ID: 927835519

View in Genome Browser
Species Human (GRCh38)
Location 2:26395236-26395258
Sequence ATGAAGAAACTATCTGATAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 488}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927835519_927835524 28 Left 927835519 2:26395236-26395258 CCTTTATCAGATAGTTTCTTCAT 0: 1
1: 0
2: 1
3: 33
4: 488
Right 927835524 2:26395287-26395309 TCTGAAGCCTCTTCCTGATCTGG 0: 1
1: 0
2: 3
3: 13
4: 187
927835519_927835521 -2 Left 927835519 2:26395236-26395258 CCTTTATCAGATAGTTTCTTCAT 0: 1
1: 0
2: 1
3: 33
4: 488
Right 927835521 2:26395257-26395279 ATGTGGAGTTCATCTGCATGTGG 0: 1
1: 0
2: 2
3: 12
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927835519 Original CRISPR ATGAAGAAACTATCTGATAA AGG (reversed) Exonic
900016652 1:155351-155373 ATCATGATACTATCTGACAAGGG + Intergenic
900046913 1:513943-513965 ATCATGATACTATCTGACAAGGG + Intergenic
900069117 1:755661-755683 ATCATGATACTATCTGACAAGGG + Intergenic
900492249 1:2956561-2956583 ATAAAGAAACTACCTGAGACTGG + Intergenic
900587797 1:3441602-3441624 ATAAGGGAGCTATCTGATAATGG + Intergenic
903147392 1:21383366-21383388 GGGCAGAAACTATCTGATACTGG + Intergenic
906734069 1:48107565-48107587 ATGAAGATACTACCTGAGACTGG + Intergenic
907230511 1:52994427-52994449 ATGACAAAAATATCTAATAATGG - Intronic
908056766 1:60295892-60295914 ATGAAGAAAATATATGCTGATGG + Intergenic
908905376 1:69002712-69002734 GTGAAGAAAATATCTGATTCTGG - Intergenic
909163133 1:72180552-72180574 ATAAACAATATATCTGATAAGGG + Intronic
909193101 1:72579903-72579925 ATGAAAAAACTCTTGGATAATGG + Intergenic
909540387 1:76784995-76785017 ATGAATAAAGTTTGTGATAAAGG - Intergenic
909790203 1:79667473-79667495 ATGAAGAGACTTTCAAATAAAGG + Intergenic
909889153 1:80981219-80981241 ATGAAGAAACTGTATCAAAAAGG + Intergenic
910577545 1:88783162-88783184 ATGAAGAAAATATCTGAGGCAGG - Intronic
910741401 1:90522479-90522501 AATAACAAACTATCTGAAAAAGG + Intergenic
910766818 1:90790484-90790506 ATGAAGATACTACCTGAGACTGG + Intergenic
911082877 1:93950573-93950595 ATGAAGAGATTATCTGAAACTGG - Intergenic
911233320 1:95383166-95383188 ATAAAGAAACCACCAGATAAAGG - Intergenic
911634637 1:100220469-100220491 ATGAATAGACTATCTTATCACGG - Intronic
911909212 1:103611177-103611199 ATGAAGAAAGTATCTCAAACAGG + Intergenic
911911541 1:103643411-103643433 ATGAAGAAAGTATCTCAAATAGG + Intergenic
911916913 1:103708539-103708561 ATGAAGAAAGTATCTCAAATAGG - Intronic
911918956 1:103737549-103737571 ATGAAGAAAGTATCTCAAATAGG + Intronic
911992861 1:104724805-104724827 AACAATAAACTATCTGAAAAAGG + Intergenic
912077981 1:105901334-105901356 ATGAAGAAAATCTGTGATATGGG - Intergenic
912605607 1:110985866-110985888 ATGAAGAAGCTACCTAGTAAGGG + Intergenic
912936356 1:114006877-114006899 ATGAAGATACTACCTGAGACTGG + Intergenic
