ID: 927826650

View in Genome Browser
Species Human (GRCh38)
Location 2:26313999-26314021
Sequence CAGAAACAGAGGAAGCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 732
Summary {0: 1, 1: 0, 2: 12, 3: 69, 4: 650}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927826646_927826650 18 Left 927826646 2:26313958-26313980 CCAGCAGGCTCTGACATGCTGTT 0: 1
1: 0
2: 2
3: 13
4: 198
Right 927826650 2:26313999-26314021 CAGAAACAGAGGAAGCAGTGGGG 0: 1
1: 0
2: 12
3: 69
4: 650
927826645_927826650 19 Left 927826645 2:26313957-26313979 CCCAGCAGGCTCTGACATGCTGT 0: 1
1: 0
2: 5
3: 17
4: 219
Right 927826650 2:26313999-26314021 CAGAAACAGAGGAAGCAGTGGGG 0: 1
1: 0
2: 12
3: 69
4: 650
927826644_927826650 26 Left 927826644 2:26313950-26313972 CCTGGAACCCAGCAGGCTCTGAC 0: 1
1: 1
2: 1
3: 35
4: 322
Right 927826650 2:26313999-26314021 CAGAAACAGAGGAAGCAGTGGGG 0: 1
1: 0
2: 12
3: 69
4: 650

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927826650 Original CRISPR CAGAAACAGAGGAAGCAGTG GGG Intronic
900331611 1:2137578-2137600 CAGATACAGAGGAGGCCATGTGG - Intronic
900588236 1:3444226-3444248 CAGAAGGCAAGGAAGCAGTGGGG - Intergenic
900809086 1:4787581-4787603 CAGCAAGAGTGGAAGCAGAGGGG + Exonic
901558609 1:10051595-10051617 TAGAAAAAGTGGTAGCAGTGTGG - Intronic
901842249 1:11961006-11961028 CAGAGAAAGAGGAAGGACTGGGG + Intronic
902367798 1:15989008-15989030 CAGAGACAGAGGAGGCTGAGAGG - Intergenic
902530029 1:17085115-17085137 CAAAAACAGAGGAAGGTGGGGGG - Intronic
902651816 1:17842368-17842390 AAGCAACAGAGGAAGTAGTGGGG - Intergenic
902729989 1:18362934-18362956 CAGAAACAGAGGCAGAAGTGGGG - Intronic
903135009 1:21303514-21303536 CTGAAACAAAGGAAGCACTCAGG + Intronic
903228672 1:21908714-21908736 CAAAACCAGAGGAAGCTTTGGGG - Intronic
903242842 1:21995209-21995231 CAGAGGCAGAGGTTGCAGTGAGG - Intronic
903727710 1:25463569-25463591 CAAAAACAGAAAAAGCAATGAGG + Intronic
904333548 1:29783083-29783105 CAGGAACAGAGGGATCAGAGTGG - Intergenic
904431907 1:30469742-30469764 CAGAAGCACAGAAAGCAGTGGGG + Intergenic
904616102 1:31750759-31750781 CAGAATCACAGGGCGCAGTGGGG + Intronic
904850732 1:33457431-33457453 CAGAAGCAGAGGGATAAGTGAGG - Intergenic
905592804 1:39179308-39179330 CAGAAACAGAAGATGCAGAAGGG - Intronic
905850655 1:41272158-41272180 CAGAAGCAGGGGAAGCAGCCAGG - Intergenic
906517367 1:46447759-46447781 CAGAAACCGAGGGAGCAGGTGGG + Intergenic
906670378 1:47649836-47649858 CAGAAACTGAGGACCCAATGAGG + Intergenic
906687582 1:47772404-47772426 CAGACCTCGAGGAAGCAGTGTGG + Intronic
906712417 1:47940795-47940817 GAGAAATAAAGGCAGCAGTGTGG + Intronic
906961106 1:50419916-50419938 CAGAAAGAGAGGGAGCCCTGGGG - Intronic
907025768 1:51116744-51116766 CAGAAACACAGAAAGCAGGAGGG - Intronic
907296034 1:53455197-53455219 CAGAAATAGAGAAAGGAGAGTGG + Intergenic
907808644 1:57846047-57846069 CAGAGACAGAGGGAAGAGTGTGG + Intronic
908844141 1:68307387-68307409 CAGAGACCTAGGAAGCTGTGCGG - Intergenic
909941996 1:81621891-81621913 CAGGAGCAGAGGAGGAAGTGAGG - Intronic
910108266 1:83654520-83654542 CTGAAACAGAGGAAGAATTATGG - Intergenic
910171862 1:84386495-84386517 CAGCAGCAGAGGTAGCAGAGGGG + Intronic
910427342 1:87130677-87130699 CAGAACCAGATGAAGAAGTCAGG - Intronic
910766158 1:90784468-90784490 CAAAAACAAAAGAAGCAGTGTGG + Intergenic
911110290 1:94176678-94176700 GAGAAGCAGAGGTTGCAGTGAGG - Intronic
911153191 1:94614982-94615004 CAGAAACTTAGGAAGCAGTGTGG + Intergenic
911196549 1:95000837-95000859 CAGAAAGAGAAGAAGAAGAGAGG + Intronic
911304604 1:96217577-96217599 CAGAAATATAGGAAACAATGAGG - Intergenic
911410958 1:97505930-97505952 AAGAAGCAGATGAGGCAGTGGGG + Intronic
911735842 1:101335765-101335787 CATAAACAGGGGAAGCAGCCCGG + Intergenic
912518344 1:110229487-110229509 CAGAAGCAGAGGAAGCAGCGTGG - Intronic
913142717 1:115957119-115957141 GAGAGACTGAGGAAGCAGTTGGG + Intergenic
913274418 1:117122879-117122901 CATGAACAAAGAAAGCAGTGAGG - Intergenic
913283323 1:117206262-117206284 CTGAAACAGATGTTGCAGTGAGG - Intronic
913335076 1:117702525-117702547 CACAGAGAGAGGAAGCTGTGTGG - Intergenic
913439637 1:118884150-118884172 CAGAAGCAGAGGAAGCTGCAGGG + Exonic
913579250 1:120209775-120209797 CAGGAACAGGGGAAGCAATTAGG - Intergenic
913628922 1:120688613-120688635 CAGGAACAGGGGAAGCAATTAGG + Intergenic
913705422 1:121417068-121417090 CAAAGACAGAGGAGGAAGTGGGG - Intergenic
914203291 1:145505479-145505501 AAGACACAGTGGAAGAAGTGTGG + Intergenic
914204782 1:145517552-145517574 AAGAAGAAGAGGAAGGAGTGTGG + Intergenic
914237220 1:145823402-145823424 AAGACACAGTGGAAGAAGTGTGG + Intronic
914250324 1:145917079-145917101 CAGAAACAGAGAAAGCAAGAGGG + Intronic
914347783 1:146814772-146814794 CAGGAACAGAGCAATCAATGTGG + Intergenic
914370780 1:147022675-147022697 AAGAAGAAGAGGAAGGAGTGTGG - Intergenic
914482413 1:148078633-148078655 AAGACACAGTGGAAGAAGTGTGG + Intergenic
914561181 1:148821207-148821229 CAGGAACAGGGGAAGCAATTAGG - Intronic
914611653 1:149309001-149309023 CAGGAACAGGGGAAGCAATTAGG + Intergenic
914689370 1:150011843-150011865 TAGAAACTGAGGAAGAAGTGAGG - Intergenic
914888673 1:151603609-151603631 CAGAGGCAGAGGTTGCAGTGAGG + Intergenic
914991966 1:152506658-152506680 CAGAAGCAGAGGCTGGAGTGAGG - Intergenic
915126513 1:153669394-153669416 CAGAAACAGTGTAAGCATGGTGG - Intronic
915487503 1:156232037-156232059 TAGAAACTGTGGAAGGAGTGAGG + Intronic
915938675 1:160104414-160104436 AAGAAACAGATGGAACAGTGGGG + Intergenic
916459659 1:165010299-165010321 CAGGAATACAGGAAGCAGAGTGG - Intergenic
916509731 1:165461423-165461445 CAGAAACAGGGAAAGAAGTTAGG - Intergenic
916689559 1:167177267-167177289 CAGAAACAGAGAAAACAGGAAGG - Intergenic
916693505 1:167213877-167213899 AAGAAAAAGAGGATCCAGTGAGG + Intergenic
918109822 1:181445680-181445702 CTGACACAGAGGCAGCAGTTGGG + Intronic
918571490 1:185998333-185998355 CAGAAACAGAGACAGCCATGAGG - Intronic
920102893 1:203529095-203529117 GAAGAACAGAGGAACCAGTGGGG - Intergenic
921384550 1:214555381-214555403 CAGAAGCAGAGGATTCAGAGAGG - Intergenic
921417952 1:214912421-214912443 CAGAGACAGTGGCAGCAGTAAGG + Intergenic
921442661 1:215206134-215206156 CAGAAACAGAGGTAACAGTAAGG - Intronic
921572505 1:216796164-216796186 CAGAAATAGAAGGAGCAGTGGGG + Intronic
921677930 1:217997488-217997510 CTGAAATAGAGGAACCAGTAGGG + Intergenic
922107383 1:222524329-222524351 CAGAGGCAGAGAAAGCAATGGGG - Intronic
922443928 1:225680232-225680254 GAGAGAAAGAGGAGGCAGTGTGG - Intergenic
922557748 1:226545928-226545950 CAGGACCAGTGGAAGCTGTGTGG - Intergenic
923974719 1:239249233-239249255 CCGAAAAAGAGCAAGCTGTGTGG + Intergenic
