ID: 927812237

View in Genome Browser
Species Human (GRCh38)
Location 2:26186512-26186534
Sequence ACTGCTGTCTGGGTGTCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 238}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927812226_927812237 17 Left 927812226 2:26186472-26186494 CCGAGGGTGCAGCTCCCTGTGCA 0: 1
1: 0
2: 3
3: 18
4: 243
Right 927812237 2:26186512-26186534 ACTGCTGTCTGGGTGTCTTGGGG 0: 1
1: 0
2: 1
3: 17
4: 238
927812225_927812237 18 Left 927812225 2:26186471-26186493 CCCGAGGGTGCAGCTCCCTGTGC 0: 1
1: 0
2: 1
3: 25
4: 214
Right 927812237 2:26186512-26186534 ACTGCTGTCTGGGTGTCTTGGGG 0: 1
1: 0
2: 1
3: 17
4: 238
927812224_927812237 29 Left 927812224 2:26186460-26186482 CCTGGGAGATTCCCGAGGGTGCA 0: 1
1: 0
2: 0
3: 7
4: 95
Right 927812237 2:26186512-26186534 ACTGCTGTCTGGGTGTCTTGGGG 0: 1
1: 0
2: 1
3: 17
4: 238
927812230_927812237 3 Left 927812230 2:26186486-26186508 CCCTGTGCAGTGGCTCAGGGATT 0: 1
1: 0
2: 2
3: 48
4: 1346
Right 927812237 2:26186512-26186534 ACTGCTGTCTGGGTGTCTTGGGG 0: 1
1: 0
2: 1
3: 17
4: 238
927812231_927812237 2 Left 927812231 2:26186487-26186509 CCTGTGCAGTGGCTCAGGGATTG 0: 1
1: 0
2: 2
3: 19
4: 233
Right 927812237 2:26186512-26186534 ACTGCTGTCTGGGTGTCTTGGGG 0: 1
1: 0
2: 1
3: 17
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927812237 Original CRISPR ACTGCTGTCTGGGTGTCTTG GGG Intronic
902328111 1:15716003-15716025 ACTGCTGACTGGGTGCCTCTGGG + Intronic
904881209 1:33698548-33698570 ACTGCTGCATGGGTGTAATGAGG + Intronic
906826826 1:48990633-48990655 ATTGCTGTCTGCTTGTTTTGTGG + Intronic
908617145 1:65934481-65934503 ATTGTTGTCTGTTTGTCTTGTGG - Intronic
915901232 1:159848001-159848023 ACTCCTGTGTAGGTTTCTTGAGG - Intronic
916409712 1:164534127-164534149 AGTTCTTTCTGGGAGTCTTGCGG - Intergenic
916936597 1:169634015-169634037 ACTGCTGTCTGAGCATCTGGTGG - Intergenic
922291168 1:224210096-224210118 ACTGTGGTCTGTGGGTCTTGGGG - Intergenic
923914292 1:238485369-238485391 ACTGCTGACTGGGTGTGAAGAGG + Intergenic
1063165806 10:3460983-3461005 AATGGTTTCTGCGTGTCTTGAGG - Intergenic
1065923764 10:30417486-30417508 ACTGCTGCCAGACTGTCTTGTGG + Intergenic
1066466250 10:35652833-35652855 ACTGGAGTTTGGTTGTCTTGTGG + Intergenic
1066553253 10:36582633-36582655 ACTCCTGTCTGGGTGACATAGGG + Intergenic
1067046324 10:42987260-42987282 ACTGGTGTGTGGGTGTGTGGTGG - Intergenic
1067283489 10:44890831-44890853 CCTGCTTTCTGGGTGTGGTGTGG - Intergenic
1068053444 10:51981773-51981795 TCTGATGACTGTGTGTCTTGGGG + Intronic
1068540364 10:58286705-58286727 ACTGCTGTTTTGGTGTCCAGTGG - Intronic
1068888957 10:62128367-62128389 ACTGCTTTCTGTGTGCCTTTGGG - Intergenic
1070811164 10:79298762-79298784 ACTGCTGCCTGGGCGCCTGGAGG + Intronic
1072268026 10:93749176-93749198 ATAGCTGTTTGGGTGTCCTGAGG - Intergenic