913355629 1:117918641-117918663 ATGAAGATACTTTCTGACACAGG + Exonic
914215315 1:145621665-145621687 ATAAATTACCTATCTGATAATGG + Intronic
914374363 1:147060774-147060796 ATGAAGAAAAGCTCTGATATGGG - Intergenic
914467266 1:147942050-147942072 ATAAATTACCTATCTGATAATGG + Intronic
915017975 1:152754239-152754261 ACAAAGAAACAATCAGATAATGG - Intronic
915710021 1:157886968-157886990 ATGAAGAAACAAACTTATAATGG + Intronic
916350537 1:163844661-163844683 AAGAAGAAACTATCTTCCAAGGG + Intergenic
916606657 1:166349402-166349424 ATGAGGAAATTATCTTCTAAAGG - Intergenic
917547554 1:175986675-175986697 ATGAACAGACAATATGATAATGG + Intronic
917879494 1:179320188-179320210 ATGTAGAAACTAACTCAAAAAGG - Intronic
918948643 1:191105679-191105701 ATAAAGAAACTATGGGATCATGG - Intergenic
919518165 1:198553299-198553321 ATTAAGGAACTGTTTGATAATGG - Intergenic
919598108 1:199589798-199589820 ATGAAGAAACAGTCTAGTAAAGG - Intergenic
921319218 1:213921800-213921822 ATGAAGAAACGAATTAATAAAGG - Intergenic
921469010 1:215526214-215526236 ATGAATAAACTATTGGACAATGG + Intergenic
921578514 1:216867031-216867053 ATGATGAAACTTTGTGATACTGG + Intronic
921674436 1:217962522-217962544 ATGAATAAATAATATGATAAAGG - Intergenic
921700086 1:218259135-218259157 ATGTAGAAACTACCTGACAAAGG + Intergenic
921761341 1:218918743-218918765 ATGCATACACTAGCTGATAAAGG + Intergenic
921766114 1:218974069-218974091 ATAAAGATACTATCTGAGACTGG - Intergenic
922104478 1:222501053-222501075 ATCATGATACTATCTGACAAGGG + Intergenic
922264797 1:223973568-223973590 ATCATGATACTATCTGACAAGGG + Intergenic
923133999 1:231101556-231101578 ATGAAGGAAGTATATGGTAAAGG - Intergenic
923961637 1:239091097-239091119 ATGAAGACATTATCTGAGACCGG - Intergenic
924019735 1:239768608-239768630 ATAAAGGAACTATCAGATGAAGG - Intronic
924346656 1:243078572-243078594 ATCACGATACTATCTGACAAGGG + Intergenic
924393171 1:243585967-243585989 ATTCATAAACTATCTGACAAAGG + Intronic
1063101853 10:2957035-2957057 ATGAAGAAAATACCTGACACTGG - Intergenic
1063354804 10:5388006-5388028 ATGAAAAAAGTATCTGAGACAGG - Intergenic
1064013734 10:11757095-11757117 ATTCATAAACTATCTTATAATGG + Intronic
1064042337 10:11978461-11978483 ATGAACAAACTATGTGTTAGTGG - Intronic
1065348005 10:24767526-24767548 ATGAGGAAACTACTTGATACTGG - Intergenic
1065521275 10:26575690-26575712 ATAAAGAAACTACCTGAGACTGG + Intergenic
1065527021 10:26633126-26633148 ATAAAGAAACTACCTGAGACTGG + Intergenic
1065559735 10:26950395-26950417 ATAAAGAAACTACCTGAGACTGG - Intergenic
1066321099 10:34304695-34304717 ATGAAGAAACTAAAACATAAAGG - Intronic
1066729695 10:38426277-38426299 ATCATGATACTATCTGACAAGGG - Intergenic
1067075724 10:43180272-43180294 ATGAACAAAATATCTAAGAACGG - Intronic
1067550593 10:47232243-47232265 AAGAAGAAAGTTTCTGATAGTGG - Intergenic
1068052998 10:51975859-51975881 TGGGAGAAAATATCTGATAAGGG + Intronic