924066289 1:240225554-240225576 CAGAAACACAAGAAGCTCTGGGG + Intronic
924379244 1:243446626-243446648 CAGGAACAGAGAAAGCAGAAAGG - Intronic
924462973 1:244275526-244275548 CAGAGAGAGAGATAGCAGTGAGG + Intergenic
924462977 1:244275581-244275603 CAGAGAGAGAGATAGCAGTGAGG + Intergenic
924462985 1:244275674-244275696 CAGAGAGAGAGATAGCAGTGAGG + Intergenic
924462989 1:244275750-244275772 CAGAGAGAGAGATAGCAGTGAGG + Intergenic
924462995 1:244275820-244275842 CAGACAGAGAGATAGCAGTGAGG + Intergenic
924463061 1:244276542-244276564 CAGAGAGAGAGATAGCAGTGAGG + Intergenic
1064193070 10:13224329-13224351 AAGAAAGAAAGGAAGCGGTGGGG + Intronic
1064626317 10:17265575-17265597 CAAAAATAAAGGAGGCAGTGGGG - Intergenic
1065293785 10:24256081-24256103 CAGAACCAGAGGGAGAAGTGAGG - Intronic
1065519598 10:26558798-26558820 CAGAAACAACAGAAGCAATGAGG + Intronic
1066372328 10:34827965-34827987 CATAAACAGAGGAAGATGTCTGG - Intergenic
1067534910 10:47101954-47101976 CAGAAGCAGAGGGAGAAATGTGG + Intergenic
1067726036 10:48771849-48771871 TAGGAAGAGAGGAAGCAGGGAGG + Intronic
1068254450 10:54491587-54491609 AAGAAATAAAGAAAGCAGTGGGG + Intronic
1068928220 10:62561848-62561870 CAGAACCAGAGGAATCAGCTAGG - Intronic
1068930478 10:62584082-62584104 AGGAAAAAGAGGAAGCACTGGGG + Intronic
1070005756 10:72422481-72422503 CAGAAGCAGAGAAAGGAGAGAGG - Intronic
1070547379 10:77463344-77463366 TAGAAGCAGAGGAAACACTGAGG - Intronic
1070552114 10:77498111-77498133 CAGAAAAAGAGAAGGCAGGGAGG + Intronic
1070617804 10:77982326-77982348 CAGAGACAGAGAAAGCTGTGAGG + Intronic
1070700776 10:78600243-78600265 TGTAAACAGAGGTAGCAGTGAGG - Intergenic
1071105279 10:82086620-82086642 AAGATAGAGAGGAAACAGTGTGG + Intronic
1071160788 10:82743010-82743032 CAGAATCAAAGAATGCAGTGGGG + Intronic
1071530180 10:86384437-86384459 CAGAAAAAGAGGAACCAGGCAGG + Intergenic
1071892647 10:90028433-90028455 CAGGCACAGAGGGAGCAGGGGGG - Intergenic
1072423601 10:95310470-95310492 GAGAAACAGAGGAGGAAGAGGGG + Intergenic
1072745713 10:97937836-97937858 CTGAAACACAGGAAGAGGTGGGG - Intronic
1073140657 10:101245282-101245304 CAGAACCAGAGCAGGCAGAGAGG + Intergenic
1073455931 10:103636765-103636787 CAGAGGGAGAGGAAGGAGTGGGG - Intronic
1074050600 10:109877874-109877896 CAGAAAGACAGAAAGCAGAGTGG + Intronic
1074617731 10:115087107-115087129 GAGGAAGAGAGGAAGCAGGGAGG + Intergenic
1075120194 10:119659143-119659165 CAGTAACAGATGAAGCTGCGGGG + Intronic
1075410756 10:122226211-122226233 CAGGAAGAGAGGAGGAAGTGGGG - Intronic
1075565464 10:123500481-123500503 CAGAAGCAGAGGAAGGAGGAAGG - Intergenic
1075823274 10:125332066-125332088 TAGAAACACAGAATGCAGTGAGG - Intergenic
1076079893 10:127569902-127569924 CAGACATGGAGGAAGGAGTGTGG + Intergenic
1076091468 10:127689932-127689954 CAGGAACAAGGGGAGCAGTGAGG - Intergenic
1076118956 10:127920994-127921016 CAGACACCGAGGAAGCTTTGAGG - Intronic
1076441705 10:130484999-130485021 CAGGCACAGAGGAAGGACTGCGG - Intergenic
1076558720 10:131347055-131347077 AAGAAAGGGAGGAAGGAGTGAGG - Intergenic
1078414269 11:11152496-11152518 CAGAAAAAGAGAGAGAAGTGGGG + Intergenic
1078570919 11:12457502-12457524 CAGCAATGGAGGAAGCAGAGAGG - Intronic
1080051138 11:27860250-27860272 CAAAAATAGAGGCAGCAGAGAGG + Intergenic
1080109325 11:28547754-28547776 CAGGAACAAAGGCAGCAGGGAGG - Intergenic
1080352515 11:31401539-31401561 GAAAAACAGAGGAGGAAGTGGGG - Intronic
1080773643 11:35365589-35365611 CAGAGACAGAGACAGCAGAGCGG - Intronic
1081330149 11:41791798-41791820 CAGAAACAGAGCTGGAAGTGGGG - Intergenic
1081549858 11:44101082-44101104 CAGAAACTGAGGAAACACAGTGG + Intronic
1082207235 11:49452408-49452430 CAGAAGAAAAGGAAGCAGTCTGG - Intergenic
1083687998 11:64388836-64388858 CAGAAGCAGGGGATGCAGAGAGG + Intergenic
1083688704 11:64393128-64393150 CAGAGCCAGAGGCTGCAGTGGGG - Intergenic
1083712786 11:64559348-64559370 AAGAAACAGAGGAGGCAGGAGGG - Intronic
1083894124 11:65611681-65611703 AGGAAACGCAGGAAGCAGTGGGG + Intronic
1084561441 11:69907762-69907784 CAGAAGCAGAGGAAGCAGGCAGG + Intergenic
1085682234 11:78587773-78587795 CAGAAGCAGAGAGAGCAGTTTGG + Intergenic
1086063005 11:82719585-82719607 CAGAATCACAGGCAGCACTGAGG + Intergenic
1086648041 11:89249325-89249347 CAGAAGAAAAGGAAGCAGTCTGG + Intronic
1088824818 11:113484535-113484557 TAGAGACAGAGAGAGCAGTGAGG - Intergenic
1088989764 11:114942527-114942549 CAAAGACAGTGGTAGCAGTGAGG + Intergenic
1089739650 11:120573664-120573686 TAGAAACAGAGAGAGCAGTGGGG + Intronic
1089828118 11:121297861-121297883 CAGAAACTTAGGAAGCAGTGTGG + Intronic
1090439325 11:126713086-126713108 CTGAAACTGAGGAAGCACAGGGG + Intronic
1090759479 11:129823594-129823616 CAGAAACAGAGGAAATAGCAAGG - Intronic
1090944684 11:131419529-131419551 CAGAATGAGGGGAGGCAGTGAGG + Intronic
1091104852 11:132909044-132909066 CAGAGACAGAAGCATCAGTGCGG + Intronic
1091155116 11:133365013-133365035 TAGAGAGAGAGGCAGCAGTGGGG - Intronic
1091427248 12:401758-401780 AAGTAACTGCGGAAGCAGTGCGG + Intronic
1091532616 12:1374296-1374318 CAGAAAGAGGTGAAGCAATGAGG + Intronic
1091570638 12:1682474-1682496 CAGAGGCAGAGGTTGCAGTGAGG + Intergenic
1092006235 12:5072790-5072812 AAGAAACAGAGGAAGCACGCTGG + Intergenic
1092819319 12:12338485-12338507 CAGAAAAATAGGTAGCAGTTGGG + Exonic
1093817389 12:23566487-23566509 CCAACACAGAGGAGGCAGTGAGG - Intronic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1094570511 12:31637409-31637431 AAGAAAGAGAGGAAGGAGGGAGG - Intergenic
1095329715 12:40944201-40944223 CAGACACATAGGAATCACTGGGG - Intronic
1095871494 12:47033266-47033288 CAGAAACGCAGGAACCAGTGAGG - Intergenic
1096261748 12:50097051-50097073 GAGACCCAGAGGAAGGAGTGAGG + Intronic
1097683741 12:62672917-62672939 CATAAACAGGGGAAGGAGAGTGG + Intronic
1097879968 12:64677915-64677937 GAGCTACAGAGCAAGCAGTGTGG - Intronic
1099664082 12:85604264-85604286 CAAAAAAAGAGGAGGTAGTGTGG - Intergenic
1101037809 12:100722282-100722304 TAGAAGCAGAGGAACCAGTTGGG - Intronic
1102122906 12:110456677-110456699 AAAAAAAAGAGGAAGTAGTGGGG - Intronic
1102216138 12:111162590-111162612 CACAAGCAGAGGAAGCTCTGTGG + Intronic
1102238553 12:111309611-111309633 CAGAAATAGAGGAAGGAAGGAGG - Intronic
1102851153 12:116246656-116246678 CAGACACAGCTGAAGCATTGTGG + Intronic
1102956983 12:117065214-117065236 CAGACACAGGGGAACCAGGGAGG + Intronic
1103233030 12:119348287-119348309 TAGAACCAGAGTAAGCAGTTTGG + Intronic
1103688799 12:122753425-122753447 GAGAAAAACAGGAAGCAATGGGG - Intronic
1104063475 12:125287171-125287193 CAGAAGCAGAGGAGGGAGGGAGG - Intronic
1104758697 12:131284303-131284325 TAGAAGCAGAGGAGGCTGTGAGG + Intergenic
1104821904 12:131682222-131682244 TAGAAGCAGAGGAGGCCGTGAGG - Intergenic
