ID: 927835197

View in Genome Browser
Species Human (GRCh38)
Location 2:26391476-26391498
Sequence CAAAGTATGAAAGGTCTTTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927835194_927835197 -4 Left 927835194 2:26391457-26391479 CCAATTACTATAACATTTCCAAA 0: 1
1: 0
2: 1
3: 32
4: 391
Right 927835197 2:26391476-26391498 CAAAGTATGAAAGGTCTTTCAGG 0: 1
1: 0
2: 2
3: 19
4: 192
927835193_927835197 24 Left 927835193 2:26391429-26391451 CCAGATAGCTGTGTGCATTTATG 0: 1
1: 0
2: 2
3: 19
4: 151
Right 927835197 2:26391476-26391498 CAAAGTATGAAAGGTCTTTCAGG 0: 1
1: 0
2: 2
3: 19
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927835197 Original CRISPR CAAAGTATGAAAGGTCTTTC AGG Exonic
902413535 1:16225975-16225997 CAAAGTATGAGAGTACTTTGGGG - Intergenic
904959598 1:34321828-34321850 CAAATTATGCATGGTCTTGCAGG + Intergenic
906866736 1:49429278-49429300 ATAAGAATGAAAGGTCTGTCTGG + Intronic
907247240 1:53116010-53116032 GAAAGAATGAAAGGGCTTTGGGG - Intronic
907533464 1:55126107-55126129 CAAGTTATGAAGGGTCTTACAGG - Intronic
908693383 1:66808124-66808146 CAAATCATGAAATGTCTTGCAGG - Intergenic
911889476 1:103348926-103348948 CAAAGTATGAAGTGTCTTGCAGG + Intergenic
913029146 1:114880557-114880579 CCAAGTATATAAGGTTTTTCAGG + Intronic
914874753 1:151504778-151504800 CAAAGAATGAAATATCTTTTGGG + Intergenic
916279754 1:163036749-163036771 CAAAGCAAGAAAACTCTTTCTGG - Intergenic
916563444 1:165953077-165953099 CAAAGAATAAAAGGTCTTACAGG - Intergenic
919030813 1:192239653-192239675 CAAAATATGAAAGCTTTTGCAGG + Intergenic
919883831 1:201918370-201918392 CACATTTTGAAAGGTCTTTCTGG - Intronic
920277978 1:204822578-204822600 CAAAGTGAGTAAGGGCTTTCCGG + Intergenic
921277081 1:213531309-213531331 CCAAATAGGAAAGGTGTTTCAGG - Intergenic
924059471 1:240156707-240156729 CAAAGTAGAAAAGGTTTGTCAGG + Intronic
1064941107 10:20736542-20736564 CAGAGGATGAAGGGTCTTTGTGG + Intergenic
1067243350 10:44515657-44515679 CAGAGGATGAAATGTCTATCTGG + Intergenic
1068549991 10:58396748-58396770 CAAAGTCTTCAAAGTCTTTCTGG - Exonic
1069803634 10:71102276-71102298 CAAAGCCTGAAAACTCTTTCAGG - Intergenic
1071958707 10:90786861-90786883 CAAGGCATGAAAGGTCTTCATGG + Intronic
1074799476 10:116984896-116984918 CTAAGTATGAAAGGTCTTAGAGG - Intronic
1076331265 10:129670774-129670796 CAAACTATCAAAGCTCTCTCAGG + Intronic
1079841226 11:25401954-25401976 AAAGGTTTGAAAGGTCTTTGGGG + Intergenic
1080045251 11:27801201-27801223 CAAAGTGTGAGGGGACTTTCAGG + Intergenic
1083471856 11:62889401-62889423 TAAAGCAGGAAAGGTGTTTCAGG + Intergenic
1083615526 11:64024224-64024246 TAAAGTCTGGAAGGTCCTTCAGG - Intronic