1068056061 10:52014177-52014199 ATAAAGAAACTACCTGAGACTGG + Intronic
1068152289 10:53148118-53148140 TTGAAAAAAATATATGATAAGGG - Intergenic
1068164227 10:53306764-53306786 AAATAGAAATTATCTGATAAGGG - Intergenic
1068696090 10:59969525-59969547 CTGAAGAAGCTATTTGATAAAGG + Intergenic
1068826429 10:61445229-61445251 ATTAAGAGACTGTCTGAGAATGG + Intronic
1070988628 10:80711029-80711051 TTGCAAAAACTACCTGATAATGG - Intergenic
1070993046 10:80749917-80749939 ATGAAGATACTACCTGAGACTGG + Intergenic
1071667388 10:87573208-87573230 TTGAAAAACATATCTGATAAAGG - Intergenic
1072091358 10:92130806-92130828 ATGTATACACTATCTGAGAAAGG + Intronic
1073397802 10:103232514-103232536 ATTAAAACACAATCTGATAAGGG + Intergenic
1074303959 10:112258854-112258876 ATGCAGCTACTATCAGATAAGGG - Intergenic
1075114494 10:119614458-119614480 ATGAAGACACTACCTGAGACTGG - Intergenic
1075828161 10:125378405-125378427 ATGAAGCAACTACCTTATGAAGG + Intergenic
1076536369 10:131180187-131180209 AAGAAGAATCTATATGATACGGG + Intronic
1076918075 10:133434831-133434853 ATCTGGAAACTATCTAATAATGG - Intergenic
1076938071 10:133578908-133578930 ATCTGGAAACTATCTAATAATGG - Intergenic
1076973243 11:150420-150442 ATCATGATACTATCTGACAAGGG + Intergenic
1077953907 11:6992121-6992143 ATGTAGAAACTATGTGAAGAGGG + Intergenic
1078474227 11:11617803-11617825 ATGAAGCAAGAATCTGCTAAAGG - Intronic
1078490276 11:11761921-11761943 ATTAATAAAGTATATGATAAAGG + Intergenic
1078716384 11:13843346-13843368 AAGGCGAAACTATCTGATATGGG + Intergenic
1079026762 11:16955060-16955082 ATAAAAAATCCATCTGATAAGGG - Intronic
1079865699 11:25731024-25731046 ATGAAGATACTATGTGAGACTGG + Intergenic
1080130717 11:28791735-28791757 ATGAAGAAAAAATGTGTTAAGGG - Intergenic
1080487244 11:32722173-32722195 ATGATGAAAATCACTGATAATGG - Intronic
1080909900 11:36585693-36585715 ATAGAGAAGCTATTTGATAATGG - Intronic
1081271881 11:41095049-41095071 ATGAAAATACTATCTGAGACTGG + Intronic
1081327466 11:41762984-41763006 TTTAAGAAACTACCTGACAATGG + Intergenic
1083032746 11:59608862-59608884 ATAGAGAAACCATCTGGTAATGG - Intronic
1084985174 11:72863587-72863609 ATAAATCAAATATCTGATAAAGG + Intronic
1085557719 11:77440503-77440525 ATGAGGAAACAAACTGAGAAAGG + Intronic
1086489934 11:87349039-87349061 GTGAAGAAACCATCTTAGAAGGG - Intergenic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1087608016 11:100400919-100400941 ATGAAACATGTATCTGATAAGGG - Intergenic
1087844467 11:102956658-102956680 TTTAAGAAAATATCTGAGAATGG - Intergenic
1087897135 11:103599246-103599268 ATGAAGATACTACCTGAGACTGG + Intergenic
1088181553 11:107118414-107118436 ATCAAGAATCTTTCTTATAATGG + Intergenic
1088575764 11:111269851-111269873 TTTAAGAAATTATCTGAAAATGG + Intronic
1090248185 11:125232147-125232169 TTGAAGAAACTATGTGAGACGGG - Intronic
1090488689 11:127138509-127138531 AAAAAGAAACCATCTGACAAGGG + Intergenic