1075566729 10:123510460-123510482 GCTGCTGCATGGGGGTCTTGGGG - Intergenic
1076729667 10:132432092-132432114 CCTGCTGTCTGGGTGGTTGGTGG - Intergenic
1077365463 11:2159751-2159773 TGTGCCGTCTGTGTGTCTTGGGG - Intronic
1077711370 11:4540547-4540569 ACTGCTGTCCCTGTGTCTTCAGG - Intergenic
1078946197 11:16071114-16071136 CCTGCTGTCTGGGTGTTTCCTGG - Intronic
1078946220 11:16071256-16071278 CCTGCTGTCTGGGTGTTTCCTGG - Intronic
1078993433 11:16671830-16671852 TCTGATGGCTGTGTGTCTTGAGG - Intronic
1080256583 11:30296984-30297006 ACTGATGACTCTGTGTCTTGAGG - Intergenic
1080311639 11:30900369-30900391 ATTGCCATCTGGGTGTCTTGTGG - Intronic
1080910155 11:36588759-36588781 GCTGCTTTCTGGGTCTCTGGTGG - Intronic
1084504008 11:69553895-69553917 ACTGCTGTGTGCGTGTGTGGAGG - Intergenic
1085521580 11:77142307-77142329 CCCACTGTCTGGGTGTCCTGTGG + Intronic
1086805188 11:91232814-91232836 ACTGTTGTATGGCTGTTTTGCGG + Intergenic
1088963086 11:114690556-114690578 ACTGATGACTGTGTGCCTTGGGG + Intronic
1090574479 11:128086271-128086293 CCTGCTGTCTGGGTGTTTCCCGG + Intergenic
1094173675 12:27520941-27520963 ACTGGCCTCTGGGTGTCTTGGGG - Intergenic
1095963583 12:47851473-47851495 ACTTCTGTGTGGGTGTGTGGGGG - Intronic
1101973715 12:109336659-109336681 ACTGTTGTCAGAGTGCCTTGAGG + Intergenic
1103241069 12:119413797-119413819 ACTGCTCTCTGAGGGGCTTGAGG - Intronic
1105759724 13:23502982-23503004 TCCTCTGTCTGGCTGTCTTGTGG + Intergenic
1106443661 13:29802985-29803007 TCTGATGACTGTGTGTCTTGGGG - Intronic
1108206285 13:48093738-48093760 TCTGCTGTCTAGGTGTTTTCGGG + Intronic
1109106070 13:58252676-58252698 ACTGCTGTCTGCCTTTCTAGTGG - Intergenic
1111079689 13:83286972-83286994 ACTGCTCTCTGTGTGGATTGTGG + Intergenic
1114266653 14:21076311-21076333 GCTGCTGTGTGTGTGTTTTGGGG - Intronic
1114530660 14:23393608-23393630 ACTCTAGTCTGGGAGTCTTGAGG + Intronic
1115307235 14:31945355-31945377 ACTGACATCTGGGTGCCTTGCGG - Intronic
1116805832 14:49493310-49493332 ACTTGTGTCTGTGTGTGTTGGGG - Intergenic
1117434854 14:55706106-55706128 AGGGCTGCCTGGGTGACTTGTGG + Intergenic
1117837626 14:59823732-59823754 TCTGATGACTGTGTGTCTTGGGG + Intronic
1118523110 14:66609403-66609425 TCTGATGTCTGTGTGTCTTGGGG + Intronic
1120023148 14:79552860-79552882 AACTCTGTCTGGGTGTGTTGTGG + Intronic
1120782928 14:88502203-88502225 GCTGCAGTGTGGGTGCCTTGAGG - Intronic
1123460119 15:20462235-20462257 ACTGATATCTGGGTCTTTTGCGG - Intergenic
1123657943 15:22538182-22538204 ACTGATATCTGGGTCTTTTGCGG + Intergenic
1124266342 15:28238006-28238028 ACTGATATCTGGGTCTTTTGTGG - Intronic
1124311854 15:28633381-28633403 ACTGATATCTGGGTCTTTTGTGG + Intergenic
1124465788 15:29938835-29938857 AGTCCTGTTTGGGTCTCTTGTGG - Intronic
1125936396 15:43639833-43639855 AATTCTGCCTGGGTGCCTTGGGG - Intronic