1105511811 13:21058373-21058395 CATAAACAGAGGAAGGATTTCGG - Intronic
1105722092 13:23127277-23127299 TAGATAGAGGGGAAGCAGTGTGG + Intergenic
1105965199 13:25377431-25377453 CAGGAATAGAGTAAGGAGTGGGG + Intronic
1106323850 13:28669054-28669076 CTGAGACAGAGCAAGCAGAGAGG - Intronic
1106424071 13:29609144-29609166 CAGACCCAGAGGAATCACTGAGG - Intergenic
1106916912 13:34525563-34525585 CAGAGACAGTGGAAGCTGTGAGG + Intergenic
1107609501 13:42099008-42099030 CAGAGAGAGAGAAATCAGTGTGG + Intronic
1107980483 13:45730005-45730027 CAGAAAAACAGGCTGCAGTGTGG + Intergenic
1108180819 13:47838082-47838104 CACAAGCTGAGGAAGGAGTGAGG - Intergenic
1108299876 13:49062506-49062528 CTGAAAAATAGGAAGTAGTGTGG - Intronic
1109311494 13:60699717-60699739 CAGAAACAGCAGAATGAGTGGGG - Intergenic
1109486514 13:63028940-63028962 CATATGCAGAGGAAACAGTGAGG + Intergenic
1109951634 13:69507950-69507972 AAGACACAGAGGAAACAATGTGG - Intergenic
1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG + Intergenic
1110905213 13:80879007-80879029 GAGAAACTGAGGAAACACTGAGG + Intergenic
1111822326 13:93228291-93228313 CAGCAACTGGGGAAGCACTGAGG - Intronic
1112943092 13:104890428-104890450 GAGACACAGAAGAAGAAGTGTGG - Intergenic
1113643079 13:111972257-111972279 GAGAGACAGAGAATGCAGTGTGG - Intergenic
1113945124 13:114039682-114039704 CTGTAACAGAGGGAGCAGTGGGG - Intronic
1114050977 14:18919660-18919682 CGGCAACGGAGAAAGCAGTGTGG - Intergenic
1114111582 14:19482262-19482284 CGGCAACGGAGAAAGCAGTGTGG + Intergenic
1114428666 14:22641781-22641803 CAGAAACAGAGGAAAAATTAAGG + Intergenic
1115096659 14:29645857-29645879 CAGTAATAGAGTAAGGAGTGGGG - Intronic
1115995161 14:39188517-39188539 TAGGAATAGAGGAAGCAGAGAGG + Intergenic
1116962490 14:50980898-50980920 CAGAAAAAGATAAAACAGTGGGG + Intronic
1117672595 14:58123598-58123620 AAATACCAGAGGAAGCAGTGTGG + Intronic
1117897039 14:60497807-60497829 AAGAGGCAGAGGATGCAGTGAGG + Intronic
1118014584 14:61646110-61646132 CAAAAAAAAAGGAAGAAGTGTGG - Intronic
1118102788 14:62625379-62625401 CAGAAACAAAGGAAGTAGACTGG + Intergenic
1118876884 14:69793541-69793563 CAGAAGCTGAGGGAGCTGTGAGG + Intronic
1119724160 14:76911995-76912017 CATGCACAGAGGAAACAGTGTGG + Intergenic
1120185419 14:81388804-81388826 CACACACAGAGGAAGTAGCGAGG - Intronic
1120243897 14:81983338-81983360 CAGAGGCAGAGGTTGCAGTGAGG - Intergenic
1120724768 14:87925809-87925831 GAAAAACAGAGAAATCAGTGAGG + Intronic
1120782073 14:88494289-88494311 CTGGAACAGAGCAAGCAGGGAGG + Intronic
1121565552 14:94906873-94906895 CAGAAACAGAGGAGACCCTGAGG - Intergenic
1122185746 14:99993763-99993785 CAGAAGCAGAGGCTGCAGTGAGG - Intronic
1122743832 14:103886771-103886793 CAGACCCAGAGGAACCAGAGAGG - Intergenic
1123048609 14:105530201-105530223 CAGGAACAGGCAAAGCAGTGCGG - Exonic
1123206812 14:106721249-106721271 CAGAAACAGTGGAGGGTGTGGGG + Intergenic
1123211834 14:106768254-106768276 CAGAAACAGTGGAGGGTGTGGGG + Intergenic
1123476143 15:20593573-20593595 CAGAGACAGAGACAGCAGTTGGG - Intergenic
1123574324 15:21651728-21651750 CTGAAACAGAAGAAAGAGTGTGG + Intergenic
1123610939 15:22094315-22094337 CTGAAACAGAAGAAAGAGTGTGG + Intergenic
1123641869 15:22406791-22406813 CAGAGACAGAGACAGCAGTTGGG + Intergenic
1124044654 15:26137783-26137805 TAGAAAAAGATGAAGCAGTAAGG - Intergenic
1124890016 15:33724245-33724267 CAGAGACAGAGGAAGAAATGAGG - Intronic
1125186603 15:36938285-36938307 CAGAATAACAGGAAGCACTGTGG - Intronic
1125602349 15:40922670-40922692 CAGACACAGAGGAAGAAACGGGG - Intergenic
1125777046 15:42225603-42225625 CGGAGACAGAGGTTGCAGTGAGG - Intronic
1126876401 15:53046083-53046105 CAGGCCCAGAGGAAGCAATGGGG - Intergenic
1127291355 15:57574137-57574159 GGGAAGCAGAGGAAGCAATGGGG - Intergenic
1127560398 15:60130677-60130699 CAGAAACAGAATAAGCAGTAGGG + Intergenic
1127938866 15:63672447-63672469 CAGAAACACAGGCATCAGTATGG + Intronic
1128211093 15:65903036-65903058 CAGGAAGAGAAGAGGCAGTGTGG - Intronic
1128288717 15:66460558-66460580 AAGAAATAGTTGAAGCAGTGAGG + Intronic
1129801520 15:78418445-78418467 CAGAAACAGAGGCTGATGTGGGG + Intergenic
1130678765 15:85978048-85978070 CAGAGGCAGAGGAAGAGGTGAGG + Intergenic
1131649395 15:94382388-94382410 CAGACATAAAGGAAGGAGTGAGG - Intronic
1202983188 15_KI270727v1_random:386071-386093 CTGAAACAGAAGAAAGAGTGTGG + Intergenic
1135709395 16:24702248-24702270 CAGAGGCAGAGGCTGCAGTGAGG - Intergenic
1135762238 16:25146742-25146764 CAGACCCAGAGGCAGCAGAGGGG - Intronic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1136102109 16:28003955-28003977 CAGAAAAAGAAGAGTCAGTGTGG + Intronic
1136753752 16:32665764-32665786 CAGAAACAGAATAAGCTGTTGGG + Intergenic
1136814360 16:33204601-33204623 CAGAAACAGAATAAGCTGTTGGG - Intronic
1136820836 16:33314681-33314703 CAGAAACAGAATAAGCTGTTGGG - Intergenic
1136827399 16:33371220-33371242 CAGAAACAGAATAAGCTGTTGGG - Intergenic
1136832465 16:33469991-33470013 CAGAAACAGAATAAGCTGTTGGG - Intergenic
1137590003 16:49687639-49687661 CAGAAAATGAGGAACCAGGGGGG + Intronic
1137633631 16:49966483-49966505 CAGAGGCAGAGGTTGCAGTGAGG + Intergenic
1138215953 16:55205618-55205640 CTGCTACAGAGGAGGCAGTGTGG - Intergenic
1138474840 16:57264542-57264564 TATTAAAAGAGGAAGCAGTGGGG + Intronic
1138650563 16:58458658-58458680 CAGGAACCGAGGAGACAGTGGGG + Intergenic
1138755430 16:59478660-59478682 CAGAAGCAGAGGATTCAGTGAGG - Intergenic
1139095692 16:63702485-63702507 AAGAAAAAGAGGAATCAGTCAGG + Intergenic
1139187294 16:64821979-64822001 CAGGAACAGAGGGAACAATGGGG - Intergenic
1139308184 16:66005917-66005939 CAGAGGCAGAGGAAGGGGTGAGG + Intergenic
1139355323 16:66364164-66364186 AAGCAACAGTGGAGGCAGTGGGG - Intergenic
1139986255 16:70900768-70900790 CAGGAACAGAGCAATCAATGTGG - Intronic
1140194445 16:72845143-72845165 GGGAAACAGAGGCAGCACTGCGG + Intronic
1140723317 16:77789665-77789687 GAGAAACAGAGGATGGAGAGGGG - Intronic
1141161400 16:81631246-81631268 CAGGAGCTGAGGAAGCAGAGAGG + Intronic
1141993508 16:87623069-87623091 CAGATTCTGAGGCAGCAGTGGGG + Intronic
1142041237 16:87895708-87895730 CAGAGACAGAAGCAGCAGGGCGG - Intronic
1202992936 16_KI270728v1_random:27575-27597 CAGAAACAGAATAAGCTGTTGGG - Intergenic
1142525548 17:537783-537805 CAAAAGTAGAGGAAACAGTGTGG - Intronic
1143560903 17:7694314-7694336 GGGAAACAGAGGTTGCAGTGAGG - Intronic
1143658913 17:8312939-8312961 CAGACACAGGGGCAGCAGGGAGG - Exonic
1143828196 17:9630038-9630060 GAGAAAAAGGGGAGGCAGTGAGG - Intronic
1144460943 17:15458192-15458214 CAGAGCCAGAGGAAACAGGGTGG - Intronic
1144641410 17:16939406-16939428 GAGAAACAGAGGAGACAGAGAGG - Exonic
