ID: 927816397

View in Genome Browser
Species Human (GRCh38)
Location 2:26221349-26221371
Sequence AGTTATTCACAGAGGATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 2, 2: 6, 3: 22, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927816397_927816402 4 Left 927816397 2:26221349-26221371 CCTACCATCCTCTGTGAATAACT 0: 1
1: 2
2: 6
3: 22
4: 193
Right 927816402 2:26221376-26221398 TCCTTTTGGGAAACAGTGTTTGG 0: 1
1: 0
2: 4
3: 53
4: 324
927816397_927816404 15 Left 927816397 2:26221349-26221371 CCTACCATCCTCTGTGAATAACT 0: 1
1: 2
2: 6
3: 22
4: 193
Right 927816404 2:26221387-26221409 AACAGTGTTTGGCTTGTTAGTGG 0: 1
1: 0
2: 3
3: 19
4: 201
927816397_927816401 -9 Left 927816397 2:26221349-26221371 CCTACCATCCTCTGTGAATAACT 0: 1
1: 2
2: 6
3: 22
4: 193
Right 927816401 2:26221363-26221385 TGAATAACTACTCTCCTTTTGGG 0: 1
1: 1
2: 5
3: 30
4: 216
927816397_927816405 16 Left 927816397 2:26221349-26221371 CCTACCATCCTCTGTGAATAACT 0: 1
1: 2
2: 6
3: 22
4: 193
Right 927816405 2:26221388-26221410 ACAGTGTTTGGCTTGTTAGTGGG 0: 1
1: 0
2: 0
3: 16
4: 183
927816397_927816400 -10 Left 927816397 2:26221349-26221371 CCTACCATCCTCTGTGAATAACT 0: 1
1: 2
2: 6
3: 22
4: 193
Right 927816400 2:26221362-26221384 GTGAATAACTACTCTCCTTTTGG 0: 1
1: 1
2: 0
3: 18
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927816397 Original CRISPR AGTTATTCACAGAGGATGGT AGG (reversed) Intronic
902305368 1:15533968-15533990 AGCATTTCACAGAGGAAGGTGGG - Intronic
903120066 1:21210388-21210410 AGTTATCCACAGAGGATGGTGGG - Intergenic
903842083 1:26250432-26250454 ATTTTTCCACAGACGATGGTTGG - Intronic
908658185 1:66410272-66410294 AGGTATTCAAATAGGAAGGTAGG + Intergenic
910445797 1:87297974-87297996 AGATATACACAGAGGACTGTGGG - Intergenic
910500223 1:87881991-87882013 AGTGGTTCACAGAGGAAGGTGGG + Intergenic
915962077 1:160275283-160275305 AGTTTTCCACAGAGGGGGGTGGG - Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916474150 1:165152680-165152702 AGTTATTTACAGGGCATGGTGGG - Intergenic
918379685 1:183941429-183941451 AGTTGTTCACGGAGGACGGAAGG - Intronic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919204990 1:194410152-194410174 ATTTATCCAAAAAGGATGGTTGG - Intergenic
1063043893 10:2372325-2372347 TGTTAGTCACACAGGCTGGTGGG + Intergenic
1063630717 10:7731377-7731399 ATTTATTCACACAGGACGTTTGG - Intronic
1065564528 10:26995533-26995555 AGGTATGCACAGAAGTTGGTGGG + Intronic
1065607016 10:27428505-27428527 AGTTATCCACTGAGGATGGCAGG - Intergenic
1066648347 10:37633677-37633699 AGGTAAGCACAGAGCATGGTGGG + Intergenic
1069080947 10:64087758-64087780 TTGTATTCACAGAGGATGTTGGG + Intergenic
1070580681 10:77716807-77716829 AGTTATTCTCAGAGGAATGATGG + Intergenic
1070685480 10:78477322-78477344 AGGAACTGACAGAGGATGGTTGG - Intergenic
1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG + Intergenic
1072509576 10:96106226-96106248 AGCTATTTACAGAAGATGTTTGG - Intergenic
1072574352 10:96686688-96686710 TGTATTTAACAGAGGATGGTCGG - Intronic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1077992165 11:7422005-7422027 AGTTATTTACTGAGGATGCGTGG + Intronic
1078599571 11:12718208-12718230 AGTGGTTCACGGAGGATGCTTGG + Intronic
1081586427 11:44387458-44387480 AATTATTCAGAGAGTATGGAGGG - Intergenic
