ID: 927826579

View in Genome Browser
Species Human (GRCh38)
Location 2:26313641-26313663
Sequence CCTATGCGGGCCCCGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927826573_927826579 -5 Left 927826573 2:26313623-26313645 CCTCTCCTTGGGCAGAACCCTAT 0: 1
1: 0
2: 0
3: 11
4: 140
Right 927826579 2:26313641-26313663 CCTATGCGGGCCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 59
927826570_927826579 6 Left 927826570 2:26313612-26313634 CCTCACCTGAGCCTCTCCTTGGG 0: 1
1: 0
2: 2
3: 35
4: 321
Right 927826579 2:26313641-26313663 CCTATGCGGGCCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 59
927826572_927826579 1 Left 927826572 2:26313617-26313639 CCTGAGCCTCTCCTTGGGCAGAA 0: 1
1: 0
2: 1
3: 30
4: 229
Right 927826579 2:26313641-26313663 CCTATGCGGGCCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 59
927826575_927826579 -10 Left 927826575 2:26313628-26313650 CCTTGGGCAGAACCCTATGCGGG 0: 1
1: 0
2: 0
3: 3
4: 86
Right 927826579 2:26313641-26313663 CCTATGCGGGCCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927826579 Original CRISPR CCTATGCGGGCCCCGAAGCC TGG Intronic
902368993 1:15993807-15993829 CCCATGGGGACCCCGAAACCAGG + Intergenic
907323691 1:53621389-53621411 CCTATGTGGGCCTCACAGCCCGG + Intronic
921065447 1:211619405-211619427 CCTAGGTGGGTCCAGAAGCCAGG - Intergenic
1073431269 10:103488923-103488945 CCTAGTCGGGACCTGAAGCCAGG + Intergenic
1075658042 10:124174682-124174704 CCCATGCAGGCCCCGCAGCCAGG + Intergenic
1076566776 10:131404360-131404382 CCTATGGGAGCCCCTGAGCCTGG - Intergenic
1083194115 11:61072802-61072824 CCAATCCGGGATCCGAAGCCAGG + Intergenic
1083955266 11:65979338-65979360 CCTGTGCAGCCCCCGAGGCCAGG - Exonic
1084030962 11:66480351-66480373 CCCATCCGGACCCCGAGGCCAGG + Exonic
1084272950 11:68038794-68038816 TCTATGCTGGCCCCGATGCAGGG - Intergenic
1085411796 11:76295733-76295755 CCTATGGGGTCCTTGAAGCCTGG + Intergenic
1089455956 11:118625915-118625937 CCTCTGGGGGCTCAGAAGCCTGG + Intronic
1103339766 12:120215215-120215237 CCTGGGGGGCCCCCGAAGCCCGG - Exonic
1103649575 12:122422435-122422457 CCTGGGCGGGCCCCGCAGGCCGG + Intronic
1113076878 13:106475478-106475500 ACTATGCCGGCTCCTAAGCCAGG - Intergenic
1119383815 14:74245056-74245078 CCTGGGCAGGCCCCGAACCCAGG - Intronic
1122961569 14:105096290-105096312 CCTCTGTGGGCCCCTAATCCTGG - Intergenic
1123964059 15:25438412-25438434 CCACAGCGGGCCCCGAAGGCCGG + Intronic
1126034797 15:44536566-44536588 CCTCTGGGGTCCCGGAAGCCCGG + Intergenic
1129901106 15:79149969-79149991 CCATTGCAGGCCCAGAAGCCAGG - Intergenic
1131259372 15:90880638-90880660 CCTCTGCGGGACCCCAAGCCAGG - Intronic
1133659485 16:7902687-7902709 CCTATGCTGGTCACAAAGCCAGG - Intergenic
1133732421 16:8589115-8589137 TCTCCGCAGGCCCCGAAGCCCGG + Intronic
1134670695 16:16052829-16052851 TCTCTGCGGGCCCCCAAGCCGGG + Intronic
