intronic
1007054554 6:38869399-38869421 CACTCCAGCCTGGGTGACTTAGG - Intronic
1007077604 6:39078000-39078022 CGCTGCTGTTTGTGTGTCTGTGG + Intronic
1010226872 6:73498133-73498155 CACTGCAGCCTCAGTGTCTTGGG - Intronic
1011165674 6:84443176-84443198 CACTGCTAACTGTCTGTCTTTGG + Intergenic
1012932174 6:105328766-105328788 GACTGGTGTTTGGGTTTCTTTGG - Intronic
1013033601 6:106360270-106360292 CTCTGATCTCTGGGTGGCTTGGG - Intergenic
1013183557 6:107738173-107738195 CACAGCTCCCTGGGTGTTTTAGG - Intronic
1014802301 6:125790820-125790842 CGCCGCAGTCGGGGTGTCTTAGG - Exonic
1014983517 6:127974527-127974549 CACTGAAGGCTGTGTGTCTTGGG + Intronic
1016739310 6:147510543-147510565 CAGTGTTGTGTGGGTATCTTGGG + Intronic
1017619430 6:156280674-156280696 CACTTCTGTTTGTCTGTCTTTGG - Intergenic
1018667567 6:166153374-166153396 CACTGCTGCCTGGGCCTCCTAGG + Intergenic
1019625603 7:2014275-2014297 CTCCGCTGTCAGGGTGTCTCAGG - Intronic
1019627020 7:2021356-2021378 CTCTGCTGCCTGAGTGGCTTCGG - Intronic
1022358480 7:29638093-29638115 CGACCCTGTCTGGGTGTCTTTGG + Intergenic
1022755333 7:33281888-33281910 CACTGCTGCCTTGATCTCTTGGG + Intronic
1023725584 7:43139861-43139883 CATTACTGTCTGGGTGTCTTAGG + Intronic
1024621531 7:51162025-51162047 CACTGCTGTTTGTGTGACTTAGG + Intronic
1024740849 7:52352831-52352853 CTCTGCTGTCTGGGTAACTAGGG - Intergenic
1026926505 7:74197806-74197828 CACTCCTGTCTGGGTGACAGAGG - Intergenic
1027194707 7:76021729-76021751 CCCTGCTGTCTCAGTGTCATTGG + Intronic
1027852680 7:83468675-83468697 CACTGATGTCTTAGTGTGTTAGG + Intronic
1028534621 7:91878757-91878779 CACTGCAGTCTGGATCTCCTGGG - Intronic
1030214411 7:107029294-107029316 AACTGCTGTCTCGGGGGCTTTGG + Intergenic
1035266904 7:157693971-157693993 CCCTGCCGTCTGGGGGTCCTGGG + Intronic
1035474456 7:159132262-159132284 CACTGCTGTCTTGCTGCATTTGG + Intronic
1035478799 7:159164626-159164648 CACTGCTGTCTTGCTGCATTTGG - Intergenic
1035862271 8:3042100-3042122 CCCTCCTGCCTGGGTGGCTTGGG - Intronic
1038111469 8:24504290-24504312 CACTGCAGTCTGGATCTCCTGGG - Intronic
1038654846 8:29440159-29440181 CACTGCTGTCTTGATCTCCTGGG + Intergenic
1038689610 8:29749238-29749260 GACTGCTCTCTGGGTGTTTACGG + Intergenic
1038730585 8:30123187-30123209 CACTTCTGACTGGTTTTCTTGGG - Intronic
1039911559 8:41830727-41830749 AACTGGTGTCTGCGTTTCTTTGG - Intronic
1040737955 8:50534224-50534246 CTTTGCTGGCTGGGTGACTTGGG + Intronic
1040947717 8:52901443-52901465 CACTGCTGGTTGGGTCCCTTGGG - Intergenic
1041292653 8:56321353-56321375 CACTGCTGTGTGGGGCTCTGGGG + Intergenic
1044615913 8:94140394-94140416 CACTGCAGCCTGGGTGACTGAGG + Intronic
1045534352 8:103013122-103013144 CAAGGCTGTCTGGGTCCCTTGGG - Intergenic
1045768467 8:105705681-105705703 CACTGCAGTCTGTGTGGCTCTGG - Intronic
1047627081 8:126667220-126667242 CAATGCTGTTTGGGTCTCTCAGG - Intergenic
1047742845 8:127820645-127820667 CCCTGCTGACTGTGTGACTTTGG + Intergenic