1085769848 11:79315021-79315043 AGTTATGCACAGAGGGTGGTAGG + Intronic
1090234295 11:125135502-125135524 AGTTATTGAAAGAGTGTGGTAGG - Intergenic
1090885792 11:130875329-130875351 AGTGATTGCCAGAGGCTGGTGGG + Intergenic
1092927079 12:13281042-13281064 AGTGTTTCACAGAGGACAGTGGG - Intergenic
1095190258 12:39250137-39250159 AGCTATCTACAGAGGATGGCAGG - Intergenic
1095629520 12:44358396-44358418 AGAAATTCTCAGAGGATGGTTGG + Intronic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1099364580 12:81752586-81752608 AGTTATTCACACAGGGTTATGGG + Intronic
1100123783 12:91398707-91398729 AGCTCTTCATAGAGAATGGTGGG + Intergenic
1101511708 12:105399110-105399132 AGTTATTCACTTTTGATGGTTGG + Intergenic
1102649809 12:114432048-114432070 AGTTATTCACCATGGATGCTGGG + Intergenic
1105727065 13:23174095-23174117 AATTATTCAGAAAGGAGGGTTGG - Intergenic
1106765072 13:32905523-32905545 AAATATTCACAGAGGATTTTGGG + Intergenic
1108263036 13:48677415-48677437 AGTTGGTCACAGAGTTTGGTAGG + Intronic
1108784621 13:53881083-53881105 TTTTTTTCACAGAAGATGGTTGG - Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109096557 13:58125500-58125522 ACTAATTCAAAGAGGATTGTGGG + Intergenic
1109293221 13:60500091-60500113 AGTTATCCACAGAAGATGGCAGG - Intronic
1111470900 13:88681086-88681108 AGTTATGTACAGATGATGGCAGG + Intergenic
1112790625 13:102999053-102999075 TGTGATTCACAGAGGGAGGTGGG + Intergenic
1114197246 14:20489707-20489729 AATGATTCAGAGAGGATGGGTGG + Intergenic
1115070783 14:29319597-29319619 AGTTATCCACAAAGGATGCCAGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1124254531 15:28130158-28130180 TGTGCTGCACAGAGGATGGTAGG - Exonic
1124571698 15:30870328-30870350 AATTATCCACAGAGGATGGTAGG - Intergenic
1124872847 15:33560019-33560041 AGTTATTGAAAGAGAATGATTGG + Intronic
1127064095 15:55219111-55219133 CTTTATTCACAGAGGATAGTTGG - Intronic
1127644903 15:60948172-60948194 AGTTCTTTCCAGAGGATGGATGG + Intronic
1132169270 15:99631081-99631103 AGTTGTTCTCAAAGGAAGGTTGG + Intronic
1134214931 16:12309662-12309684 AGTGATTCTCAGAGGGAGGTGGG + Intronic
1139063722 16:63288009-63288031 AGTCATTCACGGAGGATTGTGGG - Intergenic
1140570149 16:76094762-76094784 AGTTGTTCTCAGAGTAAGGTTGG + Intergenic
1143820537 17:9557975-9557997 AGTTGTTCAGAGAGCCTGGTGGG - Intronic
1152777854 17:82213429-82213451 TGTTGTTCCCACAGGATGGTGGG - Intergenic
1153147970 18:2055469-2055491 TGTTGTTCAGAGAAGATGGTTGG + Intergenic
1153767652 18:8389462-8389484 CGTTCTTCACAGTGGACGGTGGG + Intronic
1156631066 18:38969373-38969395 AGTTATTAAAACAGTATGGTAGG + Intergenic
1157882023 18:51329660-51329682 GGATATTCACAGAGGAGGGAGGG + Intergenic
1158424990 18:57330884-57330906 AGTTAGCCATAGAGGATGGGAGG + Intergenic
1158734817 18:60067676-60067698 ATTCATTCACAGGGGAAGGTTGG + Intergenic
1158855008 18:61534720-61534742 AGTGATTGCCAGAGGCTGGTGGG + Intronic
1159259739 18:65998181-65998203 AGTTAGGCACAGAGGAAGGCAGG - Intergenic
1159302940 18:66599383-66599405 TGGTATTTACAGAGGCTGGTGGG + Intronic
1160301868 18:77688973-77688995 ATTTATTCACAGAGGCTGTGAGG - Intergenic
1161652346 19:5493046-5493068 AGATATTGACAAAGGCTGGTGGG + Intergenic
1162655557 19:12126420-12126442 AGTTTTTCACAGAGGAGGGTGGG + Intronic