1125949164 15:43736345-43736367 AATTCTGCCTGGGTGCCTTGGGG - Intergenic
1126681952 15:51210820-51210842 ACACCTGTCTGAGTTTCTTGGGG + Exonic
1127554904 15:60078265-60078287 CCTGCTGTCTGCATCTCTTGTGG + Intergenic
1128348838 15:66875747-66875769 ACTGCTTTCAGGGTGACTCGTGG - Intergenic
1129559858 15:76554515-76554537 TCTGATGACTGTGTGTCTTGAGG - Intronic
1130841654 15:87706447-87706469 ACTGCTGCCTGGACGTCTTCTGG - Intergenic
1132244981 15:100287565-100287587 TCTGATGACTGTGTGTCTTGGGG - Intronic
1132592841 16:733863-733885 CCTGCTGGCTGAGTGTCTTCAGG + Intronic
1132930559 16:2456914-2456936 ACTGCTCTCCGGGGGACTTGGGG - Exonic
1133039918 16:3055193-3055215 ACTGCCCTCTGGGAATCTTGTGG + Intronic
1133537476 16:6715841-6715863 AATACTGTCTGGGTTTCTTAGGG + Intronic
1134387800 16:13790288-13790310 CCTGCTGTCTGGGTGTTAGGAGG - Intergenic
1136704531 16:32175419-32175441 ACTGATATCTGGGTCTTTTGGGG - Intergenic
1136763381 16:32753987-32754009 ACTGATATCTGGGTCTTTTGGGG + Intergenic
1136804719 16:33116399-33116421 ACTGATATCTGGGTCTTTTGGGG - Intergenic
1138085096 16:54126331-54126353 ACAGCTGTCTGTGTGTGTAGTGG - Intergenic
1138335190 16:56247233-56247255 CCTGCTGTCTCCCTGTCTTGGGG + Intronic
1138843479 16:60537731-60537753 TCTGATGACTGTGTGTCTTGGGG + Intergenic
1139153716 16:64415531-64415553 AGTACTCTCTGGGTGTCCTGAGG - Intergenic
1141474536 16:84263879-84263901 GCTTCTCTCTGTGTGTCTTGTGG - Intergenic
1203065531 16_KI270728v1_random:1014308-1014330 ACTGATATCTGGGTCTTTTGGGG + Intergenic
1143877255 17:10001468-10001490 CCTGCTGGCTGGGTGTCTCCCGG - Intronic
1143967856 17:10769739-10769761 TCTATTGTCTGGGTGTCATGTGG + Intergenic
1145257330 17:21333600-21333622 TCTTCTGCCTGGGTATCTTGGGG - Intergenic
1145319310 17:21754435-21754457 TCTTCTGCCTGGGTATCTTGGGG + Intergenic
1147666773 17:42154038-42154060 ACTGCTGTCCGTGTGTCTATAGG - Intronic
1149727748 17:58913648-58913670 ACTGCTGACTGGTTGAGTTGGGG + Intronic
1155265216 18:24085904-24085926 GCTGCTGTCTGGGCACCTTGGGG - Intronic
1155508716 18:26555940-26555962 ACTGGTATCTGGGTGTATTGGGG + Intronic
1157103592 18:44752347-44752369 ATAGCTGTCTGTGGGTCTTGAGG + Intronic
1157336082 18:46738621-46738643 ACTGCAGCCTGGGTGTGTGGTGG - Intronic
1157406715 18:47427984-47428006 ACAGCCGTCTCGGTGTCTGGAGG - Intergenic
1160411961 18:78681178-78681200 ACTGCAGTGTGTGTGTGTTGGGG + Intergenic
1160578024 18:79867982-79868004 CCTGCAGTCTGGGTGTCTGGCGG + Intronic
1161315055 19:3613832-3613854 GCTGCAGTCTCAGTGTCTTGTGG + Intronic
1161417086 19:4153476-4153498 ACCGTTATCTGGGTGTTTTGTGG - Intergenic
1161774670 19:6253520-6253542 ATTGCTGTGTGGTTTTCTTGTGG - Intronic
1161988982 19:7673219-7673241 ACTGCTGTGTGTGTGTGTTGGGG + Intergenic
1163628361 19:18403703-18403725 CCTGAGGTCTGGGGGTCTTGGGG + Intergenic