1084628123 11:70324599-70324621 AAAGGTATGAAAAGTATTTCAGG - Intronic
1086699664 11:89886546-89886568 CAGAGTCTGAAAAGACTTTCTGG + Intergenic
1086706507 11:89957970-89957992 CAGAGTCTGAAAAGACTTTCTGG - Intergenic
1087115634 11:94521535-94521557 CAACTTATGATAGGTTTTTCAGG + Intergenic
1087389318 11:97514050-97514072 CAGAGTAGGAATGCTCTTTCAGG - Intergenic
1087419656 11:97905660-97905682 GAAAGCCTGAAAGGTCTATCAGG + Intergenic
1089021287 11:115217766-115217788 CAAAGGATGGATGGTTTTTCAGG - Intronic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1089670769 11:120055487-120055509 CAAAGGATGGAAGGTGTTCCAGG + Intergenic
1089832489 11:121340980-121341002 CAAATTATGAAGGGTTTTTCGGG - Intergenic
1094353203 12:29549400-29549422 GGAGGTATGGAAGGTCTTTCTGG + Intronic
1095143763 12:38698919-38698941 CAAAGTCTGAAAGGACTTTTTGG - Intronic
1096894030 12:54802108-54802130 CAAAGTATGAAATAGCTTCCAGG - Intergenic
1098179736 12:67833101-67833123 CTAGGTCTGAAAGGTCTTTAGGG + Intergenic
1098917052 12:76268414-76268436 CAAAGTATGACAGGGCTTGATGG - Intergenic
1099855044 12:88153425-88153447 CAAAGTATGCAAACTTTTTCTGG + Exonic
1100151057 12:91738071-91738093 CAAAGTTTCAAATTTCTTTCTGG - Intergenic
1101219416 12:102621840-102621862 CAAAGTATAAAAGATTTTTCAGG + Intergenic
1101665728 12:106811769-106811791 GAAGGTATGAAAGGTGTTTGAGG + Intronic
1104265146 12:127225239-127225261 CATATTATGAAGGGTCCTTCTGG - Intergenic
1104375256 12:128260369-128260391 GAAAGAAAGACAGGTCTTTCTGG - Intergenic
1106241328 13:27915989-27916011 AAAAGTATGAAAGGACTTTCAGG - Intergenic
1106761181 13:32869398-32869420 CATAGTATGAAAAGTATTCCCGG - Intergenic
1107969107 13:45624204-45624226 AAAATTCTGATAGGTCTTTCAGG + Intergenic
1108101075 13:46956586-46956608 CAAAGCATGAAGGATCTTTAGGG - Intergenic
1108272858 13:48779705-48779727 CAAAGTATAATAGGTATTTATGG + Intergenic
1108542899 13:51460897-51460919 CAAAGTGAGAAAAATCTTTCTGG + Intergenic
1110212262 13:72987558-72987580 CAAATTAAGTAAGGCCTTTCTGG - Intronic
1110713153 13:78672104-78672126 CAAAGAAGGAAACCTCTTTCTGG + Intergenic
1113117917 13:106893150-106893172 AAAAGTTTGAAAGGTATTGCAGG + Intergenic
1117424821 14:55582679-55582701 CAAAGTATTGGAGATCTTTCAGG - Intronic
1118853222 14:69600823-69600845 TAAAGTGGGAAAGGGCTTTCTGG - Intergenic
1127161582 15:56192701-56192723 CAAAGATTCAAATGTCTTTCGGG + Intronic
1127359402 15:58231768-58231790 CAAAATAATAAAGGTATTTCTGG - Intronic
1127359856 15:58235889-58235911 CAAAATAATAAAGGTATTTCTGG + Intronic
1131373425 15:91903636-91903658 CAAAGTATGGGAGGCCTTTGTGG + Intronic
1133647743 16:7780345-7780367 GAAAGTATGAATGTTATTTCAGG + Intergenic
