ID: 927826353

View in Genome Browser
Species Human (GRCh38)
Location 2:26312423-26312445
Sequence TGGTGACCAGCAGTGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 8, 3: 43, 4: 241}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927826349_927826353 -2 Left 927826349 2:26312402-26312424 CCAGGTCTGCAAAGCTAGGAATG 0: 1
1: 0
2: 2
3: 10
4: 123
Right 927826353 2:26312423-26312445 TGGTGACCAGCAGTGGTAGAGGG 0: 1
1: 0
2: 8
3: 43
4: 241
927826343_927826353 15 Left 927826343 2:26312385-26312407 CCCATTCTTTGGCCCCTCCAGGT 0: 1
1: 0
2: 1
3: 12
4: 182
Right 927826353 2:26312423-26312445 TGGTGACCAGCAGTGGTAGAGGG 0: 1
1: 0
2: 8
3: 43
4: 241
927826346_927826353 2 Left 927826346 2:26312398-26312420 CCCTCCAGGTCTGCAAAGCTAGG 0: 1
1: 0
2: 0
3: 15
4: 141
Right 927826353 2:26312423-26312445 TGGTGACCAGCAGTGGTAGAGGG 0: 1
1: 0
2: 8
3: 43
4: 241
927826345_927826353 3 Left 927826345 2:26312397-26312419 CCCCTCCAGGTCTGCAAAGCTAG 0: 1
1: 0
2: 2
3: 13
4: 138
Right 927826353 2:26312423-26312445 TGGTGACCAGCAGTGGTAGAGGG 0: 1
1: 0
2: 8
3: 43
4: 241
927826348_927826353 1 Left 927826348 2:26312399-26312421 CCTCCAGGTCTGCAAAGCTAGGA 0: 1
1: 0
2: 1
3: 8
4: 153
Right 927826353 2:26312423-26312445 TGGTGACCAGCAGTGGTAGAGGG 0: 1
1: 0
2: 8
3: 43
4: 241
927826344_927826353 14 Left 927826344 2:26312386-26312408 CCATTCTTTGGCCCCTCCAGGTC 0: 1
1: 0
2: 2
3: 20
4: 284
Right 927826353 2:26312423-26312445 TGGTGACCAGCAGTGGTAGAGGG 0: 1
1: 0
2: 8
3: 43
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927826353 Original CRISPR TGGTGACCAGCAGTGGTAGA GGG Intronic
902651035 1:17837717-17837739 TGTTGACCATCAGTGCTAGCCGG - Intergenic
904137312 1:28323385-28323407 TGGTGTCCAGTAGTGGAAGGGGG - Intergenic
907602971 1:55788566-55788588 CGGTGAACAGCCGTGGTGGACGG + Intergenic
909695639 1:78465413-78465435 TGGTGAAGAGCAGTGGGTGAGGG + Intronic
910113926 1:83712015-83712037 GGGTGACCAGCAGAGTTATATGG - Intergenic
910197123 1:84653317-84653339 TGGCTACCAGTACTGGTAGATGG - Intronic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
911449540 1:98045908-98045930 TGGTGACCAGGACTGGAAAATGG - Intergenic
911524853 1:98972367-98972389 TGCTGGCCAGCAGTTTTAGATGG + Intronic
912496225 1:110093857-110093879 GGTTGACCACCAGTGGTAGATGG + Intergenic
915800637 1:158789009-158789031 TGGTTACCAGGAAAGGTAGAGGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917609193 1:176669035-176669057 TGGTGTCCAAGACTGGTAGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918068389 1:181117450-181117472 TGGAGACCAGCAGGGGTGGAGGG + Intergenic
918323664 1:183389170-183389192 TGGGGACCTGCAGTGCTGGAGGG - Intronic
918351906 1:183664917-183664939 TGTTGAAAAGCAGTGGTAGGAGG + Intronic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
921961082 1:221035000-221035022 TGGTGATTAGCTGTGGAAGATGG + Intergenic
923745775 1:236698929-236698951 AGTTGCCCAGCAGTGGTTGAGGG + Intronic
924780268 1:247141152-247141174 TGGTGACAAGCAGGGGGAGTGGG + Intronic
1064371241 10:14753335-14753357 TGGTGACAAGGAGTGATGGATGG + Intronic
1067279130 10:44858050-44858072 AAGAGCCCAGCAGTGGTAGATGG - Intergenic
1070059730 10:72970268-72970290 TGGTGAACAGAAGTGATATAAGG + Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073029149 10:100510913-100510935 TGGAGCTCAGCAGGGGTAGAGGG + Intronic