1165168890 19:33876898-33876920 AATGCTATTTGGGTGACTTGGGG - Intergenic
1165459384 19:35935648-35935670 CCGGCTGTCAGTGTGTCTTGAGG + Exonic
1165829285 19:38722547-38722569 ACTACTGTCCGGGTGCTTTGAGG + Intronic
1166741387 19:45116827-45116849 AGTGTTGTCTGGGTGTGGTGTGG + Intronic
1168405318 19:56107617-56107639 CCTGCTGTCTGTGAGCCTTGGGG - Intronic
924974787 2:162666-162688 ACTTCTGGGTGGGTGACTTGGGG + Intergenic
925201016 2:1967902-1967924 CCTGCTGTCTGTGTGTCCTCAGG + Intronic
925742782 2:7020240-7020262 AGGGATGTCTGGGTGTCTGGAGG + Intronic
927812237 2:26186512-26186534 ACTGCTGTCTGGGTGTCTTGGGG + Intronic
928229718 2:29487336-29487358 ACAGCTGTCTGGGGGTATGGGGG - Intronic
928833338 2:35515347-35515369 AGTTCTGTCTGAGTGGCTTGTGG + Intergenic
929490087 2:42388293-42388315 ACAGCTCTCTGGGTCTCTTTCGG - Intronic
933181841 2:79235895-79235917 CCTGCTGTCTGGATGTTTTCTGG + Intronic
933233220 2:79833308-79833330 ACTTCTGTCTGCTTGTCTTTAGG + Intronic
933777456 2:85779599-85779621 ACAGCTGGCTGGATGGCTTGGGG + Intronic
934679531 2:96272892-96272914 ACTGAAGTATGGGTGCCTTGAGG + Intronic
936407773 2:112222411-112222433 CCTGCTGTCTGGGTGTTTCCAGG + Intronic
937078359 2:119123490-119123512 GCTGCTGCCTGGCTTTCTTGGGG - Intergenic
937205884 2:120236935-120236957 AGTGCAGTGGGGGTGTCTTGAGG + Intergenic
937890590 2:126935490-126935512 GCTGCTGGCTGTGTGTCTGGTGG - Intergenic
942423880 2:175838593-175838615 ACTCCTGGCTGGGTATCATGGGG - Intergenic
942516317 2:176757178-176757200 ACTGTTGACTGGGAGCCTTGTGG + Intergenic
943953117 2:194156110-194156132 ACTGATGTCTGGTGGTATTGTGG - Intergenic
944471273 2:200055721-200055743 TCTGATGACTGTGTGTCTTGGGG - Intergenic
945072444 2:206004998-206005020 ACTGCTGTATTGCTGTCGTGAGG + Exonic
945761771 2:213923351-213923373 CCTGCTGTCTGGGTGTTTCCTGG + Intronic
948084424 2:235234941-235234963 ATTGCTGTCTGGGGATCATGAGG + Intergenic
948614107 2:239187274-239187296 ACTGCTGTCAGGGAGTCCTCGGG + Intronic
949020460 2:241738326-241738348 ACTGCTGTCTGGGTGGCCCTAGG + Intronic
1170883400 20:20317426-20317448 ACAGCTGTCTGGGTGTGTGCTGG - Intronic
1170892280 20:20386298-20386320 ACTGCTGTTTGTGTGTGTTGGGG + Intergenic
1170892748 20:20390123-20390145 CCTGCTGTATCGGTGTCATGTGG - Intronic
1171454281 20:25258677-25258699 CCTGCTGGCTGGCTGGCTTGGGG - Intronic
1172437796 20:34942342-34942364 ACTGCTGTCGGGGTGGCCAGGGG + Intronic
1173424282 20:42929085-42929107 ACTTCCTTCTGGGTATCTTGTGG - Intronic
1175350266 20:58313061-58313083 GGTGGTGTCTGGGTGTCTTGTGG - Intronic
1175804595 20:61820529-61820551 ACTGCTGTGAGGGTGACGTGAGG - Intronic
1177056823 21:16316679-16316701 ACTGCTTTCTGGATGATTTGGGG - Intergenic
1177505154 21:22010678-22010700 ACTGGTGGCTGGGTGGCCTGTGG - Intergenic
1179122814 21:38564699-38564721 ACTGCTGTCTCGGTGAGATGAGG - Intronic