1133843075 16:9428153-9428175 GAAAGTTTGAAAGTTCCTTCTGG - Intergenic
1134390940 16:13819457-13819479 CTAAGTATGAAAGGTGTATGTGG - Intergenic
1134615347 16:15647139-15647161 GAAAGTACCAAATGTCTTTCAGG - Intronic
1139319135 16:66099178-66099200 AATAGTCTGAAAGATCTTTCTGG + Intergenic
1139848734 16:69937983-69938005 CATAGGATGACAGCTCTTTCTGG - Intronic
1145199578 17:20931044-20931066 AAAAGTATCAAAGGCCTTTAGGG + Intergenic
1145890409 17:28410875-28410897 CAAAGTAGGAAGGGTATTACTGG - Intergenic
1146166565 17:30594246-30594268 AAAAGTATGAAAGGTATATGGGG + Intergenic
1147650235 17:42057954-42057976 AAAAGAATGAAAGGGCTTCCTGG + Intronic
1148724171 17:49776798-49776820 GAAAGTAGGAAAGCTCTTTGTGG + Intronic
1148935261 17:51160015-51160037 CAAAGAATGGACGGTCCTTCAGG - Exonic
1149691584 17:58581504-58581526 CAAAGTATGTAATGTCTACCAGG - Intronic
1150257188 17:63756859-63756881 CAAAATATGAAAGGGCTTATGGG + Intronic
1155160012 18:23187877-23187899 CAAAGAATGAAATGACTTTTTGG - Intronic
1155290434 18:24335640-24335662 GGAACTATGAAAGGTTTTTCAGG + Intronic
1155522968 18:26687770-26687792 ATAAGTATGGATGGTCTTTCAGG - Intergenic
1156484129 18:37454091-37454113 CCAAATATGATAGGTCTGTCTGG - Intronic
1157459450 18:47874415-47874437 AAGAGTATGAAAGAACTTTCTGG + Intronic
1158146386 18:54318376-54318398 CAATATATGAAAGATATTTCTGG + Intronic
1158258715 18:55585410-55585432 AACAGTATGAAAGATCTTTGAGG - Intronic
1159447553 18:68559087-68559109 CAAAGGGTGAGATGTCTTTCTGG + Intergenic
1161122607 19:2537770-2537792 GAAATTATGAAAGGTCTTGAGGG + Intronic
1161784656 19:6316449-6316471 CAAAGAATGAAATGCCTTTGCGG + Intronic
1165186090 19:34023039-34023061 CAAAGTAAGAAAAATCTTTGTGG - Intergenic
1168343026 19:55636566-55636588 GAATCTATCAAAGGTCTTTCAGG - Intronic
924984831 2:261547-261569 CAAAGTAAAAATTGTCTTTCCGG - Intronic
925647523 2:6051976-6051998 CCAAGTATGCAGGTTCTTTCAGG + Intergenic
926884800 2:17587067-17587089 CAAAGGAAGAAAGGGCTTTAGGG - Intronic
927667040 2:25040104-25040126 CAAAGAATGAAAGGTCTAGCAGG - Intergenic
927835197 2:26391476-26391498 CAAAGTATGAAAGGTCTTTCAGG + Exonic
928917921 2:36493322-36493344 CACACTAAGAAAAGTCTTTCTGG - Intronic
929676459 2:43936500-43936522 GGAAGTATAAAAGGACTTTCTGG - Intronic
931619097 2:64191961-64191983 AAAAATCTGAAAGGTCTGTCTGG + Intergenic
933622730 2:84562182-84562204 CAAAGTATGAAAGGTTAATAAGG + Intronic
935833195 2:107022016-107022038 CAAAGTAGGAAAGATCTTTCTGG + Intergenic
936780519 2:116027356-116027378 GAATGTATGGAAGGTCTTCCAGG + Intergenic
937953437 2:127405811-127405833 CAGAGCATTTAAGGTCTTTCTGG - Intergenic
938669040 2:133569484-133569506 CTCAGTTTGAAAGGTCTTTGAGG + Intergenic