1166295908 19:41889271-41889293 AGTCATTCACGGTTGATGGTTGG + Intronic
1166440797 19:42813309-42813331 AGTTATCCAAAGTGGATGGGTGG - Intronic
1166460297 19:42982191-42982213 AGTTATCCAAAGTGGATGGGTGG - Intronic
1166489002 19:43241380-43241402 AGTTATCCAAAGTGGATGGGTGG - Intronic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
925964491 2:9051416-9051438 AGTAATTAACACAGGAGGGTAGG + Intergenic
926176422 2:10596237-10596259 AGTTTTCCACAGATGGTGGTGGG + Intronic
926608753 2:14923931-14923953 AGTAATTCACAGCAGATGGAGGG + Intergenic
927816397 2:26221349-26221371 AGTTATTCACAGAGGATGGTAGG - Intronic
928039699 2:27862335-27862357 AGGTATTCACAAAGAAAGGTGGG + Intronic
928089655 2:28366382-28366404 AGTTATGCACTGAGTGTGGTGGG - Intergenic
928369298 2:30729123-30729145 AGATAGTTACAGAGGAAGGTGGG + Intronic
928640437 2:33292917-33292939 ATTTATTCACAGAGCATATTTGG + Intronic
928805180 2:35141254-35141276 AGTTTTTTACAGATGATGGAAGG - Intergenic
929738220 2:44574441-44574463 AGTTAGTTACAGGAGATGGTTGG + Intronic
929750181 2:44703238-44703260 AGTTGTTATCACAGGATGGTAGG - Intronic
932846534 2:75141271-75141293 AGCTATTTTCTGAGGATGGTGGG - Intronic
933487848 2:82946228-82946250 AGGTATTCACATAGGAAGGGAGG - Intergenic
935183932 2:100714870-100714892 AGTTATTTTCAGAAGATGGTAGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
937497189 2:122433093-122433115 AATTATTCACTGAGGCAGGTGGG - Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
939270952 2:139938730-139938752 AGTTGTTCACAGATGGTGGGGGG + Intergenic
943324742 2:186484847-186484869 AGTTCTTGTCAGAGGATGGAGGG - Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
947853889 2:233310156-233310178 AGCTATCCACAGAGGCTGGACGG - Intronic
948471024 2:238179254-238179276 AGTGATTCACAAAGGAAGGATGG + Intronic
948539438 2:238677625-238677647 AGTTATTCACATATAATTGTTGG + Intergenic
948583887 2:239006402-239006424 AGTGGTTCCCAGAGGATGGATGG - Intergenic
1168915416 20:1481497-1481519 AGCTATTCACAAAGGCTGATGGG - Intronic
1172587953 20:36097982-36098004 AGGTGGTGACAGAGGATGGTTGG + Intronic
1175323195 20:58103779-58103801 AGTCATTCACGGCAGATGGTGGG + Intergenic
1181835088 22:25599049-25599071 AGTTATTCTGGGAGTATGGTAGG - Intronic
1182793523 22:32973213-32973235 TGCTTTTCACAGAGGGTGGTTGG - Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
954954486 3:54507503-54507525 AGTTTTTCCCAGATGTTGGTTGG + Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
956820281 3:72948053-72948075 AGTTATTAAAAGAGGAATGTTGG - Intronic
958179879 3:90046512-90046534 AGTTATCCACAGAGGATAGCAGG + Intergenic
960582302 3:119291230-119291252 AGTTATTCACACCAAATGGTGGG - Intergenic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
962234986 3:133700056-133700078 AGTCATTCACAGATGAGTGTGGG + Intergenic
965081911 3:164044083-164044105 AATTATTCACAAAGGGTTGTGGG + Intergenic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
966480564 3:180403936-180403958 AGTTATCTGCAGAGGGTGGTAGG - Intergenic
970523985 4:16913046-16913068 AGTTAACCACAGTGGATGGCAGG - Intergenic
972412003 4:38804539-38804561 TGTTATTCCCAGAGGAGTGTGGG + Intronic
974243591 4:59284096-59284118 GAATATTCACAGAGGATGGCAGG + Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974328490 4:60445757-60445779 AGTTATAAACAGAAGATTGTGGG - Intergenic