1180542568 22:16464695-16464717 TCTGATGTCTGTCTGTCTTGGGG - Intergenic
1180914383 22:19474976-19474998 ACTGGTGTCTGGATGTACTGAGG + Intronic
1181392442 22:22593532-22593554 ACTACTGTCTGGGGAACTTGGGG + Intergenic
1182035540 22:27195522-27195544 GCTCCTGTCTGTGTGTCCTGGGG + Intergenic
1183433518 22:37780341-37780363 GCTGCTGTTTGGGTGTTGTGAGG + Intergenic
1184521088 22:44994591-44994613 TCTGCTGTGTGAGTGTCCTGTGG - Intronic
949749915 3:7339749-7339771 AATGCTCTCTGGGTGTTTGGAGG + Intronic
951362427 3:21740731-21740753 ACTGCTGCCTAGGTGACCTGGGG + Intronic
955632699 3:60991465-60991487 ACAGCTGTCTGGGCGTCATGGGG + Intronic
955642082 3:61096589-61096611 ACAACTGTCTGGGTTTCCTGTGG + Intronic
957778792 3:84791900-84791922 TCTGCTTTCTGGTTGTTTTGTGG - Intergenic
960527331 3:118724650-118724672 TCTACAGTTTGGGTGTCTTGTGG + Intergenic
960791092 3:121431915-121431937 GCTGCTGTCTGGGTCGATTGAGG + Exonic
961413974 3:126744093-126744115 ACTGCTGTCAGGTTGTCCTAGGG - Intronic
961969836 3:130950350-130950372 ACTTCTGGCTGGCTGTCATGGGG + Intronic
962076766 3:132090374-132090396 TCTGCTGTGTGGGTGTCTGGAGG - Intronic
963301769 3:143605411-143605433 GCTGCTGGCTTGGTGTGTTGGGG - Intronic
963598109 3:147354534-147354556 GCTGCTATCGGGGTGCCTTGAGG - Intergenic
964285917 3:155118089-155118111 ACTGCTATCTGGGTCTACTGAGG + Intronic
964722667 3:159782881-159782903 AGAGCTCTCTGGGTGTGTTGAGG - Intronic
967315800 3:188151307-188151329 ACTGTTGTATGGGTGTGTTGGGG - Intergenic
968689514 4:1983519-1983541 GCTGCTGGGTGGGTGTCTGGGGG + Intronic
971721918 4:30255906-30255928 ACTTGTGTCTGGGAGACTTGAGG - Intergenic
972177705 4:36427985-36428007 CCTGCTGTCTGGGTGCCTCCAGG - Intergenic
973558693 4:52112102-52112124 AGTCATGTTTGGGTGTCTTGAGG - Intergenic
973701801 4:53544867-53544889 ATTGCTGGCTGTGTGTCTTTGGG - Intronic
976015195 4:80543872-80543894 ACTGATGACTGTGTGTCTTGGGG - Intronic
976379789 4:84386300-84386322 ACTACAGTATGGCTGTCTTGTGG + Intergenic
976850108 4:89535265-89535287 TCTGATGACTGTGTGTCTTGGGG + Intergenic
978205553 4:106076548-106076570 TCTGATGACTGTGTGTCTTGGGG - Intronic
978326186 4:107559455-107559477 AGTGCTGTATGGGTTTCTTAGGG - Intergenic
978526703 4:109674519-109674541 ACTTTTGTCTGCGTGTTTTGTGG + Intronic
979723205 4:123927954-123927976 TCTGATGACTGTGTGTCTTGGGG - Intergenic
979758557 4:124372401-124372423 TCTGATGGCTGTGTGTCTTGAGG + Intergenic
985395594 4:189540075-189540097 TCTGATGTCTATGTGTCTTGGGG - Intergenic
986050035 5:4081446-4081468 CCTGTTGCCTGGGTGTCATGTGG - Intergenic
986181862 5:5400563-5400585 ACTGCTCTCTCAATGTCTTGGGG - Intergenic
986428818 5:7661402-7661424 ACTGTTTTCTGTTTGTCTTGTGG - Intronic
986752191 5:10797394-10797416 ACTTGTGTCTGCGTGTCTTATGG - Intergenic
986922946 5:12709670-12709692 AATGCTGTCTGGGTGTAATGAGG + Intergenic
