ID: 927834274

View in Genome Browser
Species Human (GRCh38)
Location 2:26379545-26379567
Sequence CACATTAGGAGGCATGTAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927834274 Original CRISPR CACATTAGGAGGCATGTAGC GGG Intronic
900309470 1:2026537-2026559 AAAATCAGGAGGCATGTGGCCGG + Intronic
900623299 1:3597003-3597025 CACTTTAGGGGGCATGGAGCGGG - Intronic
906360388 1:45152178-45152200 CTCATTAGAAGGCATTCAGCAGG + Intronic
909195073 1:72609570-72609592 CACTTTAGTAGACATGTAACTGG + Intergenic
912343908 1:108946062-108946084 CACTTTGGGAGGCATGAGGCAGG + Intronic
912565868 1:110586891-110586913 CACATAAGGAAGCATGGACCAGG + Intergenic
914312152 1:146476271-146476293 CACTTTATCAGGCAGGTAGCTGG - Intergenic
914502198 1:148257065-148257087 CACTTTATCAGGCAGGTAGCTGG + Intergenic
915119077 1:153617324-153617346 GACATGAGGAGGGATGTAGTGGG - Intergenic
915935969 1:160090569-160090591 CACCTTAAGAGGCATCTGGCAGG - Intergenic
1063482757 10:6390882-6390904 CAGTTTAGGAGTCATGCAGCTGG + Intergenic
1065140841 10:22716533-22716555 CACTTTGGGAGGCATGAGGCAGG + Intergenic
1067163875 10:43849332-43849354 CCCCTTAGGAGGCATCTAGGTGG + Intergenic
1067533481 10:47091573-47091595 CACATAAGCAGGCAGGCAGCAGG - Intergenic
1067900911 10:50240626-50240648 GACATATGGAGGCATGTAGTTGG - Intronic
1069096580 10:64266778-64266800 CACATTAGGAAGCAGGGAGAAGG - Intergenic
1069182653 10:65382305-65382327 CATCTTGGGAGGGATGTAGCAGG - Intergenic
1070443394 10:76468854-76468876 AACATTAAGAGGCATGGAGAGGG + Intronic
1075734199 10:124654069-124654091 CAAATAAGGAGGCATGTGGCTGG - Intronic
1075823858 10:125336828-125336850 CACATTCGGAGACCTGTAGATGG + Intergenic
1076548576 10:131262331-131262353 GACATTTGGAGGCATATAGGAGG + Intronic
1076699297 10:132262238-132262260 CACATGAGGAAGAATGAAGCTGG + Intronic
1083060363 11:59863789-59863811 ACCATTAGAAGGGATGTAGCAGG + Intronic
1088136282 11:106559628-106559650 CACAGTAGGAGGTGAGTAGCAGG + Intergenic
1090872467 11:130760613-130760635 CCCAGGAGGAGGCATGGAGCTGG + Intergenic
1091081677 11:132675074-132675096 CACATTAGGAAGCAACTAGAAGG + Intronic
1091537116 12:1421681-1421703 CTCATCAAGAGTCATGTAGCTGG - Intronic
1093755457 12:22846934-22846956 CATATTATTTGGCATGTAGCAGG + Intergenic
1095946036 12:47753841-47753863 CACATTAGGAGGGGTGGTGCTGG + Intronic
1096273462 12:50185387-50185409 CACATTAGGAGGAAAGTGGAAGG + Intronic
1096817654 12:54211412-54211434 AACAGTAGGAGGCATGGAGGTGG + Intergenic
1096901866 12:54891535-54891557 CAGATTAGGAGGCATATAAGGGG - Intergenic
1097722812 12:63041773-63041795 CACAATAGGAGACCTGAAGCAGG + Intergenic
1102391081 12:112549252-112549274 CACAGCAGGAGGCAAGCAGCAGG - Intergenic
1103338254 12:120206407-120206429 CACATCAGGAGGCAAGCAGCAGG - Intergenic
1103868196 12:124070697-124070719 CAGTTTAGGAGTCATGCAGCTGG - Intronic
1104009635 12:124920690-124920712 CACTTTGGGAGGCATGAGGCAGG - Intergenic
1105538321 13:21291080-21291102 TGCTTTAGGAGTCATGTAGCTGG - Intergenic
1106895116 13:34291616-34291638 CACAGAAGGAGCCATGCAGCAGG + Intergenic
1107890259 13:44908035-44908057 CACATTGGGAGGCCTGAGGCAGG - Intergenic
1108369984 13:49759778-49759800 CACAGTAGGAGGTAGGCAGCAGG - Intronic
1112697183 13:101963396-101963418 ACCATTTGGAGGCATGTAGAAGG - Intronic
1115245102 14:31286934-31286956 CACATGGGGAGGAATGCAGCAGG - Intergenic
1116461820 14:45185642-45185664 CATAGTACTAGGCATGTAGCGGG - Intronic