974506508 4:62781144-62781166 AGTTATTTACACAGGATCATGGG - Intergenic
975099694 4:70498534-70498556 ACATATTCACAGAAGATGATTGG + Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976770213 4:88643987-88644009 ATTTATCCAAAGAGGATGGATGG + Intronic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
979288390 4:118952684-118952706 AGTTAATCACATTGGATAGTAGG + Intronic
979575459 4:122286148-122286170 CTTTATTCACAGAGAATAGTAGG - Intronic
980602874 4:135047599-135047621 ATTTATTCACAGATGATGTGGGG - Intergenic
983627239 4:169814295-169814317 ACTTCCTCACAGGGGATGGTAGG + Intergenic
984692904 4:182748749-182748771 AAATATTCCCACAGGATGGTAGG - Intronic
984966664 4:185145454-185145476 AGTTATTCAGAGAGGAGGAGGGG + Intronic
986005142 5:3661145-3661167 ATTTATCCTCAGAGGATGGATGG - Intergenic
988408663 5:30857404-30857426 AGATATTTACGGAGGAGGGTAGG - Intergenic
989548271 5:42699927-42699949 AGATATTCAGAAAGGATGGATGG + Exonic
990493071 5:56320934-56320956 AGTCATTCACAGAGGAAGAGAGG - Intergenic
992033726 5:72750124-72750146 AGTGATACACAGAGGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG + Intergenic
994769474 5:103963842-103963864 GGTTATTTACAGGGGGTGGTGGG - Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996738939 5:126781323-126781345 ATTTATTCAGAAAGGATGGCAGG + Intronic
997002753 5:129782031-129782053 AGTTATTCAGAAAGGATATTGGG + Intergenic
997179406 5:131812858-131812880 AGTTTTCCACTGAGGATGGAAGG - Intronic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1000851483 5:166345670-166345692 TATTAATCACAGAGGAAGGTAGG + Intergenic
1001006220 5:168052747-168052769 AGTTATAAACCGAGAATGGTAGG - Intronic
1001838821 5:174855707-174855729 AGTTATTCACAGAAGATAGCAGG - Intergenic
1002247126 5:177893744-177893766 AAATATTCATCGAGGATGGTTGG + Intergenic
1002676057 5:180913789-180913811 AGTTATTCGTAGAGAATGGCAGG - Intronic
1003791217 6:9549963-9549985 AGTTATCTTCAGAAGATGGTAGG - Intergenic
1008433591 6:51449258-51449280 AGGTGTTGATAGAGGATGGTGGG - Intergenic
1009287392 6:61837751-61837773 GGTTGTTCACAGAAGTTGGTTGG - Intronic
1011668832 6:89662712-89662734 AGTAAATGACAGAGAATGGTAGG + Intronic
1011759203 6:90542198-90542220 AGATATTCCCAAAGGATGGGCGG + Intronic
1012033366 6:94101061-94101083 AGTTATTCATAGAGGATGGTGGG - Intergenic
1012964129 6:105655322-105655344 AGTTATCCATAGAAGATGGCAGG - Intergenic
1015831830 6:137378094-137378116 AGTTATTCACAGAAAATGGAAGG + Intergenic
1026467021 7:70662789-70662811 AGTTAGGCACAGGGCATGGTGGG + Intronic
1031135775 7:117882550-117882572 AGTTGTTCACAGGGGTGGGTGGG + Intergenic
1033758346 7:144415775-144415797 TGTTAATCACAGAGGATGCTGGG + Intergenic
1033856268 7:145564989-145565011 AGTTATTCACCGACAATGGGAGG + Intergenic
1034835522 7:154348460-154348482 TTTTAATCACAGAGGATGTTGGG - Intronic
1034857110 7:154561164-154561186 AATTACTCAGAGAGGATTGTTGG - Intronic
1036527350 8:9547549-9547571 AGTTATCCACAGAGGATGGCAGG + Intergenic
1039292313 8:36109912-36109934 AGTTATCTACAGAGGATAGCAGG + Intergenic
1039329644 8:36523188-36523210 GGTTAATAACAGAGGAGGGTAGG + Intergenic
1043803902 8:84646768-84646790 AGTTATTGACAGTAGATGGAAGG - Intronic