940378149 2:152981134-152981156 CTAAGTATTAAATGTCTTTCTGG + Intergenic
941492703 2:166162691-166162713 GAAAGAAAGAAAGGTCTTTCTGG - Intergenic
942334135 2:174862788-174862810 CAAGATATGAAAGGTATTTCTGG + Intronic
942428615 2:175885002-175885024 CACAGTTTGAAATGTTTTTCAGG - Intergenic
946002742 2:216496489-216496511 CAAAGTCTGGAAGCTCTTCCTGG + Intergenic
947326574 2:228985444-228985466 CAAGCTATGAAAGCTCTTTGAGG + Intronic
947628128 2:231634081-231634103 CAAAGCATGAAAGGCCTGGCTGG + Intergenic
1169609818 20:7365733-7365755 CAAAGTTTGTGAGGTCTTTCTGG + Intergenic
1170325886 20:15153889-15153911 CAAAGTATAAAAAATCCTTCTGG - Intronic
1170339391 20:15306493-15306515 CAAAGTATCATAGGTGTTTAAGG + Intronic
1170634335 20:18091891-18091913 AAAAGTAAGAAAGGTTTTGCAGG - Intergenic
1171061413 20:21966245-21966267 CAAAGGATGATACTTCTTTCTGG - Intergenic
1171183411 20:23107761-23107783 CAAAGTATGAGTGGGCTTTTTGG - Intergenic
1173417288 20:42868166-42868188 CAGAGTATTAAGGGTGTTTCTGG + Intronic
1174657430 20:52183243-52183265 CAAGGTGGGAAAGGTATTTCAGG + Intronic
1175321508 20:58091421-58091443 ACAAGAATGTAAGGTCTTTCAGG + Intergenic
1175584923 20:60131616-60131638 CACAGCAGGAAAGGACTTTCCGG + Intergenic
1181743497 22:24939790-24939812 CAAATGTTCAAAGGTCTTTCAGG - Intronic
1184874085 22:47261754-47261776 CTAGGTTTGAAAGGACTTTCAGG - Intergenic
950946081 3:16947742-16947764 GAAAGAATGAAAGGGCTTTCTGG - Intronic
953447060 3:42977391-42977413 CAAAGTGTGAAAGGACTTGTAGG + Intronic
953587036 3:44211381-44211403 CAAAATATGAAAGTTATTGCTGG + Intergenic
954536503 3:51363030-51363052 CAAAGTATGAAAAGTAAATCGGG + Intronic
956871193 3:73419981-73420003 GAAAGTATGAAAGCTCTGTGTGG - Intronic
958731347 3:97963657-97963679 GATGGTATGAGAGGTCTTTCAGG + Intronic
959916264 3:111819936-111819958 CATGGTATGAAATGTCTTGCAGG + Intronic
960466621 3:118003682-118003704 AAAAGTATGAAACCTCTTTATGG - Intergenic
960540180 3:118853353-118853375 CCAAGTATGAATGGCTTTTCTGG - Intergenic
961969254 3:130942569-130942591 TACAGTCTGAAAGGTTTTTCAGG - Intronic
965408138 3:168296166-168296188 CAAAAAATGAAAAGTCTTTAAGG - Intergenic
965447392 3:168792047-168792069 GAAAGTAGGAAAGGACTCTCTGG + Intergenic
965794550 3:172426369-172426391 CATATTCTGAAAGCTCTTTCAGG + Intergenic
965984932 3:174739584-174739606 CAAAGCATGCAATGTCTTTTAGG + Intronic
967691224 3:192476113-192476135 CCATGTATGGAAAGTCTTTCGGG - Intronic
968788163 4:2639944-2639966 CTGAGTATGAAAGTTCTTGCAGG + Intronic
971981023 4:33750561-33750583 CAAAGTTTGAAATGTATTACTGG - Intergenic
972798466 4:42446926-42446948 CAAAGCAGGAAAGGGCATTCTGG + Intronic