987562378 5:19540543-19540565 ACTTCTGTCTGGGTGTCCAGGGG + Intronic
989314885 5:40066805-40066827 ACAGCTTCCTGGGTGGCTTGGGG + Intergenic
993933650 5:93973598-93973620 TCTGATGACTGTGTGTCTTGGGG - Intronic
994613951 5:102079757-102079779 TCTGATGTCTGTGTATCTTGGGG - Intergenic
995550476 5:113276185-113276207 AGTGCTGCCAGGGTGTCTGGAGG - Intronic
995998979 5:118334642-118334664 ATTGCTGTCTAGTTGTTTTGTGG - Intergenic
997384361 5:133460719-133460741 ACTGCTGGCTGTGTGACTTTGGG + Intronic
997432265 5:133848619-133848641 AGTGCTGTGTAGGTTTCTTGGGG - Intergenic
998762895 5:145452002-145452024 ACTGCTGACTGATTTTCTTGGGG - Intergenic
998786721 5:145719009-145719031 TCTGCTTTCTGGGTATCCTGAGG + Intronic
1000743191 5:164995999-164996021 ACTGCTGTCTGTGTGTGTGGGGG + Intergenic
1002623300 5:180505905-180505927 TCTGCTGTCTTAGTGTATTGTGG + Intronic
1002799423 6:507191-507213 ACTGCTGTGTGTGTGTGTGGGGG - Intronic
1003374537 6:5563544-5563566 ACTGCTGTTAGGGGGTTTTGGGG + Intronic
1004492987 6:16134861-16134883 ACGCCTGTCTGGGTATCTTTAGG + Intronic
1009497736 6:64372499-64372521 TCTGATGTCTCTGTGTCTTGGGG + Intronic
1009678228 6:66855533-66855555 ACTGTTTTCTGTTTGTCTTGTGG + Intergenic
1012932173 6:105328765-105328787 ACTGGTGTTTGGGTTTCTTTGGG - Intronic
1014132173 6:117846805-117846827 CCTGCTGTCTGGGTGTTTCCAGG - Intergenic
1014468102 6:121781138-121781160 ACTGGTGACTGGGTGTTGTGAGG + Intergenic
1014662775 6:124193793-124193815 TCTGCTGCCAGGGTGTCCTGAGG + Intronic
1015951149 6:138553876-138553898 ACTGCTTTCTGAGTTTGTTGTGG - Intronic
1017939990 6:159043715-159043737 AATGCTGTATGTGTGTTTTGTGG - Intronic
1019031441 6:169017118-169017140 TCTGATGACTGTGTGTCTTGGGG + Intergenic
1019386823 7:761791-761813 TCTGGTGTCTGTGTGTCATGAGG + Exonic
1024458651 7:49636952-49636974 ACTGCTTTCTGTCTTTCTTGAGG - Intergenic
1029134766 7:98361498-98361520 ACTGGGGTCTGAGTGTTTTGGGG + Intronic
1029442375 7:100594222-100594244 ACTGGAGTCTGGGGGACTTGGGG + Intronic
1029614622 7:101648470-101648492 CAGGCAGTCTGGGTGTCTTGGGG + Intergenic
1030073199 7:105714997-105715019 CCTCCTGACTGGGTTTCTTGAGG + Intronic
1030700435 7:112632608-112632630 ATTGCTGTGTGGCTTTCTTGTGG - Intergenic
1032955822 7:136971227-136971249 ACTGCTTTCTGTGTTACTTGAGG - Intronic
1033494403 7:141879641-141879663 TCTGATGACTGTGTGTCTTGCGG + Intergenic
1034330302 7:150276954-150276976 GTTGCTGTCAGGGTGTTTTGTGG + Intronic
1035266906 7:157693972-157693994 CCTGCCGTCTGGGGGTCCTGGGG + Intronic
1035952882 8:4043561-4043583 GCTGCTGTCTGGCCGCCTTGAGG + Intronic
1036019500 8:4828472-4828494 GCTGTTTTCTGAGTGTCTTGGGG + Intronic
1036223165 8:6938082-6938104 ACTTCTATCTGGGTGTCTGGCGG - Intronic
1036479273 8:9123866-9123888 ACTTCTGTCTTGACGTCTTGGGG + Intergenic
1038689611 8:29749239-29749261 ACTGCTCTCTGGGTGTTTACGGG + Intergenic