1144641413 17:16939431-16939453 GAGAGACAGAGGAGGCAGAGAGG - Exonic
1144694974 17:17297316-17297338 CAGTAACAGAGGAAACTTTGGGG - Intergenic
1145276156 17:21432249-21432271 CAGCAACAGATGAAGGAGTGGGG - Intergenic
1145314000 17:21718163-21718185 CAGCAACAGATGAAGGAGTGCGG - Intergenic
1145356383 17:22158524-22158546 CATATGCAGAGGAAGCAGTGAGG - Intergenic
1145712448 17:26990140-26990162 CAGCAACAGATGAAGGAGTGAGG - Intergenic
1146380312 17:32322921-32322943 CAGAAACAGGGGCAGGAGTGTGG + Exonic
1146553158 17:33799332-33799354 GAGAAAGAGAGGAAACAGAGAGG - Intronic
1146630356 17:34465136-34465158 CAGAAACACAGGCAGCAGGCAGG + Intergenic
1146955028 17:36932486-36932508 GAGAGACAGAGGCAGAAGTGAGG - Intergenic
1147411841 17:40258711-40258733 CAGAAAGAGAGGAGGGAGGGAGG + Intronic
1147442304 17:40454612-40454634 TAGAAGCAGAGGAAGGAGTGGGG + Intronic
1147538477 17:41335855-41335877 CAGAGACAGAGGAGGCTGAGAGG + Intergenic
1148541448 17:48483772-48483794 CAGAAAAAGAGGAAGCTGCATGG + Intergenic
1150678196 17:67263022-67263044 AAGAAATAGAGGACCCAGTGAGG - Intergenic
1151057924 17:71055532-71055554 CGGAGACAGAGGTTGCAGTGAGG - Intergenic
1151205296 17:72502129-72502151 AAAAAAAAGAGCAAGCAGTGGGG - Intergenic
1151216726 17:72582202-72582224 CAGAAAGAGAGGCAGCCCTGCGG - Intergenic
1151353777 17:73546538-73546560 CAGCCAGAGAGGAGGCAGTGTGG - Intronic
1151374625 17:73678272-73678294 CAGTATCAGAGGAAGAAGGGAGG + Intergenic
1151450653 17:74196522-74196544 CAGACACACAGGCAGCAGCGGGG + Intergenic
1152743283 17:82027929-82027951 CAGCAACAGTGAAAGCAGCGAGG + Intronic
1153350644 18:4077584-4077606 CAGCAAGAGAGGAAGCAGGGTGG - Intronic
1153549117 18:6242286-6242308 AAATGACAGAGGAAGCAGTGTGG - Intronic
1153804413 18:8699878-8699900 GAGAACCAGAGGAAGTAGAGAGG - Intergenic
1154095921 18:11414635-11414657 CAGACACAGAGGAGGCAGCATGG - Intergenic
1154488819 18:14903145-14903167 CAGAGACAGAGATTGCAGTGAGG - Intergenic
1154947654 18:21178122-21178144 GACAAAGAGAGGAGGCAGTGTGG + Intergenic
1156387446 18:36618905-36618927 CAGAAACAGAGGATCCAGGGAGG - Intronic
1156944572 18:42814035-42814057 CAGGGGTAGAGGAAGCAGTGGGG + Intronic
1157202527 18:45671482-45671504 CAAGAGCAGAGGAAGCCGTGGGG - Intronic
1157218516 18:45806684-45806706 CAGGGGCAGAGGAAGCAATGAGG + Intergenic
1157320755 18:46632046-46632068 AAGAAACAGAAGAGGCAGTGGGG + Intronic
1157618605 18:49002435-49002457 CAGAAACAGAGGCAGCAGGGAGG - Intergenic
1157889937 18:51406068-51406090 CAGGATCAGATAAAGCAGTGTGG + Intergenic
1158288545 18:55912851-55912873 CAGAAGGAGAGGAAGAATTGTGG - Intergenic
1159228849 18:65578187-65578209 CAGGAACAGATATAGCAGTGGGG - Intergenic
1159639579 18:70848013-70848035 CACCAACAAAGGAAACAGTGAGG - Intergenic
1160004290 18:75058026-75058048 CACACACAGAGGAAGGAGTCAGG + Intronic
1160161943 18:76479987-76480009 CAGAAACAGAGGAACCTGCCTGG + Intronic
1160448565 18:78946782-78946804 CAGAAAAAGAGGGAGAAGAGGGG + Intergenic
1161308607 19:3581106-3581128 AAGAAGAAGAAGAAGCAGTGTGG - Intergenic
1161459920 19:4390502-4390524 CAGAAAGAGAGGAAGAAGAGGGG + Intronic
1163427780 19:17248455-17248477 CAGAAACAGAACAAGAAGTATGG - Intronic
1163478879 19:17542838-17542860 CAGGAAAAGAGGAGGCAGGGAGG + Intronic
1163691976 19:18743168-18743190 GGGAACCAGAGGAAGCAGAGTGG + Intronic
1163807668 19:19409742-19409764 CAGAAACAAAGGTACCACTGGGG + Intronic
1163850436 19:19659992-19660014 CAGAGACAAAGAAAGCATTGTGG + Intronic
1164169316 19:22710688-22710710 AAGTAACAGAGGAATCAGAGAGG - Intergenic
1164359763 19:27492022-27492044 CAGATAAATATGAAGCAGTGTGG + Intergenic
1164945342 19:32288558-32288580 GAAAAACAGAGGAAGCAGGGTGG - Intergenic
1165221455 19:34320073-34320095 CTGAAGTAGAGGAAGCTGTGCGG + Exonic
1165537608 19:36462565-36462587 CAGCAATAGTGGAAGCAGTGGGG - Intronic
1165983365 19:39745833-39745855 GAGAAAAAGAGGAAGCAGTAAGG - Intergenic
1166341173 19:42138144-42138166 AAGAACCAGAGGATGGAGTGTGG + Intronic
1166563261 19:43747558-43747580 AGGAGACAGAGGATGCAGTGAGG + Intronic
1167599807 19:50448027-50448049 AAGAAACAGAGGAGGGAGCGAGG - Intronic
1168330221 19:55563808-55563830 GAGAGACAGAGGGAGCAGTGAGG - Intergenic
925231068 2:2234526-2234548 CAGACAAAGACAAAGCAGTGTGG + Intronic
925243799 2:2360626-2360648 CAGACAGTGAGGAAGCAGGGGGG - Intergenic
925901980 2:8515436-8515458 CAGAAAGAGAGACAGCAGAGAGG + Intergenic
926184634 2:10679592-10679614 GAGAAAGAGAGGAAGGAGAGAGG - Intronic
926719611 2:15949922-15949944 CGGTAACAGAGGAAGGAGCGAGG + Intergenic
926809739 2:16745748-16745770 CAGTAGGAGAGGAAGCAGTGAGG - Intergenic
927145382 2:20162185-20162207 CAGACAAAGATGAAGCAGCGGGG - Intergenic
927571455 2:24164433-24164455 CAGGAAGAGAGGAGGCAGTGGGG + Intronic
927826650 2:26313999-26314021 CAGAAACAGAGGAAGCAGTGGGG + Intronic
928356555 2:30621717-30621739 CAGGGGTAGAGGAAGCAGTGGGG + Intronic
928379494 2:30805356-30805378 GAGAAAAAGGGGAAGCAGTGAGG - Intronic
928405451 2:31011051-31011073 CAGAAGCACAGGAAGGAGGGAGG + Intronic
928929731 2:36611677-36611699 CAGGAAGAGAGGATGCAGAGTGG + Intronic
929306936 2:40374021-40374043 GTGAAACACAGGACGCAGTGAGG + Intronic
929881947 2:45844509-45844531 AAGAATTAGAGCAAGCAGTGAGG + Intronic
930227160 2:48805570-48805592 CAGAGACAGAGGGAGAAGAGAGG + Intergenic
930435600 2:51337520-51337542 CAGGACTAGAGGAAGCAATGAGG + Intergenic
930720621 2:54634210-54634232 AAGAAACCGAGGAAGCAGCAAGG - Intronic
931693245 2:64852962-64852984 AAGAAAAAGAGGAAGGAGAGGGG + Intergenic
931771478 2:65501674-65501696 CCGGAGAAGAGGAAGCAGTGTGG - Intergenic
932574546 2:72955534-72955556 CAGAAACAGAGGCAGGGATGTGG + Intronic
932842446 2:75096038-75096060 GAGAAATAGTGGAGGCAGTGAGG + Intronic
933014550 2:77108267-77108289 AAGAGAAAGAGGAGGCAGTGGGG + Intronic
933263297 2:80153575-80153597 CAGGAAAAGAAGGAGCAGTGAGG - Intronic
933331530 2:80898285-80898307 GGGAAACAGAGGAAGCAGCTGGG + Intergenic
935154838 2:100475000-100475022 CAGAGGCAGTGGAAGTAGTGTGG + Intronic
935700809 2:105810118-105810140 TAGAAACAGGGAAAGGAGTGTGG + Intronic
936909738 2:117577770-117577792 GAGAAACAAATGAAGCAGGGAGG + Intergenic
937301543 2:120845730-120845752 CAGAAACAGAGGTATCCATGCGG - Intronic
937534199 2:122866108-122866130 CAGGAAGAAAGGGAGCAGTGGGG - Intergenic
938244424 2:129765930-129765952 CAGAAGGAAAGGAGGCAGTGGGG - Intergenic
939193973 2:138949659-138949681 CAGAAAGAGAGGAAGAGGTGTGG - Intergenic
939458917 2:142473687-142473709 CAGAAACTGAAGGAGCTGTGAGG + Intergenic
939545633 2:143549382-143549404 CAGGAAGAGAGGAAGCAGATGGG + Intronic
939963998 2:148592835-148592857 CTGAGAGAGGGGAAGCAGTGGGG - Intergenic
940279883 2:151978286-151978308 AAGATACATAGGAGGCAGTGTGG + Intronic