974067649 4:57094666-57094688 CAAAGCATAAAACGTCATTCAGG - Intronic
974486117 4:62508330-62508352 GAAAGAATAAAAGGACTTTCTGG + Intergenic
975384656 4:73742198-73742220 CAAACTATGTATGGTCTTTCTGG - Intronic
975876370 4:78842304-78842326 CAAATTAAGAAATGTCTTTATGG - Intronic
975993451 4:80285378-80285400 CAAAATAAGAAAGGATTTTCAGG - Intronic
976220437 4:82752996-82753018 CAAAGTCTGGATGGTCTTTAAGG - Intronic
976430649 4:84960295-84960317 CAAAGTTTGGAAGGACTTCCAGG - Intronic
978044653 4:104111800-104111822 TGTAGTATGAAAGGTCTTTAGGG + Intergenic
981824052 4:148918913-148918935 CAAATTATGATAGGTTTATCAGG - Intergenic
982994967 4:162331549-162331571 GAAAGTATGAAAAATCTTACCGG + Intergenic
987775957 5:22366482-22366504 CCAACTGTGAAAGGTCCTTCTGG + Intronic
987798856 5:22666909-22666931 CAAAATATGCAAGGTCTTATAGG - Intronic
987894736 5:23929844-23929866 CAAACTATGAAGGGCATTTCTGG - Intergenic
990081484 5:51920773-51920795 CAAAGAAGAAAATGTCTTTCCGG + Intergenic
990592217 5:57278006-57278028 CAAACTGTTAAAAGTCTTTCAGG + Intergenic
990786228 5:59423611-59423633 AAAATTATGAAAGGTCTTCTAGG + Intronic
996191900 5:120554812-120554834 GAAATTATGAGAGGTGTTTCTGG - Intronic
996202306 5:120691349-120691371 CAGAATATGAAAGGGATTTCAGG + Intergenic
997305421 5:132832199-132832221 AAAAATATTAAAAGTCTTTCAGG - Intergenic
999520564 5:152346658-152346680 CCATCTATGAAAGGGCTTTCTGG + Intergenic
999879779 5:155849185-155849207 CACAGTGTGAAAGCTCCTTCTGG + Intergenic
1001022519 5:168195435-168195457 AAAAGCATGAAATGTCTTTGGGG - Intronic
1001037049 5:168304711-168304733 CAAAATATCTCAGGTCTTTCTGG - Intronic
1001369922 5:171188864-171188886 AAAAGTGTGCAATGTCTTTCTGG - Intronic
1003411771 6:5870707-5870729 CAAAATATTAAAGGACTTTTAGG - Intergenic
1003841386 6:10124225-10124247 CACAGTATGACAAGTCTTTCTGG - Intronic
1005726347 6:28652486-28652508 AGAAGTTTGAAAGGACTTTCTGG - Intergenic
1006301845 6:33197861-33197883 AAGAGTATGTAAGGTCTTTGCGG + Exonic
1009884173 6:69604549-69604571 AAAAGTAGGAAAGGCATTTCAGG - Intergenic
1011894983 6:92214803-92214825 AAAAGTAGGAAAGGTGTTTGAGG - Intergenic
1013098053 6:106963848-106963870 CAAATTATGAAAGGCCTTACAGG + Intergenic
1014337107 6:120150427-120150449 CAAAATACAAAAGGTCATTCGGG + Intergenic
1014884811 6:126766937-126766959 AAAAGTATGAAATATCTTTGGGG - Intergenic
1015712674 6:136159296-136159318 TACAGTATGAAAGGTGTTTTTGG + Intronic
1020430980 7:8115935-8115957 CAAGGTATGAAAGGCCTCTGAGG - Intronic
1020525071 7:9249093-9249115 AAGATTATTAAAGGTCTTTCAGG + Intergenic
1021049929 7:15970619-15970641 AAAAGTATGAAATATTTTTCAGG + Intergenic
1024154134 7:46603133-46603155 CGCAGTATGAAATGTCTTGCTGG + Intergenic