1074100202 10:110348693-110348715 TGGTGACCAGAGGTGGCAGAGGG - Intergenic
1074460299 10:113630568-113630590 TAGTCAGCAGTAGTGGTAGAGGG - Intronic
1074594994 10:114854678-114854700 TGAGGACCAGCACTGGTCGATGG + Intronic
1075458843 10:122602423-122602445 TGCTGAGTAGCAGTGGTTGAGGG + Intronic
1075459474 10:122606482-122606504 TGCTGAGTAGCAGTGGTTGAGGG + Intronic
1075460106 10:122610541-122610563 TGCTGAGTAGCAGTGGTTGAGGG + Intronic
1075460738 10:122614600-122614622 TGCTGAGTAGCAGTGGTTGAGGG + Intronic
1076211919 10:128655604-128655626 AGGTGCCCATCAGTGGTGGATGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1081459606 11:43259953-43259975 TGTTGACCAGCAGCTGAAGAGGG + Intergenic
1083897633 11:65628068-65628090 TGGAGGCCAGCAGTGGTACCTGG + Intronic
1084101287 11:66951330-66951352 TGCAGACCAGCAGGGGGAGAGGG + Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084908369 11:72366974-72366996 AGGTGCCCATCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085994338 11:81893157-81893179 TGGACACTAGCAGTGGTAGGTGG + Intergenic
1088425093 11:109693628-109693650 TGGGCACCAGCAGTGGTGGGTGG - Intergenic
1089176545 11:116552676-116552698 TGCTGAGCAGCAGTGTTTGAGGG + Intergenic
1091284316 11:134399582-134399604 GGCTGCCCAGCAGTGGCAGAGGG + Intronic
1092293641 12:7181266-7181288 TGGTGATCAGCAATGGTGGACGG - Intergenic
1092902371 12:13071825-13071847 GGGTGGCCAGCAGTTGGAGAGGG + Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093108371 12:15117750-15117772 TGGTGACCAGCATTCTTAGAGGG + Intronic
1093287136 12:17277962-17277984 TGGTGATCAGCTGTGGGAGCTGG + Intergenic
1094200733 12:27792477-27792499 TCCTGACCAGCAGTGGGAGGTGG + Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095099274 12:38163652-38163674 TGGTGGCCAGCAGTGCTCGGGGG - Intergenic
1098201076 12:68056160-68056182 AGGTGCCCATCAGTGGTGGACGG - Intergenic
1098652646 12:72992511-72992533 TGGTGCCCACCACTGGGAGAGGG + Intergenic
1101038333 12:100727790-100727812 TGGTGAGGAACAGTGGGAGAAGG - Intronic
1102565418 12:113794411-113794433 TGGAGTCCAGCAATGGGAGAAGG - Intergenic
1103074854 12:117973938-117973960 GGTTGACAAGCAGTGGAAGAAGG - Intergenic
1103802552 12:123548793-123548815 TGGTGATCAGCAGTGGTGGATGG - Intergenic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104573184 12:129943110-129943132 TGAAGACCAGCGGTGGGAGATGG + Intergenic
1107299794 13:38953686-38953708 TGATGAAAAGCAGTGGTGGAGGG + Intergenic
1108819514 13:54330367-54330389 TGTTGAAAAGCAGTGGTAAAAGG - Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109380903 13:61558304-61558326 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1109462143 13:62674948-62674970 TGGTGCCCAGAAGTGGCAGCAGG + Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110921203 13:81088194-81088216 TGGTTACCAGGAGTGGAAGGTGG + Intergenic
1111575582 13:90150285-90150307 TAGTGACCACCAGAAGTAGATGG - Intergenic
1113592280 13:111509370-111509392 CGGCGATCAGCAGTGGTAGACGG + Intergenic
1113902999 13:113806808-113806830 TGGAGGCCCGCAGGGGTAGAAGG + Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118808679 14:69258766-69258788 TGGTGTCCAGCAGTGCCAGCAGG + Intergenic
1120097376 14:80403859-80403881 CAGTGATCAGCAGTGGTGGACGG - Intergenic