941050948 2:160733292-160733314 CAGAAACAGTGAGACCAGTGAGG + Intergenic
941228310 2:162876740-162876762 CAGAAACAGGGTAAGAAATGAGG + Intergenic
941790005 2:169541875-169541897 CAGGAACAGTGGATTCAGTGTGG - Intronic
941913373 2:170789032-170789054 CAGAGGCAGAGGCTGCAGTGAGG - Intronic
942455572 2:176136215-176136237 AAGAAACAGAGGAGGCGGGGAGG + Intergenic
943172395 2:184419296-184419318 GAGAAACATCAGAAGCAGTGGGG + Intergenic
943564995 2:189506644-189506666 CTGAGACAGAGCAAGTAGTGGGG - Intergenic
943646985 2:190417120-190417142 TAGAAGTAGAGGAAGGAGTGAGG + Intronic
943708636 2:191063508-191063530 CAGAAACGGAGGTGGCAGTGTGG + Intronic
943772497 2:191733481-191733503 CAGAACCAGTGGAAGGAGGGTGG + Intergenic
943862566 2:192887569-192887591 CAGAAACAGATGAAGAGGTCAGG - Intergenic
944211739 2:197212862-197212884 GAGATGCAGAGGAAGCTGTGGGG - Intronic
945891190 2:215433158-215433180 AAGAAACACAGGAACCAGTTGGG + Intronic
946237354 2:218332365-218332387 CAGAAAGAGAAGAAGCAGGATGG + Intronic
946372892 2:219291155-219291177 CAGAAGCAGAGGCAGCAGGAGGG + Intronic
946639062 2:221763697-221763719 CTTGAACAGAGGAGGCAGTGGGG + Intergenic
946966964 2:225046211-225046233 AAGGAAGGGAGGAAGCAGTGAGG - Intergenic
947232258 2:227900534-227900556 TGGACACAGAGGGAGCAGTGTGG + Intronic
947738463 2:232473170-232473192 CGCAAACAGAGGTAGCAGTCTGG - Intergenic
948107472 2:235427238-235427260 CAGAGACAGGGGAGGCAGTGCGG - Intergenic
948586905 2:239025564-239025586 CAGACACAGAGGAAGCCAGGCGG - Intergenic
948716318 2:239865670-239865692 GAGAGACAGAGGAAGGAGGGAGG - Intergenic
948819470 2:240532510-240532532 CAGAAACACAAGAAGGAGTAAGG + Intronic
1168969930 20:1924069-1924091 CAGTAACAGAAGAAGCAGCCAGG + Intronic
1170190315 20:13638828-13638850 CACACACAGAGGCAGCAGCGCGG + Intronic
1170286760 20:14718368-14718390 CAGTATTAGAGGAAACAGTGTGG + Intronic
1170468902 20:16648762-16648784 AAGAAACAGAGGGAAAAGTGGGG - Intergenic
1171297007 20:24026151-24026173 CAGGGACAGAGGAAGCACGGTGG - Intergenic
1171997083 20:31739754-31739776 CAGAAACTGAGGAAGGAGGAAGG + Intronic
1172110692 20:32543169-32543191 CAGGAACAGGGCAAGGAGTGGGG + Intronic
1173060537 20:39655925-39655947 AAAAAACTGAAGAAGCAGTGAGG + Intergenic
1173234091 20:41228000-41228022 CAGAAGGAGAGGAAGGAATGGGG - Intronic
1175343970 20:58256929-58256951 GAGCAAGAGAGGAAGTAGTGGGG - Intergenic
1176614269 21:9015494-9015516 CAGTTACTGAGGAAGCTGTGGGG - Intergenic
1177745242 21:25204761-25204783 CAGAAAGAAAGAAAGTAGTGAGG + Intergenic
1178121387 21:29473716-29473738 CACAGACAGAGGGAGCAGGGAGG - Intronic
1178849793 21:36203626-36203648 CAGAAAGGGAGGGTGCAGTGGGG + Intronic
1178966614 21:37125706-37125728 AAGAAACAGAAGCAGCAATGTGG - Intronic
1179348000 21:40579309-40579331 CAGAAGAAAAAGAAGCAGTGAGG + Intronic
1179502680 21:41819962-41819984 GAGAAACAGAGGAAGGCATGGGG + Intronic
1180469454 22:15642035-15642057 CGGCAACGGAGAAAGCAGTGTGG - Intergenic
1180559791 22:16606785-16606807 AGGAATGAGAGGAAGCAGTGTGG - Intergenic
1180591444 22:16941026-16941048 CAGAAAAAGATGAAAAAGTGAGG - Intergenic
1181409678 22:22710236-22710258 CAGATACACAGGCAGCAGGGTGG + Intergenic
1181430386 22:22877945-22877967 CAGAAACACAGACAGCAGTGGGG + Intronic
1182830244 22:33299202-33299224 GAGAGAGAGAGGAAGCAGTATGG + Intronic
1183027594 22:35077365-35077387 CAGGAAAAGAGGAGGCTGTGAGG - Intronic
1183221861 22:36519678-36519700 CAGGAACTGAGCAAGCACTGAGG - Intronic
1183343321 22:37294051-37294073 GAGAAGCTGAGGAAGCAGTAGGG + Intronic
1183434062 22:37783212-37783234 AGGAAACTGAGGCAGCAGTGTGG - Intergenic
1183574129 22:38676228-38676250 AAGAAGCAGAGGTTGCAGTGAGG + Intergenic
1183670174 22:39268245-39268267 GAGAGACAGAGGAAGGAGCGTGG - Intergenic
1183676278 22:39300540-39300562 CTGGAACAGAGGAGGCAGAGTGG + Intergenic
1184946364 22:47807145-47807167 GAGATGCAGAGGCAGCAGTGGGG - Intergenic
1185103867 22:48856333-48856355 CAGCTAAAGAGGAAGCTGTGGGG - Intergenic
1185340699 22:50289669-50289691 CAGAGACAGCCGGAGCAGTGGGG - Exonic
949170333 3:988829-988851 TAGAAGAAGAGGAAGAAGTGAGG - Intergenic
949901629 3:8819760-8819782 CATAGACAGAGGAAGGAATGAGG - Intronic
949997083 3:9626604-9626626 CAGAGGCTGAGGAAGGAGTGAGG - Intergenic
950124009 3:10500554-10500576 GAGACACACAGGAAGGAGTGAGG + Intronic
950491624 3:13308683-13308705 CAGGGCCAGAGGAGGCAGTGTGG + Intergenic
950700885 3:14745193-14745215 CAGAGAGAGAGAGAGCAGTGAGG + Intronic
951384022 3:22023225-22023247 GAGAATGAGAGGAAGCAGAGTGG + Intronic
952009729 3:28886688-28886710 AAGAAAAAAAGGAAGGAGTGAGG - Intergenic
952321765 3:32284333-32284355 AAGAACAGGAGGAAGCAGTGAGG + Intronic
952326226 3:32322849-32322871 CAGAGACAGAGAAAGCAGAGGGG + Intronic
952728978 3:36619400-36619422 CAGAATCAGAGAAGGCAGTTAGG - Intergenic
952982666 3:38750826-38750848 CAGGAACAGAGAAAGGAGGGTGG + Intronic
953066618 3:39478558-39478580 AAGAAACAGAGGTAGGAGTTAGG - Intronic
953475383 3:43201616-43201638 CAGAAACTGAGCAAGGATTGAGG + Intergenic
953531628 3:43745069-43745091 CAGAACCAGAGGTTGGAGTGAGG - Intergenic
953582437 3:44169115-44169137 CTGAGACTTAGGAAGCAGTGAGG + Intergenic
955347488 3:58171866-58171888 CAGAAACAGTGAGAGCTGTGTGG + Intronic
956572942 3:70717267-70717289 CAGAAACAGAGGAATGATTTAGG + Intergenic
956785308 3:72637392-72637414 CTGGAACAGAGGAAGCAGGTGGG - Intergenic
956837136 3:73104513-73104535 CAGAAACAGAGGAGGGAGACTGG - Intergenic
956904434 3:73751011-73751033 TACAAACACAGGAAGGAGTGAGG + Intergenic
956960387 3:74392399-74392421 AAGAAAAAGAAGAAGCAGGGTGG - Intronic
957906289 3:86560490-86560512 GAGCAACAGAGCAAGCAGAGAGG + Intergenic
958446827 3:94225860-94225882 CAGAAACATAGAAAAGAGTGTGG - Intergenic
958862308 3:99458619-99458641 GAGACACAGAGGAACCAGTAAGG - Intergenic
959836432 3:110923795-110923817 CAGCAGAAGAGGCAGCAGTGCGG + Intergenic
959893001 3:111577736-111577758 CAGAAACAGAGGATGGACTAAGG - Intronic
959991116 3:112633258-112633280 CAAAGACAGAGGAAGGATTGTGG - Intronic
960409741 3:117308344-117308366 CAGAAAGACAGGAAGATGTGTGG - Intergenic
960611693 3:119560395-119560417 CAGAAAGAGAGCAAACCGTGTGG + Intergenic
960909423 3:122634140-122634162 TGGAAACAGAGGAAGAAGAGAGG - Intronic
960927098 3:122804953-122804975 CAGACACTAAGCAAGCAGTGAGG - Intronic
961087308 3:124079173-124079195 CAGCTGCAGAGGAAGCAGAGGGG + Intergenic
961679873 3:128592358-128592380 CAGACACAGAGGAAGTATTTGGG - Intergenic
962251452 3:133838473-133838495 AAGACACAAAGGAAGGAGTGGGG - Intronic
962264809 3:133937313-133937335 TAAACACAGAGGAAGCAGGGCGG - Intronic
962309121 3:134313257-134313279 CAGAAATGGAAGCAGCAGTGTGG + Intergenic