1048329513 8:133462501-133462523 CACTGCTGGCTGTGTGACATTGG - Intronic
1049363848 8:142226988-142227010 CACTGCTGTGTGGGTGCAGTGGG - Intronic
1049363856 8:142227023-142227045 CACTGCTGTGTGGGTGCAGTGGG - Intronic
1049363865 8:142227058-142227080 CACTGCTGTGTGGGTGCAGTGGG - Intronic
1049547501 8:143240273-143240295 CACTGCTGGCTGTGTGCCTTGGG - Intergenic
1049864089 8:144922409-144922431 CCCTGCTGTCTCAGTGTCATTGG - Intergenic
1050724061 9:8626544-8626566 CATTACTGTCAGGGTGTTTTTGG + Intronic
1051275789 9:15396759-15396781 CAGTGTTCTCAGGGTGTCTTTGG + Intergenic
1051460435 9:17307300-17307322 CACTCCAGTCTGGGTGACATGGG - Intronic
1053417940 9:37958595-37958617 CATTGCTGTCTGTGTGTAGTTGG - Intronic
1055897084 9:81190252-81190274 CACTGCAGCCTTGATGTCTTGGG + Intergenic
1056427301 9:86490104-86490126 CCCAGCTGTCTGGGTGTCTGAGG - Intergenic
1058153319 9:101486100-101486122 CACTGCGCTCGCGGTGTCTTGGG - Intronic
1058511463 9:105723465-105723487 CACTGCAGTCTTGATCTCTTGGG + Intronic
1059791516 9:117645930-117645952 CCCTGCTGTCTGTGTGGCTGGGG + Intergenic
1060137273 9:121169560-121169582 CACAGCTGGCTCGGGGTCTTTGG + Intronic
1060828447 9:126699566-126699588 CACTGGTGTCTGGGAGCCTGTGG - Exonic
1061265303 9:129501362-129501384 CTCTCCTGGCTGGGTGACTTTGG - Intergenic
1061277481 9:129577687-129577709 CACTGCTGTGCTGGAGTCTTTGG - Intergenic
1061549563 9:131325507-131325529 CACTGGCGTCTGTGTGACTTTGG + Intergenic
1062688811 9:137830367-137830389 CACTGCTGTCAGGGTGCCATGGG + Intronic
1062721866 9:138048791-138048813 CACTGCAGTCTCTGTGTCCTGGG + Intronic
1062752255 9:138264224-138264246 CCCTGCTGTTTGGGTGTTTATGG + Intergenic
1185725718 X:2420026-2420048 CTCTCCTGTCTTGGTGTGTTTGG - Intronic
1186834250 X:13421459-13421481 CACTGCAGCCTGGGTGGCCTGGG + Intergenic
1187157914 X:16738297-16738319 CCCAGCTGTCTGGGTGGCTGAGG + Intronic
1187863786 X:23705937-23705959 CACAGTTGTCTGAGTGTATTGGG - Intronic
1188113309 X:26216626-26216648 CACTGCTGTCTGAGTGCCCACGG - Intronic
1189205995 X:39239279-39239301 AACTTCTGCCTGGGTCTCTTGGG - Intergenic
1189307272 X:39996277-39996299 CACTGCAGCCTGGATCTCTTGGG - Intergenic
1189437157 X:41003128-41003150 CACTGCAGCCTCTGTGTCTTGGG - Intergenic
1190407897 X:50105762-50105784 CACAGCTGTCTGCCTCTCTTTGG + Intergenic
1190679163 X:52810398-52810420 CACTGAAGTCTGGGTCTCTTGGG - Intergenic
1190844597 X:54180699-54180721 CACTTATCTCTGGGTGACTTTGG + Intronic
1192587086 X:72327780-72327802 CACTTCTTTCTTGGTCTCTTTGG + Intergenic
1193731465 X:85108326-85108348 GACTCATGTCTGGGTGGCTTGGG + Exonic
1194751082 X:97684833-97684855 CACTCCAGCCTGGGTGTCTCTGG - Intergenic
1196564259 X:117186487-117186509 CACTACTGGCTGTGTGACTTAGG - Intergenic
1196794909 X:119494487-119494509 CACTGCTGTCTGGATGCTTCTGG - Intergenic
1199982171 X:152927261-152927283 CAGAGCTGTCTGTGTGTCTAGGG + Intronic
1201893282 Y:18966337-18966359 CACTGCTGTCTAGGTGACAGAGG + Intergenic