1120845329 14:89120059-89120081 TGGTGCTCAGTAGTGGTGGAGGG + Intergenic
1122540690 14:102496245-102496267 TGGTCACCAGCAGTGCTGGTGGG - Intronic
1123058256 14:105582526-105582548 AAGTGACCTGCAGTGGTGGAGGG - Intergenic
1123082344 14:105701451-105701473 AAGTGACCTGCAGTGGTGGAGGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1125481338 15:40083023-40083045 TGGTGACCATCGGTGGTAAGAGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127145658 15:56020397-56020419 AGGTGCCCATCAGTGGTGGACGG - Intergenic
1127692726 15:61413872-61413894 TGCTCACCAGCAGTGTTGGATGG + Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128443651 15:67737794-67737816 TGGTGACCACCACGGGGAGAAGG + Intronic
1128622175 15:69160330-69160352 TAGTGACCAGAAGTAGTAGGAGG - Intergenic
1128733231 15:70034735-70034757 TGTTGAGCAGCAGTGGGACATGG + Intergenic
1129450798 15:75650110-75650132 GGATGACAAGCAGTGGAAGATGG + Exonic
1129691087 15:77713996-77714018 TGGGAACCAGCAGCTGTAGATGG - Intronic
1130552207 15:84896980-84897002 TGGTGACCACCAGTGGTTTGGGG + Intronic
1131120929 15:89823053-89823075 TGGTGACCAGCAGTGGGGGAGGG + Intergenic
1133840824 16:9407738-9407760 TGGTGGCCAGAGGTGGTGGAGGG + Intergenic
1134474690 16:14562531-14562553 TGGTTTCAAGGAGTGGTAGAAGG - Intronic
1134766526 16:16763588-16763610 TGGTGACCAGCAATAACAGACGG - Intergenic
1135538580 16:23312882-23312904 TGGTGAAGAGCTGTGGTGGAGGG + Intronic
1139548598 16:67661242-67661264 TGGAGACCAGCAGTGGAGGAAGG - Intronic
1139602584 16:67995477-67995499 TGCTGACCAGCAGTGGATGATGG - Intronic
1140562763 16:76002892-76002914 AGGTGCCCATCAGTGGTGGATGG + Intergenic
1141626162 16:85262321-85262343 TGGTGACACGCGGTGGCAGAGGG + Intergenic
1141879195 16:86846667-86846689 TGGGGACAAGCAGAGGTAGGAGG - Intergenic
1146688772 17:34858808-34858830 TGGAGACCAGCTGTGATGGAGGG + Intergenic
1147653960 17:42077992-42078014 TGGAGCCCAGCAGTGGCAGGAGG - Intergenic
1148249581 17:46064509-46064531 TGGTGAGCAGTTTTGGTAGAGGG - Intronic
1150292916 17:63992077-63992099 TGGTGACCAGCAGTCCCAGATGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152245156 17:79181632-79181654 GGGTGGCCGGCAGTGGCAGAGGG - Intronic
1152245162 17:79181652-79181674 GGGTGGCCAGCAGTGGCAGAGGG - Intronic
1153141855 18:1981591-1981613 AGGTGCCCATCAGTAGTAGAGGG - Intergenic
1154313981 18:13289351-13289373 TGGTGACTAACAGTGTTAAAGGG + Intronic
1154960871 18:21307611-21307633 AGGTGACCAGAAGGGGTAAAAGG - Intronic
1155302323 18:24441723-24441745 TGGTGTCCAGGACTAGTAGAAGG + Intronic
1156265426 18:35483784-35483806 TGGTTACCTGCAGGGGCAGAGGG + Intronic
1158200888 18:54939310-54939332 AGATTATCAGCAGTGGTAGATGG + Intronic
1158239211 18:55358306-55358328 TGATGAGCAGCAGTAGTAGTTGG - Intronic
1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG + Intronic
1158777192 18:60597452-60597474 TGGAGACCAGCAAGGGTAGAGGG + Intergenic
1162007761 19:7790724-7790746 TGGTTCTCAGCAGTGGTGGATGG - Intergenic
1165391083 19:35539287-35539309 AGTTGACCAGCAGTGGTCAATGG - Intronic
1166911669 19:46163467-46163489 TGGTGATGAGCAGTGGGAGAGGG + Intergenic
1167635674 19:50653896-50653918 TGGGAACCAGGAGGGGTAGATGG + Intronic
925455735 2:4015232-4015254 GGTTGACCAGCAGTGGTTGCAGG - Intergenic
925684628 2:6458580-6458602 TGGTGAAGAGCAGGGGTGGAGGG + Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