962579122 3:136781787-136781809 CAGGAACAAAGGAAGAAATGGGG + Intergenic
962959627 3:140298733-140298755 CAGCAACTGTGGATGCAGTGGGG + Intronic
962988444 3:140557297-140557319 CAGAAAGAGAGGAACAAGGGTGG + Intronic
963219704 3:142795526-142795548 CAGAAACAGTGCAAGCAAGGAGG + Intronic
963981104 3:151537986-151538008 CTGAAACTGAGGAAGCAGGAGGG - Intergenic
964154416 3:153566850-153566872 AAGAAGGAGAGGAAGCAGTGAGG - Intergenic
964377280 3:156060634-156060656 CAGAAAGAGAGGAAGCAGGAAGG - Intronic
964893720 3:161568635-161568657 CTGTAACAGAGGCAGAAGTGTGG - Intergenic
965247387 3:166291543-166291565 TAGACACAGAGGAACGAGTGAGG - Intergenic
965410605 3:168326053-168326075 GAGAAACAGAGGAAGCAGAGTGG + Intergenic
965539097 3:169854391-169854413 CAGAAAAAGAGTCAGCAGGGTGG - Intronic
965740098 3:171865285-171865307 GAGAAACAGAGGAAGTAATTAGG + Intronic
966233913 3:177679808-177679830 CAGAAATAGAGGAGTCAGAGTGG + Intergenic
966630136 3:182063509-182063531 AAGGAACAGAGGAAGGAGGGAGG + Intergenic
967245786 3:187485052-187485074 CAGGAACAGAAGGAACAGTGTGG + Intergenic
967314675 3:188140397-188140419 AAGGAACAGAGAAAGCACTGGGG - Intergenic
968837229 4:2973925-2973947 AAGAGACAGAGGAAACCGTGTGG - Intronic
969172506 4:5375656-5375678 CAGAAACAAAGGCAGCAAAGAGG - Intronic
969277780 4:6148622-6148644 CAGGAGCAGAGGAAGAAGGGAGG + Intronic
969584234 4:8082832-8082854 CAGAGACACAGGAAGGAGCGCGG - Intronic
970169351 4:13274418-13274440 CAGAAGCAGAGGCAGCCCTGAGG + Intergenic
970391499 4:15616732-15616754 CAGGGGTAGAGGAAGCAGTGGGG - Intronic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
971364344 4:25965626-25965648 GAGAAGCAGAGGAAGTAGAGGGG - Intergenic
971391805 4:26192995-26193017 CAGAAGCAGAGGCTGGAGTGAGG + Intronic
972086597 4:35225030-35225052 CAGATGCAGAGGTTGCAGTGAGG - Intergenic
972650802 4:41015819-41015841 CAGAAACAGAGAATGTAGTGTGG + Intronic
973613429 4:52658285-52658307 CAGAAAAAGGGAAAGCAATGGGG + Intronic
973635420 4:52857728-52857750 CAGAGAGAGAGAAAGCAGGGGGG - Intergenic
974543056 4:63264542-63264564 TAATAACAGAGGAAACAGTGTGG - Intergenic
974664346 4:64938317-64938339 CAGAGACAGAGTAAGGAGGGAGG - Intergenic
975050577 4:69859229-69859251 AAGAAAGAGAGGAAGGAGAGCGG - Intronic
977447529 4:97149624-97149646 CAGAAACAGAAACAGTAGTGAGG - Intergenic
977914188 4:102572528-102572550 CAGCCACTGTGGAAGCAGTGTGG - Intronic
978090177 4:104706409-104706431 CAGAAACAGAGAAGGCAGAGTGG + Intergenic
978171682 4:105679073-105679095 CAGAAATAGATCAAGAAGTGGGG - Exonic
978624053 4:110664481-110664503 CAGAGAAAGGGGAAGCAGTGAGG - Intergenic
979101079 4:116615393-116615415 AAGAAACAAAGGAAGGAATGAGG + Intergenic
980189510 4:129505997-129506019 CAGAAACAGAAGAAACTGAGTGG + Intergenic
980880823 4:138708549-138708571 TAAGCACAGAGGAAGCAGTGGGG + Intergenic
981239474 4:142459074-142459096 CAGTAACCTAGAAAGCAGTGTGG + Intronic
983553443 4:169038893-169038915 TAGAAAGATAGGAAGAAGTGAGG - Intergenic
984277780 4:177630942-177630964 AAGAAACAGAGAAAACAGTTGGG - Intergenic
984372305 4:178883266-178883288 AAGAAACAGAGTGAACAGTGAGG - Intergenic
984778219 4:183503000-183503022 CAGAAACAGAGCAAGATGAGAGG - Intergenic
984855694 4:184194306-184194328 CAGAAACACAGGAAGATGAGGGG - Intronic
984889955 4:184482919-184482941 CCGAAGCAGAGGAAAGAGTGGGG + Intergenic
985135788 4:186784626-186784648 CAGGAACTGGGGAAGCAGCGTGG - Intergenic
985481820 5:116955-116977 CAGACGCAGCGAAAGCAGTGGGG - Intergenic
985486345 5:153613-153635 AAGAAACAGAGGACGGGGTGGGG - Intronic
986516646 5:8571464-8571486 CAGAAATAGGGGAAACAATGGGG - Intergenic
986844549 5:11737461-11737483 GAGAAAAAGAGACAGCAGTGCGG + Intronic
987170397 5:15250939-15250961 CAGAGACAAAGGAAGAAGAGAGG + Intergenic
987819693 5:22947145-22947167 CTGAAGCAGAGGGAGCAGTTTGG - Intergenic
987899993 5:23998904-23998926 CAGAAACACAGGTTGGAGTGAGG - Intronic
987948458 5:24646006-24646028 CAGGTACAGAGGAGGCAGTATGG - Intergenic
987960352 5:24799345-24799367 AAGAAAGAGAGGGAGAAGTGGGG - Intergenic
988670119 5:33372264-33372286 CAGGAACAGAGAAAGCAGGAGGG + Intergenic
991953437 5:71969500-71969522 CACAAGTAGAGGAAGCAGTAAGG - Intergenic
992500293 5:77335565-77335587 GAGAGAGAGAGGAAGGAGTGAGG + Intronic
992673074 5:79078928-79078950 CAGAGTCAGAGCAAGCAGTTTGG - Intronic
992940598 5:81757457-81757479 CAAGAACAAAGGAAGCAGTACGG - Intergenic
993027101 5:82660003-82660025 CAAAAGCTGAGGAAGCAGAGTGG - Intergenic
993083811 5:83338016-83338038 CTAAAACTGAGGAAGCTGTGTGG + Intronic
993185911 5:84619408-84619430 CAGAAAGAAAGGAAGCAGGATGG + Intergenic
995023214 5:107389880-107389902 CAGAAAATGAGGAAGTAGTGGGG - Intronic
995096809 5:108246037-108246059 CAGAAACTGAAGAAACTGTGTGG - Intronic
995247023 5:109946120-109946142 CAGACACAAATGAAGCAGTGGGG + Intergenic
995283487 5:110360740-110360762 CAGAAATGGAAGAAGAAGTGGGG - Intronic
995966230 5:117910905-117910927 CATAGACAGAGGAAGAAATGTGG - Intergenic
996625200 5:125562559-125562581 CAGGAACACAGGAGGCAGTAGGG + Intergenic
996748667 5:126867960-126867982 CAGAATCACAGCAAGGAGTGTGG + Exonic
996974534 5:129414631-129414653 CAGAAACAGATACAGCAGTCTGG + Intergenic
997426306 5:133805041-133805063 AAGAAACCAAGGAGGCAGTGGGG - Intergenic
997488851 5:134255722-134255744 CAGGATCAGAGGATGCAGTATGG - Intergenic
997582121 5:135024645-135024667 CAGGGACAGAGGAAGCCCTGGGG - Intergenic
997775929 5:136604993-136605015 CAGAAAAAGAGGAAGGAAGGTGG - Intergenic
997981881 5:138472703-138472725 CTGAAACAGTGAAAACAGTGTGG - Intergenic
998603929 5:143614645-143614667 AAGCAAGAGAGGAAGCAGTGGGG - Intergenic
998826082 5:146102981-146103003 CAGAAACAAAGGAAGGAGAAAGG + Intronic
998826926 5:146111453-146111475 CAGAAAGAGAGAAAACAGTAAGG + Intergenic
999660971 5:153862527-153862549 CAGAAGAGGAGGAGGCAGTGAGG - Intergenic
999702276 5:154239096-154239118 CAGAAACAAAGTGGGCAGTGAGG - Intronic
1000183983 5:158841037-158841059 CAGAAACCAAGGTGGCAGTGAGG - Intronic
1001748772 5:174111955-174111977 GAGAAAGAGAGGAGACAGTGAGG - Intronic
1002261414 5:177996180-177996202 CAGAAACAGAGCAACAGGTGAGG - Exonic
1002963647 6:1941381-1941403 CAGATGAGGAGGAAGCAGTGAGG + Intronic
1003347863 6:5287423-5287445 GATAAAAAGAGGAAACAGTGCGG - Intronic
1003722941 6:8725344-8725366 CAGAAACAAAGAAAGCAGATTGG + Intergenic
1003941892 6:11036983-11037005 GAGAGACAGAGGAGGCAGAGAGG + Intronic
1003941924 6:11037227-11037249 GAGAGACAGAGGAGGCAGAGAGG + Intronic
1004290073 6:14358742-14358764 CAGAAACAGAGAAAGGAAGGTGG - Intergenic
1005954505 6:30654475-30654497 CAGAGGCAGAGGTTGCAGTGAGG + Intronic
1006338740 6:33434165-33434187 CAGAAGCAGGGGAAAGAGTGAGG - Intronic