1044133663 8:88558246-88558268 ACTTATTGACAGATGAGGGTGGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1044601786 8:94012385-94012407 AGGAATTAACAGAGGATGGAAGG + Intergenic
1044860826 8:96522047-96522069 AGTTTTGCAGAAAGGATGGTAGG - Intronic
1045717398 8:105064679-105064701 AGTAATTCACATCGGATGGAAGG - Intronic
1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047262137 8:123273456-123273478 AGTTAATTAAAGAGGATGGTAGG - Intronic
1049290802 8:141800709-141800731 CATTAGTCACAGAGGAGGGTTGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051369868 9:16349177-16349199 AGTCAGTCCCACAGGATGGTTGG + Intergenic
1052095747 9:24381541-24381563 GTTTATTCACAGAGGATGCCAGG - Intergenic
1052193778 9:25687634-25687656 AGGTATCCACACAGGATGCTTGG + Intergenic
1053610815 9:39711399-39711421 AGTTATTCACAGAAGATGGCAGG - Intergenic
1053819834 9:41955183-41955205 AGTAGTTCACATAGGCTGGTGGG + Intronic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054110100 9:61098842-61098864 AGTAGTTCACATAGGCTGGTGGG + Intergenic
1054242707 9:62630996-62631018 AGTTATTCACAGAAGATGGCAGG + Intergenic
1054556832 9:66665514-66665536 AGTTATTCACAGGAGATGGCAGG + Intergenic
1054610757 9:67232283-67232305 AGTAGTTCACATAGGCTGGTGGG - Intergenic
1055955777 9:81772511-81772533 AGTGATACACAAAGGATGCTAGG - Intergenic
1056108334 9:83370088-83370110 TCTTACTCACAGAGGATGATAGG - Intronic
1056665050 9:88574900-88574922 AGTTATGCCCCCAGGATGGTGGG - Intronic
1058239796 9:102542463-102542485 AGTTATTTACAGATGATGTCAGG - Intergenic
1059853562 9:118369975-118369997 TGTTATTGACAGAGGCTGGAGGG + Intergenic
1061114941 9:128604185-128604207 ATTTATTCAGCGAGGAAGGTTGG + Intronic
1061777618 9:132976061-132976083 AGTTACTCACGGGGGAAGGTAGG + Intronic
1185834186 X:3329632-3329654 AGAAATTCACAAAGGATGCTTGG - Intronic
1188942213 X:36254181-36254203 AGGGCTTCACAGGGGATGGTGGG + Intronic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189899276 X:45689271-45689293 AGTTATTTTCAGAGGAAGGAGGG - Intergenic
1190579483 X:51877545-51877567 AGGTATGCACAGAGGTTTGTTGG + Intronic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191956132 X:66644246-66644268 AGCTCTTCAGAGAGGATGGAAGG - Intergenic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192789400 X:74366470-74366492 AGTTATTCAGAAAGGATGGCAGG + Intergenic
1195681474 X:107550122-107550144 AGTCATTCACATTTGATGGTCGG + Exonic
1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG + Intronic
1196333957 X:114507779-114507801 AGTTATTTCCAGAGGCTGGGAGG + Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197174091 X:123466206-123466228 GGTTGCTCACAGAGGTTGGTTGG + Intronic
1197491592 X:127123386-127123408 AGTTTTTCAAAGATGATTGTAGG - Intergenic
1197649909 X:129053103-129053125 AGATATTCATACATGATGGTGGG + Intergenic
1199008504 X:142730855-142730877 AGTTATCTCCAGAGGATGGCAGG - Intergenic
1200289353 X:154857107-154857129 AGTTATTCACAGAGGATTACAGG - Intronic
1200746061 Y:6904904-6904926 AGTTACCCACAGAAGATGGCAGG + Intergenic
1200823156 Y:7609172-7609194 AGGTATTCACAGTGGGTGCTAGG + Intergenic
1202236899 Y:22721923-22721945 AGGTATTCACAGTGGGTGCTAGG - Intergenic
1202306268 Y:23474245-23474267 AGGTATTCACAGTGGGTGCTAGG + Intergenic
1202564541 Y:26196344-26196366 AGGTATTCACAGTGGGTGCTAGG - Intergenic