927826353 2:26312423-26312445 TGGTGACCAGCAGTGGTAGAGGG + Intronic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
930631150 2:53756757-53756779 CGGTGATCAGCAGTGGTGGACGG - Intronic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
936081397 2:109434989-109435011 AGGTGCACAGCAGAGGTAGAGGG - Intronic
937046187 2:118853312-118853334 TGGGGACCAGGGGTGGGAGAGGG - Intergenic
937289780 2:120775396-120775418 TGGTGTCCATCAGGGGTAGTTGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942831223 2:180238913-180238935 TGTTGAACAGCAGTGGTGGACGG - Intergenic
943071273 2:183143296-183143318 TGCTCACCAGCAATGATAGAGGG - Intronic
943694440 2:190909474-190909496 TGGTTACCAGAAGTGGGGGAGGG - Intronic
947076993 2:226355570-226355592 TGATGGCCATCAGTGGAAGATGG + Intergenic
948363971 2:237442708-237442730 TGGAGAACAGCGGTGGTACAAGG - Intergenic
948384908 2:237575251-237575273 TGGTGACCAGGAGGGGCAGGAGG - Intronic
1168841580 20:913325-913347 TGGGGACCAGGAGTGTCAGAGGG + Intronic
1171502337 20:25603537-25603559 TGGTGAGAACCAGTGGTGGAGGG + Intergenic
1172952219 20:38729469-38729491 TGGTGAGCAGCTGTGGTTAAAGG + Intergenic
1173015497 20:39221445-39221467 GGGTTACCTGCAGTGGCAGATGG - Intergenic
1173826804 20:46052982-46053004 TGGTGACCAGCAGGGCTAAGTGG - Exonic
1174940358 20:54919896-54919918 TGGTCACCAGCAGAGGTAGATGG + Intergenic
1176300620 21:5097310-5097332 GGGAGACCAGCAGAGGTGGAGGG - Intergenic
1177738119 21:25118775-25118797 CGGGGAACAGCAGTGGTAGAGGG - Intergenic
1177870029 21:26560461-26560483 TGCTGACTAGAAGTGGTAGAAGG + Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179856423 21:44164671-44164693 GGGAGACCAGCAGAGGTGGAGGG + Intergenic
1179913243 21:44461077-44461099 TGGGGTCCAGCAGTGGGGGATGG + Exonic
1180057677 21:45367293-45367315 TGGCAGCCAGCAGTGGGAGAGGG - Intergenic
1182454883 22:30443959-30443981 TGGGGTACAGCAGTGGTAGGTGG - Intergenic
1183803990 22:40192791-40192813 GGATGAACAGCAGGGGTAGAAGG + Intronic
1184648241 22:45907786-45907808 AGGTGATCAGCAGTGGCAGACGG + Intergenic
1185344028 22:50303714-50303736 TGCTGACCAGCTGTGCCAGAGGG + Intronic
950005543 3:9688887-9688909 GGGGGACCAGTAGTGGGAGAAGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955407984 3:58637507-58637529 GGGTGACCACCACTGGTAGAAGG + Intronic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
959522148 3:107333052-107333074 TGAGGACTAGCAGTGGTATATGG - Intergenic
962806973 3:138934723-138934745 TGGTCTCCAGCAGAGGGAGATGG + Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
967356630 3:188579131-188579153 TGCTGACCAGCACTTGCAGATGG + Intronic
968359445 3:198137080-198137102 TGTTCAGCAGCAGTGGGAGAGGG - Intergenic
968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG + Intergenic
970718316 4:18955275-18955297 TGAGAAGCAGCAGTGGTAGAAGG + Intergenic
971017644 4:22505225-22505247 TTGTGCCCAGCAGTGGGACATGG + Intronic
971203445 4:24535745-24535767 TGGGGTCCAGAAGTGCTAGAGGG - Intronic
972580968 4:40395354-40395376 TGCTGGCCAGCAATGGCAGAGGG + Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
977295197 4:95201976-95201998 TTTTGACCAGCAATAGTAGAGGG - Intronic
978238312 4:106487241-106487263 TGGTGACAAGCAGTGGAGGGTGG + Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978832242 4:113102170-113102192 TGGTGAGCAGCAGCGGTGGCTGG + Intronic