1006912963 6:37576000-37576022 CAGACAAAGAAGAAGGAGTGTGG - Intergenic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007564830 6:42841892-42841914 GAGAAAAATGGGAAGCAGTGTGG - Intronic
1007790990 6:44308168-44308190 CAGAAACTTAGGAATCAGTTGGG - Intronic
1008806333 6:55433408-55433430 CAAAAACAGAGAAGACAGTGGGG + Intergenic
1009443691 6:63713456-63713478 CAGAGACAGAAAAAGCAGGGAGG + Exonic
1009886798 6:69633066-69633088 TAGAAACAGATGAAGAATTGAGG - Intergenic
1011082330 6:83503222-83503244 CACCAGCAGAGGAAGGAGTGAGG + Intergenic
1011230679 6:85158222-85158244 CATAAGCAGAAGAAGCAGTTAGG - Intergenic
1011629345 6:89309364-89309386 GAGAAGCTGAGGAAGCTGTGGGG - Intronic
1011714920 6:90095376-90095398 CTGCAACAGAGAAAGAAGTGGGG + Intronic
1011802342 6:91031392-91031414 CAGAAACAGGGAAACCAGTTAGG - Intergenic
1011894960 6:92214491-92214513 CAGAATTGGAGGAAGAAGTGTGG - Intergenic
1012011532 6:93792796-93792818 TAGAAGAAGAAGAAGCAGTGTGG + Intergenic
1012054784 6:94392724-94392746 CAGAGAGAGGGGAAGGAGTGTGG - Intergenic
1012556744 6:100522590-100522612 CAGAGACAGGGGAAGCAGAGTGG + Intronic
1012802376 6:103847241-103847263 GAGAGACAGAGGAAGGAGGGAGG + Intergenic
1013078328 6:106790558-106790580 CCGGCACGGAGGAAGCAGTGTGG + Intergenic
1013169261 6:107621455-107621477 CAGAGACAAAGGAACCAGTGTGG + Intronic
1013199319 6:107877514-107877536 CAGAGGCAGAGGTTGCAGTGAGG - Intronic
1013929038 6:115507719-115507741 CAGAAACTGGGGTACCAGTGTGG - Intergenic
1014543170 6:122700546-122700568 CAGAGACATAGTAAGCAGAGTGG + Intronic
1014692548 6:124578867-124578889 CAGAAAGAGAGATAGCAGGGTGG + Intronic
1015140695 6:129928210-129928232 CAGAGGCAGAGGATACAGTGGGG - Intergenic
1015926321 6:138313277-138313299 CAGAAGCAGAGCCAGCAGAGTGG - Intronic
1015994152 6:138980600-138980622 TAGAATCAGAGGAGGTAGTGGGG - Intronic
1017333375 6:153225775-153225797 CAGAAGCGGAGGTTGCAGTGAGG - Intergenic
1017694342 6:156999590-156999612 AAGAAACACAGGCAGCAGGGTGG + Intronic
1017900592 6:158715731-158715753 CAGAAACAGGGGAAGCACTCGGG - Intronic
1018367922 6:163140259-163140281 CAGAAACAGAGTAGGCAGTGAGG + Intronic
1018990764 6:168671686-168671708 CAGAAGCAGAGGGACCAGGGCGG - Intronic
1019078994 6:169415067-169415089 CAGAAACAGAGGAGGAAGGGAGG + Intergenic
1019091002 6:169533569-169533591 CAGAAACAGAAAAGGCAGAGAGG + Intronic
1020079702 7:5280924-5280946 CAGCAGCAGAGGAAGGAGAGGGG + Intronic
1021038097 7:15826288-15826310 CAAAAACCGAGAAAGCAATGAGG - Intergenic
1021089605 7:16467733-16467755 CAGAAAAAGAAAAAGTAGTGAGG - Intronic
1021252096 7:18342278-18342300 CAGAAACCGAAGAATAAGTGAGG - Intronic
1021812272 7:24414580-24414602 GAGAAACAAGGGAAGCTGTGAGG + Intergenic
1022283992 7:28937850-28937872 GCGAAGCACAGGAAGCAGTGTGG + Intergenic
1023460810 7:40394671-40394693 AGGAAGCAGAGGAAGCACTGGGG - Intronic
1023562647 7:41491830-41491852 CAGAAAGAGAGGGAGAAGGGAGG - Intergenic
1024270166 7:47635884-47635906 CAGGAGGAGAGGAAGAAGTGAGG + Intergenic
1025199202 7:56951279-56951301 CAGCAGCAGAGGAAGGAGAGGGG - Intergenic
1025672744 7:63625654-63625676 CAGCAGCAGAGGAAGGAGAGGGG + Intergenic
1026236057 7:68528334-68528356 CAGAGTCAGAGAAGGCAGTGTGG + Intergenic
1027231277 7:76274137-76274159 CAGTGACAGAGGAGCCAGTGCGG + Intronic
1028433062 7:90770651-90770673 CAGAAACAAAGGAAGCAGTAAGG - Intronic
1028963608 7:96776971-96776993 CAGAAGCAGTGGCAGCAGAGAGG + Intergenic
1029525229 7:101089778-101089800 CAGAAGCAGAGGAGGCAGGTGGG + Exonic
1030329654 7:108257914-108257936 GAGACAAAGAGGAGGCAGTGTGG - Intronic
1030340871 7:108378748-108378770 CAGAGCCAGACAAAGCAGTGTGG + Intronic
1030516764 7:110548666-110548688 GAGAAAAAGAGAAAGCAGGGAGG - Intergenic
1030793325 7:113756554-113756576 TAGAAACAGAGGAAATTGTGGGG - Intergenic
1032786952 7:135208538-135208560 CAGTGACAGTGGCAGCAGTGGGG - Intronic
1032952248 7:136928130-136928152 AAGAAGCAGAGGAAGGAGGGAGG + Intronic
1033052492 7:138018878-138018900 GAGAAACAGAGGAGGCACTGCGG + Intronic
1033105151 7:138513964-138513986 CAGAATCAGAGGAGGAAGGGTGG + Intronic
1033786642 7:144739402-144739424 CAGACACACAGAAAGAAGTGCGG + Intronic
1033894923 7:146057539-146057561 AAGAAACAGGGGAAACAGGGAGG - Intergenic
1034089830 7:148353260-148353282 CAAAAGAGGAGGAAGCAGTGAGG + Intronic
1034284831 7:149877990-149878012 CAGAAACAGACAAAGCAGTGTGG + Intronic
1034292568 7:149944711-149944733 CAGTGACAGAGAAAGCAGTGGGG - Intergenic
1034555299 7:151846564-151846586 CAGAAACAGAGGTGGCGTTGTGG - Intronic
1034591478 7:152143589-152143611 CAAACACAGAGGAAACAGAGGGG + Intronic
1034813502 7:154152181-154152203 CAGTGACAGAGAAAGCAGTGGGG + Intronic
1035047083 7:155974609-155974631 AAGAAACAGAGGAGGCAGCCTGG + Intergenic
1035331278 7:158098814-158098836 GAGAAAGCAAGGAAGCAGTGGGG + Intronic
1035358953 7:158297060-158297082 CAGAAGCAGAGGAACTAGTAAGG - Intronic
1036837364 8:12084727-12084749 GAGAAGCAGAGGCTGCAGTGAGG + Intergenic
1036859157 8:12330971-12330993 GAGAAGCAGAGGCTGCAGTGAGG + Intergenic
1037344634 8:17885779-17885801 CAAAAACAGAGGAAGGACTCTGG + Intronic
1037777088 8:21842634-21842656 CTGAAAGAGAGGAAGCAGCCAGG + Intergenic
1038018858 8:23536426-23536448 CAGGAACAGAGGCAGCAGGGTGG - Intronic
1038124859 8:24661971-24661993 CATAAAAAGATGAAGCATTGTGG + Intergenic
1038206550 8:25472082-25472104 GTAAAACAGAGGAAGCAGAGGGG - Intronic
1038818425 8:30930389-30930411 CAAAAACAGAGATAGCAGTCTGG - Intergenic
1039278976 8:35961633-35961655 CAGAAAAAGAAGAAGCCATGAGG - Intergenic
1039449841 8:37663684-37663706 CATCGGCAGAGGAAGCAGTGTGG - Intergenic
1039576556 8:38628422-38628444 CAAAAACAGAGAAAGAAATGAGG + Intergenic
1039964288 8:42272253-42272275 CAGAGAAAGTGGAGGCAGTGAGG - Intronic
1040039608 8:42902895-42902917 GAAAAATAGAGGCAGCAGTGAGG - Intronic
1040365268 8:46708976-46708998 CAGAAAAGGAGCAAACAGTGGGG - Intergenic
1040444360 8:47478422-47478444 CAGAGACAGAAGAAGCAGGAAGG + Intronic
1040619760 8:49078436-49078458 CTGAAACACAGGAAGCTGTGGGG - Intergenic
1040689550 8:49919080-49919102 CAGAAACATAGACAGGAGTGAGG - Intronic
1040822868 8:51584372-51584394 CAGAAGCAGAGCAGGCAGTCTGG - Intronic
1041930901 8:63285206-63285228 CAAAAACAAAGGAAGGAGGGAGG - Intergenic
1041934967 8:63323934-63323956 CAGAAACAGAGTTGGAAGTGGGG - Intergenic
1041942073 8:63399628-63399650 TAGCAGTAGAGGAAGCAGTGTGG - Intergenic
1042949096 8:74182542-74182564 CAGAAACAGAAGACCCACTGGGG - Intergenic
1044459363 8:92427255-92427277 CAGAGGCAGAGGTTGCAGTGAGG + Intergenic
1044954757 8:97468404-97468426 GAGGAACAGAAGAAGCAGGGAGG - Intergenic
1045859053 8:106795284-106795306 AAGAATCAAAGGAAGCTGTGTGG + Intergenic
1045986311 8:108253375-108253397 CAGGAAAAGAGGCAGAAGTGAGG + Intronic