1024351308 7:48367700-48367722 CCAAGTTAGAAAGCTCTTTCAGG - Intronic
1027379389 7:77590354-77590376 CAAAGTATTAAAGTTTTGTCAGG + Intronic
1027586425 7:80064355-80064377 CAAAGTATCAAAGATCTGTGGGG + Intergenic
1028250423 7:88533626-88533648 CAGAGCATGCAAGGTCTTGCAGG - Intergenic
1028539992 7:91932373-91932395 GAAGGTATGAAAGGTAATTCTGG - Intergenic
1028883544 7:95907345-95907367 CAAAATATAAACGGTCATTCTGG - Intronic
1029815665 7:103092029-103092051 CAAAATATGAAATTTCTATCTGG - Intronic
1032648176 7:133848638-133848660 GAAAGTATGAAAGATATTTCAGG - Intronic
1033432753 7:141304221-141304243 CAGAGCATGTAAGATCTTTCAGG - Intronic
1034588542 7:152118580-152118602 CAAAATGTGAAAGGTTATTCCGG - Intronic
1038986296 8:32814853-32814875 CAAAGTATAAAACTTCTCTCAGG - Intergenic
1039493224 8:37963404-37963426 CAAAAAATGAAAAGTCTGTCTGG - Exonic
1041631152 8:60088784-60088806 CAAAGGATGACAGGACTTTTTGG - Intergenic
1045711917 8:104994853-104994875 CAATGTATGAAAAATCTCTCTGG - Intronic
1045739925 8:105345555-105345577 AAACGTATGGAAGCTCTTTCAGG + Intronic
1046552833 8:115738505-115738527 CAGATTATGAAGGGTCTATCTGG - Intronic
1051024952 9:12597429-12597451 CCAAGTATGAAAAGGGTTTCAGG + Intergenic
1052379658 9:27756340-27756362 GCCAGTGTGAAAGGTCTTTCTGG - Intergenic
1052398944 9:27976377-27976399 AAAAGTGTGAATGTTCTTTCTGG + Intronic
1054998794 9:71425049-71425071 CCAAGAGTGGAAGGTCTTTCAGG - Intronic
1055577539 9:77675122-77675144 GTAAGTATGAATGGTCTCTCTGG - Intergenic
1058279292 9:103091443-103091465 CAAACTATGAAAGATTTTTTTGG - Intergenic
1058384318 9:104415742-104415764 CAAAGCAGGGAAGGGCTTTCAGG - Intergenic
1059566768 9:115390337-115390359 CAAATCATGAAAGGCCTTGCAGG + Intronic
1060713957 9:125903116-125903138 CAAAAAAAGAAAGATCTTTCAGG - Intronic
1185886304 X:3786411-3786433 TAAATTATGAAGGATCTTTCTGG - Intergenic
1187387218 X:18859941-18859963 CACAGTTTTTAAGGTCTTTCTGG - Intergenic
1187833160 X:23403524-23403546 CAAAGTATTACAGCTCTTTGTGG - Exonic
1188012871 X:25075958-25075980 CAAAGTATGAAGGTTCTGGCCGG - Intergenic
1188408403 X:29840745-29840767 CCAAGTATCAAAGGGCTGTCAGG - Intronic
1188779281 X:34260486-34260508 CAAAGGATTATAGGACTTTCCGG + Intergenic
1190128727 X:47727008-47727030 AAAAATAGGAAAGGTCGTTCAGG - Intergenic
1192213802 X:69143989-69144011 CAAAGTCTGAAAGTTCTCTCTGG + Intergenic
1192326128 X:70133799-70133821 CAAAGCATCAAAGGACTTCCGGG - Exonic
1192495159 X:71611589-71611611 CAAAGTTAGAAAGGCCATTCTGG - Intronic
1192580102 X:72273939-72273961 CAAAGTGAGAAAGATCTTTGTGG - Exonic
1195329326 X:103784295-103784317 CAAAGCATGAAACATCTTTCTGG - Intronic