978848282 4:113301644-113301666 TGGTGACCAGGTGTTGGAGAAGG - Intronic
979278742 4:118841092-118841114 TGGTGATCAGCAGTATTATACGG + Intergenic
979468298 4:121066952-121066974 TGGTGACCAGCTGAAGTAAATGG - Intronic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
981240875 4:142474508-142474530 TGGATACCAGCAGTGGGAGTGGG - Intronic
981673563 4:147314977-147314999 TGGTGACCAGAAATGGAAAAGGG - Intergenic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983155449 4:164341359-164341381 TGTTGAATAGAAGTGGTAGAGGG - Intronic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
987738468 5:21874686-21874708 CTGTGAACAGCAGTGGTGGATGG - Intronic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988163546 5:27552238-27552260 TAGTGACCAGCAGTGAGAGTGGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994203041 5:97000595-97000617 TGATGATCATCCGTGGTAGATGG + Intronic
994284572 5:97949253-97949275 TGGTGTCAAGCATTGGCAGATGG - Intergenic
994435213 5:99720862-99720884 TGGTTACCATCAGTGGGAGGGGG - Intergenic
994851968 5:105067286-105067308 AGGTGTCCAACAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996128268 5:119751524-119751546 TGGCAAACAGCAGTGGCAGATGG - Intergenic
996210475 5:120802674-120802696 TTGTGACAAGCAGGGGAAGAGGG - Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
997455573 5:134014960-134014982 AGGTGCCCATCAGTGGTGGATGG + Intergenic
998696689 5:144648705-144648727 TGGTCACCTGCAGACGTAGATGG + Intergenic
998979592 5:147687193-147687215 CAGTGACCAGCAGTAGTAAATGG - Intronic
999201130 5:149817026-149817048 TGGTGACCAGGGGTGGGGGATGG - Intronic
999892137 5:155990019-155990041 TGTTTCCCAGAAGTGGTAGAGGG - Intronic
1000474133 5:161684354-161684376 TTGTGATCACCAGTGGTAGGAGG + Intronic
1000849851 5:166326475-166326497 TGGTGAGCAGGACTGGGAGATGG + Intergenic
1001635533 5:173207508-173207530 TGGTGACCAGGAGTGGGAGATGG + Intergenic
1002590847 5:180291243-180291265 CGGTGTCCAGCAGTGCCAGAGGG - Intronic
1006933688 6:37702899-37702921 TAGTGGCCAGAAGTGGGAGAGGG - Intergenic
1008132932 6:47739140-47739162 TGGTGAGCAGCAGTGATGGTGGG + Intergenic
1009229363 6:61043668-61043690 TGGTGAACAGCAGTGGGGGTGGG + Intergenic
1009325798 6:62346377-62346399 TGGTGACAAGCAGTGGGGTAGGG - Intergenic
1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009885202 6:69617025-69617047 GGGTGATCAGCAGTGGTGGACGG - Intergenic
1010955093 6:82081255-82081277 AGGTGTCCATCAATGGTAGATGG + Intergenic
1011189091 6:84712068-84712090 CGGTGAACAGCAGTGGCGGACGG + Intronic
1011403754 6:86993627-86993649 TGCTGCCATGCAGTGGTAGAAGG - Intronic
1012319823 6:97829290-97829312 TGGTGCTCAGCAGTGTCAGAAGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013410504 6:109879599-109879621 TGGTGATCAGCAGTGGTGGACGG - Intergenic
1014075028 6:117225802-117225824 TGGTCACTAGCAGGGATAGAAGG - Intergenic
1014183419 6:118408812-118408834 TGGTGGTCAGCAGGGGTAGGGGG - Intergenic
1014478713 6:121908342-121908364 TGTTGAACAGAAGTGGTACAAGG + Intergenic
1015147168 6:130000190-130000212 TGGTGGCCACCAGTGGAAGGAGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018831708 6:167448578-167448600 GGGTGACCATCAGTGGCAGGTGG - Intergenic