1046914996 8:119670588-119670610 CAGAAATAAAGGAAGCTCTGGGG + Intronic
1047611675 8:126526981-126527003 AAGAAGCAGAGGCAGCAGTGGGG - Intergenic
1047764814 8:127981761-127981783 TAGAAACAGAGGATGCAGTGGGG - Intergenic
1048115536 8:131517691-131517713 AAGAAGGAGAGGAAGCAGAGAGG - Intergenic
1049235838 8:141511865-141511887 CAGAAAGAAAGGAGGCCGTGTGG + Intergenic
1049415324 8:142492365-142492387 CAGGGACAGACGGAGCAGTGTGG + Intronic
1049802581 8:144524936-144524958 CAGCAGCAGCGGCAGCAGTGCGG + Exonic
1050607511 9:7316946-7316968 GAGAAACAAAGGAAGCAGAGAGG + Intergenic
1050909489 9:11050118-11050140 CAGAAAAAGTGGAAAAAGTGAGG - Intergenic
1051157488 9:14166734-14166756 CAGAAGCAGAGGAAACACAGAGG - Intronic
1051677133 9:19569827-19569849 CAGAAACAGAAAAATCAGTATGG - Intronic
1052135781 9:24908336-24908358 CAGCAAGAGAGGACGGAGTGTGG - Intergenic
1052793011 9:32894702-32894724 CAGACACTAAGGAAGCAGTTTGG + Intergenic
1052865362 9:33461769-33461791 CAGAATTACAGGAAGCAGAGAGG + Exonic
1052962522 9:34312555-34312577 CAGAAACAGAGAAAGAGGTGAGG + Intronic
1053511778 9:38693851-38693873 GAGACACAGAGGGTGCAGTGGGG - Intergenic
1053748130 9:41221682-41221704 ATGTTACAGAGGAAGCAGTGGGG - Intergenic
1053944443 9:43292025-43292047 AAGAAAGAAAGGAAGAAGTGAGG - Intergenic
1054818221 9:69496140-69496162 TGGAAACAGAGGCAGCAGTGTGG + Intronic
1054844794 9:69782521-69782543 CATAAACAAAGGCAGCAATGGGG + Intergenic
1055797347 9:79989114-79989136 GAGAAAAAGAGGAAGCTGTCAGG - Intergenic
1056156052 9:83838787-83838809 CTGAACCAGAGTGAGCAGTGGGG - Intronic
1056581139 9:87888672-87888694 CAGAGACAGAGACAGCAGTTGGG + Exonic
1056842261 9:90007822-90007844 CAGAAACCCAGAAACCAGTGTGG - Intergenic
1057437502 9:95055880-95055902 CAAAAACAGAAGAAACGGTGGGG - Intronic
1057572513 9:96215367-96215389 GAAAAGCAGAGGATGCAGTGTGG + Intergenic
1058116957 9:101095270-101095292 CAGAAGCATAGGAAGCAGTGGGG - Intronic
1058267255 9:102918159-102918181 CAGGAACAGATAAAGCAGTGAGG - Intergenic
1058419855 9:104823179-104823201 CAGGAACTGAGGAAGAAGGGAGG + Intronic
1059396350 9:114036401-114036423 CAGGAACTGAGGAAGGAGAGGGG - Intronic
1059473987 9:114529139-114529161 CAGAAGCAGAGGGAGCAGTGGGG + Intergenic
1059568583 9:115409396-115409418 CAGAAACAAAGAAACCAGTTAGG + Intergenic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1060045585 9:120337513-120337535 CAGGCACAGAGGAAGCAGCGTGG - Intergenic
1060370995 9:123070934-123070956 GACAAACAGAAAAAGCAGTGTGG - Intronic
1060455297 9:123787131-123787153 GAGAAACATAAGAAGCAGTGTGG - Intronic
1060508724 9:124216902-124216924 CGGAAACAGGGGAGGCAGAGAGG + Intergenic
1060542465 9:124440117-124440139 CAGACCCAGAGGAAGAAATGAGG - Intergenic
1060557978 9:124519227-124519249 CAGAACCAGAGCAAGGAATGGGG - Exonic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060759261 9:126234452-126234474 CAGAGAGAGAGGAGGCAGGGAGG + Intergenic
1061124168 9:128663301-128663323 CAGAAGAAGAGGAAGGAGTGGGG - Intergenic
1062103751 9:134741594-134741616 CAGAAGCAGAGGCAGGAGGGTGG + Intronic
1062568126 9:137172241-137172263 CTGAGGCAGAGGCAGCAGTGGGG + Exonic
1062646286 9:137550201-137550223 CAGAAACAGAAAAAACAGTCAGG + Exonic
1202784258 9_KI270718v1_random:32383-32405 ATGTTACAGAGGAAGCAGTGGGG - Intergenic
1203687640 Un_GL000214v1:10253-10275 GAGAGACAGAGGTTGCAGTGAGG + Intergenic
1203587579 Un_KI270747v1:20603-20625 AAGAAAGAAAGGAAGAAGTGAGG - Intergenic
1203648635 Un_KI270751v1:93800-93822 GAGAGACAGAGGTTGCAGTGAGG - Intergenic
1185518411 X:718257-718279 CAGAAACAGAGGAAGAATCAGGG + Intergenic
1185702432 X:2241381-2241403 GAGACACAGAGGAAGCAGGAGGG - Intronic
1185779956 X:2835596-2835618 CAGACACAGAGGAGGCCATGTGG + Intronic
1185825346 X:3243944-3243966 AAGAAAAACAGGAAGCAGAGGGG + Intergenic
1186287707 X:8063707-8063729 AAGAAAAAGAAGAGGCAGTGTGG - Intergenic
1186591494 X:10934621-10934643 CAGAAGCAGAGAAACCAGTCAGG - Intergenic
1186591574 X:10935447-10935469 CAGAAGCAGAGAAACCAGTCAGG - Intergenic
1186648655 X:11535203-11535225 CAGATACATGGGAAGCAGGGTGG - Intronic
1186870631 X:13767688-13767710 GAGAAATAGAGGAAGGAGGGAGG - Intronic
1186915908 X:14220275-14220297 CACAAACAGAGTAGGGAGTGAGG + Intergenic
1187282950 X:17875571-17875593 CAGAAAAAGAGGAAAAAGAGTGG - Intergenic
1188327523 X:28823738-28823760 CAGAAACAGAGCTTGGAGTGAGG - Intronic
1188338589 X:28971061-28971083 CAAAATCAGGGAAAGCAGTGTGG - Intronic
1188468705 X:30512443-30512465 CAGAAAGAGAAGAAAGAGTGGGG + Intergenic
1188668819 X:32857991-32858013 CCGAGAGAGAGAAAGCAGTGAGG + Intronic
1189063812 X:37784495-37784517 CAGAAGCACAGGAAATAGTGAGG + Intronic
1189665735 X:43352861-43352883 TAGAAAAGGAGGAAGCAGTGAGG - Intergenic
1189895527 X:45651644-45651666 AAGAACCAGAGGAAGCAGTCGGG - Intergenic
1190472523 X:50797070-50797092 AAGAAACAGAGAAAAGAGTGCGG + Intronic
1190963885 X:55279359-55279381 CAGAAAAAGAGAAAGGAATGAGG + Intronic
1191109094 X:56791102-56791124 GAGAAACAGAGTGAGCAATGAGG - Intergenic
1191138531 X:57092346-57092368 CAGAGGTAGAGGAAGCAGTGAGG + Intergenic
1192244211 X:69359657-69359679 CAGAAACAGAGGAGGCAAAAGGG - Intergenic
1192363453 X:70453245-70453267 CACAAGAAGAGGAAGCAGTTAGG - Intronic
1193142670 X:78044361-78044383 CAGAAAGAGATGAAGCAATGTGG - Intronic
1193431995 X:81419115-81419137 CAGCAAAAGAGGAAGCAGAGAGG - Intergenic
1196752877 X:119133203-119133225 CAAGAAAAGAGGAAGCTGTGGGG - Intronic
1197684991 X:129429401-129429423 AAGAGACAGAGAAAGCAGAGAGG + Intergenic
1197769669 X:130082139-130082161 CATCTACAGAGGAAGAAGTGGGG + Intronic
1197841566 X:130753284-130753306 GAGGAACAGAGACAGCAGTGAGG - Intronic
1198803841 X:140474483-140474505 CAGAAGCAGAGGAAGAAGCAAGG - Intergenic
1199084794 X:143616176-143616198 CAGAAAACTAGGAAGCTGTGGGG - Intergenic
1200112704 X:153750163-153750185 CAGACACTGAGGATCCAGTGGGG - Intergenic
1201186692 Y:11411756-11411778 CAAAAAAGGATGAAGCAGTGAGG + Intergenic
1201245024 Y:11995063-11995085 CAGAGCCTGAGGAAGCAGAGAGG + Intergenic
1201253844 Y:12088059-12088081 AAGAAAAATAGGAAGCAGAGGGG - Intergenic
1201290093 Y:12414393-12414415 CAGACACAGAGGAGGCCATGTGG - Intergenic
1201554221 Y:15251644-15251666 CAGAAACACTGGAGGCAGAGAGG + Intergenic
1201601678 Y:15736403-15736425 CAGAAACAGAAGAGACAGTTGGG + Intergenic
1201717234 Y:17058911-17058933 GAAAAACAGAAGAAGCAGCGTGG - Intergenic
1202169301 Y:22024094-22024116 GAGAACCAGAGGAAGGAGGGAGG - Intergenic
1202222060 Y:22562271-22562293 GAGAACCAGAGGAAGGAGGGAGG + Intergenic
1202321055 Y:23633396-23633418 GAGAACCAGAGGAAGGAGGGAGG - Intergenic
1202549712 Y:26036660-26036682 GAGAACCAGAGGAAGGAGGGAGG + Intergenic