1039581967 8:38674430-38674452 ACTGCTGTATTGGTTTCCTGTGG + Intergenic
1039636944 8:39177977-39177999 TCTGATGATTGGGTGTCTTGGGG + Intronic
1040811908 8:51462827-51462849 TCTGATGACTGTGTGTCTTGGGG - Intronic
1040843545 8:51810088-51810110 ACTGCTGCCAGTGTGTCCTGAGG - Intergenic
1044790435 8:95841465-95841487 GCTTCTGCCTGGGTCTCTTGGGG - Intergenic
1048440014 8:134452919-134452941 ACTGATGACTGGGTGACCTGAGG + Intergenic
1049363847 8:142226987-142227009 ACTGCTGTGTGGGTGCAGTGGGG - Intronic
1049363855 8:142227022-142227044 ACTGCTGTGTGGGTGCAGTGGGG - Intronic
1049363864 8:142227057-142227079 ACTGCTGTGTGGGTGCAGTGGGG - Intronic
1049908771 9:245120-245142 ACAGCTGTGTAGGTGGCTTGTGG - Intronic
1051460434 9:17307299-17307321 ACTCCAGTCTGGGTGACATGGGG - Intronic
1053308801 9:37002453-37002475 CCTGCTGCCTGTCTGTCTTGCGG + Intronic
1053600649 9:39605268-39605290 GCTTCTGTCTGGGTCTCTGGTGG + Intergenic
1053858295 9:42359076-42359098 GCTTCTGTCTGGGTCTCTGGTGG + Intergenic
1054252880 9:62737161-62737183 GCTTCTGTCTGGGTCTCTGGTGG - Intergenic
1054566997 9:66771660-66771682 GCTTCTGTCTGGGTCTCTGGTGG - Intergenic
1055633135 9:78245125-78245147 ACTTATTTCTGTGTGTCTTGTGG + Intronic
1056186052 9:84135918-84135940 ACTGGTGTCTGGGTGTTGTGCGG + Intergenic
1056352491 9:85764671-85764693 ACTGTTTTCGGGGTGTCTGGTGG + Intergenic
1056688254 9:88784293-88784315 ACTGCTGACTTGGAGACTTGTGG + Intergenic
1058153318 9:101486099-101486121 ACTGCGCTCGCGGTGTCTTGGGG - Intronic
1059791518 9:117645931-117645953 CCTGCTGTCTGTGTGGCTGGGGG + Intergenic
1060170231 9:121455206-121455228 ACAGCTGTGTGGGTGTTTTTTGG - Intergenic
1061015327 9:127978029-127978051 ACTGCTGTGTGGGTGGCCTCAGG + Intronic
1061046111 9:128166030-128166052 ACTTCTGTCTGGGTGGATAGGGG - Intergenic
1061851951 9:133421549-133421571 GCTGCTGTCTGCCTGGCTTGGGG + Intronic
1062275442 9:135728305-135728327 CCTGGTGTCGGGGTGTCCTGGGG - Intronic
1186176615 X:6931740-6931762 ACTGCAGTCTGGATGTCGTCTGG - Intergenic
1191918015 X:66222975-66222997 ACTGCAGTCTAGGAGTCTGGAGG + Intronic
1193044128 X:77034020-77034042 TCTGCTGTCTGGGTGTTTCCTGG - Intergenic
1193398937 X:81019628-81019650 TCTGATGACTGTGTGTCTTGGGG + Intergenic
1194243389 X:91479450-91479472 TCTGATGACTAGGTGTCTTGGGG + Intergenic
1194762939 X:97815905-97815927 ACTGCTACCCGGGTTTCTTGTGG - Intergenic
1195687841 X:107601967-107601989 ACTGGTGTCTGGGTGGCTTGTGG - Exonic
1197641341 X:128971607-128971629 ACTGGTGCCTAGGTGTCTTATGG + Intergenic
1198505656 X:137298646-137298668 ACTGCTGTGAAGGTGTGTTGAGG - Intergenic
1198507580 X:137316780-137316802 TCTGCTATCTGGGTTTCTTTCGG - Intergenic
1198736681 X:139792995-139793017 ACTGGTGTCTAGGAGTCATGGGG + Intronic
1200562372 Y:4720825-4720847 TCTGATGACTAGGTGTCTTGGGG + Intergenic