1137478445 16:48830902-48830924 CAGATGCGGGCCCTGAACCCAGG - Intergenic
1139534557 16:67563149-67563171 GCTAGGCGGGCGCCGAAGCCGGG - Intronic
1144815144 17:18028893-18028915 CCTCTGCCAGCCCCGCAGCCTGG + Intronic
1151370723 17:73644829-73644851 ACTTTGCGGGTCCCGGAGCCGGG + Intergenic
1160966126 19:1747723-1747745 CCTGTGAGGGCCCCGAAACTGGG + Intergenic
1161398000 19:4054810-4054832 CCGACGCGGGCGCCGACGCCGGG - Exonic
1164533836 19:29069387-29069409 CCTCTGAGGGACCCCAAGCCAGG + Intergenic
1164670920 19:30071445-30071467 CTCATGCTGGGCCCGAAGCCAGG - Intergenic
1166714287 19:44956575-44956597 CCTAAGCTGTCCCTGAAGCCAGG - Intronic
1166743194 19:45126456-45126478 AGCATGCGGGCCTCGAAGCCAGG - Intronic
1167645756 19:50704019-50704041 CCTATCCTGGCCCCCAAGTCAGG + Intronic
926090097 2:10043895-10043917 CCTGGGCGGGCTCCGGAGCCGGG + Intronic
927826579 2:26313641-26313663 CCTATGCGGGCCCCGAAGCCTGG + Intronic
929780793 2:44955644-44955666 CCTCCGAGGACCCCGAAGCCTGG + Intergenic
934526912 2:95057656-95057678 CTTGTGTGGGCCCCGAAGGCAGG - Intergenic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
1168956353 20:1837041-1837063 GGTATGAGGGCCACGAAGCCAGG + Intergenic
1172907027 20:38378003-38378025 CCCATGAGGACCCCAAAGCCTGG - Intergenic
1183340902 22:37280778-37280800 CCAATTCAGGCCCAGAAGCCAGG - Intergenic
1184813344 22:46852282-46852304 TCTCTGCGGGCCGGGAAGCCGGG - Intronic
1184930236 22:47675467-47675489 CCTATCAGGGCCCCGACCCCAGG - Intergenic
950045944 3:9948757-9948779 CCCATGGGGGCCCTGCAGCCAGG - Exonic
954156051 3:48685529-48685551 CCTCTCCGGGACCCGAGGCCAGG - Intronic
954313183 3:49786173-49786195 CAGATGCTGGCACCGAAGCCGGG - Exonic
966874582 3:184314895-184314917 ACTATGCGGGCCCCGCGGGCTGG + Intronic
968873029 4:3251013-3251035 CCTAGGCAGGCCCCAAAGCCGGG + Intronic
983660909 4:170130177-170130199 CCAATGGGGGCCCTGCAGCCAGG - Intergenic
998251973 5:140559502-140559524 CCTATGAGGTCCCCCAAACCTGG + Intronic
1006694560 6:35920615-35920637 CCGAGGCAGGCCCCGCAGCCGGG - Intronic
1007703265 6:43776483-43776505 CCCAGGCTGGCCACGAAGCCTGG - Intronic
1026665568 7:72337267-72337289 CCAAGGCGAGCCCAGAAGCCCGG - Intronic
1029448639 7:100628288-100628310 CTTCTGCGGGGCCGGAAGCCTGG + Exonic
1033049142 7:137988310-137988332 CCTTTGCGGGTCCTGAAACCTGG + Intronic
1045036258 8:98178633-98178655 CCCATGCAGGCACAGAAGCCAGG + Intergenic
1049212042 8:141391442-141391464 CCTGGGCGGGCCTCGCAGCCTGG + Intergenic
1049477980 8:142805716-142805738 CCTTTTCAGGCCCCAAAGCCAGG + Intergenic
1049603642 8:143519301-143519323 CCTGTGTTGGCCCCGAAGGCTGG - Intronic
1194629763 X:96269545-96269567 ACCATGCGGGAGCCGAAGCCGGG + Intergenic
1200091821 X:153639598-153639620 CATCTGCGGGCTCCGGAGCCAGG - Intergenic
1200353742 X:155526371-155526393 CCTATGGGTGCCCAGAAGGCAGG + Intronic
1201867419 Y:18670019-18670041 CCAATGAGGGTCCTGAAGCCAGG + Intergenic