1019257302 7:60585-60607 TCGTGGCCAGCAGGGATAGAAGG - Intergenic
1019559700 7:1649888-1649910 GGGTGACCAGGAGAGGTAGAGGG + Intergenic
1021471126 7:21003326-21003348 TGGGTGCCAGCAGTGGCAGATGG - Intergenic
1021690776 7:23228870-23228892 GGGTGACCAGCAGTGCCTGATGG + Intergenic
1026788482 7:73316911-73316933 TGGGGACCAGCAGTGTTGGTTGG + Intronic
1028019200 7:85749727-85749749 TGGTTACCAGCAGTGGGAGCAGG - Intergenic
1028142992 7:87291970-87291992 TGGCTACCAGCAGTGGCAGTGGG - Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1029392705 7:100286245-100286267 TGGTGTCCAGCCCTGGGAGAGGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1033113336 7:138602913-138602935 TGGTGACCTGCAGAGGCAGATGG - Intronic
1034702982 7:153112316-153112338 TGGTTATCAGCAGTGTTAGTGGG + Intergenic
1034925625 7:155119118-155119140 TTGAGACCAGCAGTGGCAGAAGG + Intergenic
1039697373 8:39927093-39927115 AGGTGCCCATCAATGGTAGATGG - Intronic
1041339564 8:56829167-56829189 TGTTGAAAAGAAGTGGTAGAAGG - Intergenic
1041475410 8:58259874-58259896 TTGTAACCAGCACTGGTAAAGGG - Intergenic
1041852696 8:62410349-62410371 AAGTGCCCATCAGTGGTAGATGG - Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042673716 8:71293892-71293914 TGTCGAACAGGAGTGGTAGAGGG - Intronic
1044543517 8:93433902-93433924 TGGAGAGCAGCAGTGGTCGAGGG - Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1046102945 8:109635481-109635503 TGGTGACCAGCAGAAGTGGAGGG - Intronic
1047889757 8:129294756-129294778 TGGTGACCAGGGGTGGGAGTTGG + Intergenic
1048100260 8:131343232-131343254 TGGTGATCAGCAGCGGTGGACGG + Intergenic
1048629433 8:136225928-136225950 TGGTGAACAGCAATTGCAGAGGG - Intergenic
1049016568 8:139924299-139924321 TGATGGCCAGCAGTGGTACCTGG + Intronic
1049051827 8:140203822-140203844 TGGGTACCAGGAGTGGTGGAAGG + Intronic
1049204471 8:141357287-141357309 TGATGACCAGCAGGGGCAGCAGG + Exonic
1050067598 9:1777001-1777023 TGGCAACCAGCAGTGGGAGATGG - Intergenic
1050194161 9:3062846-3062868 TGGTTACCTGCAGTGGCAGATGG - Intergenic
1050363694 9:4854722-4854744 TGTTGACCAGCAGTGGCAGTGGG + Intronic
1050929936 9:11310393-11310415 AGGTGCCCATCAGTGGTGGATGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053910998 9:42903871-42903893 AGGTGTCCATCAGTGATAGATGG - Intergenic
1055527349 9:77148274-77148296 TGGAGACCTGCAATTGTAGAGGG - Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056680607 9:88714412-88714434 TGGTGACCAGCACAGGGAGAGGG - Intergenic
1059661049 9:116400436-116400458 TGGTGGCAATCAGTGGTAGTAGG + Exonic
1060904043 9:127288455-127288477 TGGAGAGGAGCAGTGGTAGATGG + Intronic
1062744133 9:138200794-138200816 TGTTCAGCAGCAGTGGGAGAGGG - Intergenic
1186136491 X:6527349-6527371 TGGTCACCAGCAGGGGTACAGGG - Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1188869669 X:35358898-35358920 TGGTGATGAGCAGTGGGGGATGG + Intergenic
1188890722 X:35608833-35608855 TGGTTACCAGGAGTGGGAGGTGG + Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195146909 X:102027125-102027147 TGGGATCCAGCAGTGGTGGATGG - Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197149551 X:123205039-123205061 TGGTGACTTGCAGTGGTTGGCGG + Intronic
1199303576 X:146240992-146241014 TGGTGTCCATCAGTGGAGGATGG - Intergenic
1200849217 Y:7865528-7865550 TGGTGACCAGCACTGGTGGATGG + Intergenic