1116982483 14:51186224-51186246 CACAGTAGGAGGCAAGTGGTGGG + Intergenic
1117472789 14:56063242-56063264 CACAGGAGGAGGCCTGGAGCAGG - Intergenic
1125153157 15:36556539-36556561 CACTTTAGGAGGCAGGTGGATGG + Intergenic
1128406574 15:67346592-67346614 CACAACAGGAGGCAAGTGGCAGG - Intronic
1128464936 15:67902535-67902557 CAGTTTAGGAGTCATGCAGCAGG + Intergenic
1135139044 16:19906315-19906337 CACATTGGAAAGCATGAAGCAGG - Intergenic
1135940874 16:26820498-26820520 CACATTGGGAGGCAGGCAGGAGG + Intergenic
1143795684 17:9334292-9334314 TGCTTTAGGAGTCATGTAGCTGG - Intronic
1147542171 17:41369628-41369650 CACATTGGCAGGGATGTTGCAGG + Exonic
1148399223 17:47339551-47339573 CACAGTAGGAGGTAAGTGGCTGG - Intronic
1151055003 17:71020865-71020887 TACATTAGTACTCATGTAGCAGG + Intergenic
1153537708 18:6120220-6120242 CACCTTAGGAGGCACGTGGTCGG - Intronic
1155158303 18:23176412-23176434 CACAGTAGCAGGCAAGTGGCGGG - Intronic
1159337223 18:67084204-67084226 AACACTATGAGGCATCTAGCTGG - Intergenic
1162400281 19:10441934-10441956 CACTTTGGGAGGCCTGAAGCGGG - Intronic
1166686058 19:44796985-44797007 AACATTAGGAGGCACTCAGCCGG + Intronic
927834274 2:26379545-26379567 CACATTAGGAGGCATGTAGCGGG + Intronic
929404508 2:41626102-41626124 CACTTTGGGAGGCTTGAAGCGGG + Intergenic
930621243 2:53646115-53646137 TAGTTTAGGAGGCATGTAGCTGG + Intronic
939450839 2:142372481-142372503 TACATTAGTAGACATGTATCTGG - Intergenic
941414039 2:165196331-165196353 CACATTTTGAGGCAGGTCGCTGG - Intronic
942676379 2:178430704-178430726 TACAGAAGGAAGCATGTAGCAGG - Intergenic
945996583 2:216442168-216442190 CACTTTGGGAGGCCTGAAGCAGG + Intronic
946221912 2:218235003-218235025 CAAATTCTGAGGCATTTAGCAGG + Intronic
946759297 2:222977346-222977368 CACAGTTGGAGGAATGTAGCAGG - Intergenic
948225583 2:236307006-236307028 AACATTAGGAGGGATGGGGCGGG + Intergenic
1174920363 20:54695835-54695857 CACTTCAGGAGGGAGGTAGCTGG - Intergenic
1179513408 21:41890035-41890057 CTCATTAGGAAGGGTGTAGCTGG + Intronic
1180789367 22:18566180-18566202 CACAGCAGCAGGCATGCAGCAGG + Intergenic
1181232374 22:21429131-21429153 CACAGCAGCAGGCATGCAGCAGG - Intronic
1181246277 22:21505726-21505748 CACAGCAGCAGGCATGCAGCAGG + Intergenic
1181411290 22:22721583-22721605 AACATCAGGATGCATGGAGCTGG - Intergenic
1182279636 22:29210174-29210196 CTCCTTAGGAGACATGGAGCTGG - Intronic
1183811560 22:40261967-40261989 CACCTCCCGAGGCATGTAGCGGG - Exonic
951555884 3:23920259-23920281 CACATTAGGGGGAAAGTAGTTGG + Exonic
952682720 3:36113633-36113655 CACATGAGAAGGCATGTGGGAGG - Intergenic
953166160 3:40466634-40466656 CACAATATGAGGCAGGTATCAGG - Intergenic
953427339 3:42805623-42805645 CACATTAGGAGCCCTGTCCCCGG - Intronic
954966454 3:54615813-54615835 CACAGCAGGAGGTAAGTAGCGGG + Intronic
956300788 3:67770464-67770486 TACTTTAGGAGTCATGCAGCTGG - Intergenic
956975715 3:74576073-74576095 CACATTAGGAGGCAGAGGGCTGG - Intergenic
957071461 3:75570933-75570955 CACTTTGGGAGGCATGTTGGGGG - Intergenic
958151329 3:89697834-89697856 CAGTTTAGCAGTCATGTAGCGGG - Intergenic
959106568 3:102071544-102071566 CACAGCAGGAGGCGAGTAGCAGG - Intergenic
963298643 3:143575017-143575039 CACACTAAGAGACATTTAGCAGG + Intronic
965141210 3:164837499-164837521 CACAATATGAGCCATGGAGCAGG + Intergenic
972721578 4:41704545-41704567 CACTTTGGGAGGCATGAAGCAGG + Intergenic
974651885 4:64764738-64764760 AACATAAGGGGGCATGGAGCTGG - Intergenic
978535542 4:109758206-109758228 CACTTTAGAAGGCGTGTTGCTGG - Intronic
978771299 4:112458826-112458848 GACAGAAGGAGCCATGTAGCTGG - Intergenic
982268927 4:153567039-153567061 CACCTTAGAAGGCAAGTAGCAGG - Intronic
984885195 4:184443515-184443537 CACAATAAGAAGCATGGAGCTGG - Intronic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
991426008 5:66492401-66492423 TACTTTAGGAGTCATGTAGCTGG - Intergenic
993831773 5:92769031-92769053 TACATTGGGAGGCAGGGAGCAGG + Intergenic
994819823 5:104634912-104634934 CACAGTAGGAGGTAAGTGGCAGG - Intergenic
999588984 5:153123253-153123275 CACATCAGGTGGCATGTAGGTGG - Intergenic
1001622872 5:173103150-173103172 TACATTAGCAGGCATTTGGCAGG + Intronic
1004241485 6:13925775-13925797 CACCTCTGGAGGCAGGTAGCTGG + Intronic
1006030625 6:31174331-31174353 CAAACTAGGAGGCATGGACCAGG + Intronic
1007180192 6:39923912-39923934 CACAGTAGGAGGCATGCAAGAGG + Intronic
1009930279 6:70169152-70169174 CTTATTAGGAGGAATGTATCAGG + Intronic
1011604704 6:89091674-89091696 CACATTAAGTGCCATGTATCAGG - Intergenic
1015088845 6:129329834-129329856 CACAGCAGGAGGCAAGCAGCAGG + Intronic
1015118845 6:129679470-129679492 CACATTACTTGGCATGTAGTAGG - Intronic
1017327624 6:153158258-153158280 CAGACTAGGAGGCAACTAGCAGG + Intergenic
1018226558 6:161634752-161634774 CACATTAGTAGGCTTCAAGCAGG + Intronic
1019571848 7:1716530-1716552 CACCTGTGCAGGCATGTAGCCGG - Intronic
1023506235 7:40902331-40902353 CACTTTAGGAGGCTTGAGGCAGG + Intergenic
1038448463 8:27621289-27621311 CAAATTAGGATGCATGCAGAAGG - Intergenic
1040647616 8:49418346-49418368 TAGTTTAGGAGTCATGTAGCTGG + Intergenic
1043266948 8:78278672-78278694 CAGTTTAGGAGTCATGCAGCTGG + Intergenic
1044826140 8:96199203-96199225 CACAGTAGGAAGCAGGAAGCTGG - Intergenic
1046634871 8:116663101-116663123 CATATGAGGAGGCAAATAGCAGG - Intronic
1047385034 8:124401198-124401220 TAGTTTAGGAGTCATGTAGCTGG + Intergenic
1047704196 8:127481232-127481254 ATCATTAGGAGGCATTCAGCAGG + Intergenic
1047918782 8:129611473-129611495 CACAATATTTGGCATGTAGCAGG + Intergenic
1050205703 9:3194271-3194293 CCCCTTAGGAGGCATGGAGTAGG - Intergenic
1052687202 9:31771648-31771670 CACATTAGGTGGCAGATATCAGG - Intergenic
1052865800 9:33464008-33464030 CACATTAGGGGGCAGGTATGGGG + Intronic
1055231731 9:74074542-74074564 GAAATTAGGAGTCATGCAGCTGG - Intergenic
1056108476 9:83371559-83371581 CACTTTAGGAGGCGTGAGGCAGG - Intronic
1058789099 9:108423708-108423730 GACATTAGGCGGCCTGTAGAGGG - Intergenic
1058829560 9:108803356-108803378 CGGTTTAGGAGTCATGTAGCTGG + Intergenic
1059813733 9:117887539-117887561 CACAGAAGGTGGCATGCAGCTGG - Intergenic
1061042892 9:128149977-128149999 CACTGGAGGAGGCATGTGGCTGG - Intronic
1188225492 X:27592307-27592329 CACATCCAGAGGCATGGAGCCGG + Intronic
1189423676 X:40879696-40879718 CACATTAGGAGCGAGGGAGCTGG + Intergenic
1192126007 X:68501390-68501412 CACAATACCTGGCATGTAGCAGG - Intronic
1192463331 X:71336631-71336653 CAGTTTAGGAGTCATGCAGCTGG - Intergenic
1193482630 X:82046176-82046198 CACAGTAGTGGGCAGGTAGCAGG - Intergenic
1193961075 X:87925143-87925165 CAGTTTAGCAGTCATGTAGCTGG + Intergenic
1194845471 X:98801942-98801964 CACATTAGGAAACATGGATCTGG + Intergenic
1196004702 X:110823102-110823124 CACAAAAAGAGGCATGTACCAGG + Intergenic
1196243254 X:113367687-113367709 CACTTTAGGAGCATTGTAGCTGG + Intergenic
1199498158 X:148477409-148477431 TACATTAGCAGGCAGGTTGCAGG - Intergenic