1090587056 11:128224278-128224300 CAGAAGAAACTATCTCAGAATGG + Intergenic
1090680669 11:129053624-129053646 ATGAAGAAACTAAAGCATAAAGG - Intronic
1092041142 12:5385622-5385644 ATGAATAAACTGTCTCTTAATGG + Intergenic
1093365623 12:18293253-18293275 ATGAAGAAACTAGGTCAAAAAGG + Intronic
1093879208 12:24384152-24384174 ATGAAAAAAATATCTGAGACTGG - Intergenic
1094002362 12:25708458-25708480 CTGAAGGAAGGATCTGATAAAGG - Intergenic
1094438713 12:30451369-30451391 AGGAAGAAATAATTTGATAAAGG - Intergenic
1094608521 12:31970979-31971001 AGGTAGAAATAATCTGATAAAGG - Intronic
1095373837 12:41502662-41502684 GTGAAGAAACTATCCATTAAAGG - Intronic
1095420652 12:42020655-42020677 ATGATGAAAGCATCTGAGAATGG - Intergenic
1097391227 12:59016540-59016562 ATGAAGAAATTGTTTTATAATGG + Intergenic
1097727038 12:63087351-63087373 ATGAAGACACACTGTGATAAAGG + Intergenic
1098298786 12:69032350-69032372 ATCATAAAACTATCTGATACCGG + Intergenic
1099229047 12:80001997-80002019 ATAAAGATACTATCTGAGACTGG + Intergenic
1099669833 12:85675647-85675669 AAGAAGACACTATATGAAAAGGG + Intergenic
1099942919 12:89211572-89211594 ATGAAGAAAATAACTGTTGAAGG + Intergenic
1100127336 12:91443597-91443619 ATTTAGAGACTCTCTGATAATGG - Intergenic
1100164411 12:91900323-91900345 ATAAAGATACTATCTGAGACTGG - Intergenic
1100368434 12:93943043-93943065 ATGAAGAAACTCTCTGACCTGGG + Intergenic
1100674432 12:96850659-96850681 ATAAAGATACTATCTGAAACTGG + Intronic
1100873452 12:98937751-98937773 ATAAAGATACTATCTGAAACTGG + Intronic
1101337897 12:103812999-103813021 ATGTAGGAACTAAGTGATAAAGG + Intronic
1104011109 12:124930801-124930823 ATGATGAAACTACATGACAAAGG - Intergenic
1105061268 12:133153458-133153480 ATGAAGAATATCTATGATAAGGG - Intronic
1105958788 13:25310054-25310076 AGGAAGAACCTGTCTGATAGGGG - Intronic
1106773857 13:32989770-32989792 ATAAAGAAATTATCAGAAAAAGG + Intergenic
1107120208 13:36787901-36787923 AATAAGAAACAATTTGATAATGG + Intergenic
1107441665 13:40433129-40433151 ATGAAGGAACAATCTGCAAATGG - Intergenic
1107509061 13:41062979-41063001 ATGAAGCACCTATATTATAATGG + Intronic
1107686991 13:42911307-42911329 ATGATGTCACAATCTGATAAAGG - Intronic
1110492525 13:76125560-76125582 ATGAAGAAAATACCTGAGAGTGG - Intergenic
1111185872 13:84735142-84735164 ATAAAGAAACTACCTGAGACTGG - Intergenic
1111318479 13:86592619-86592641 ATAAAGATACTATCTGAGACTGG + Intergenic
1111595981 13:90411143-90411165 GTGAAGAAACTAACTGAGATGGG + Intergenic
1112008945 13:95277955-95277977 ATGAAGAAACTAGCTCAGATTGG + Intronic
1112699959 13:101996326-101996348 ATGGAGAAACTTTCTGAGGAGGG + Intronic
1112742407 13:102489929-102489951 ATGAAGATACTACCTGAGACTGG - Intergenic
1114336490 14:21696691-21696713 ATGAATAATTTATCTGATAAGGG + Intergenic
1115004317 14:28463472-28463494 ATGAAGATACTACCTGAGACTGG + Intergenic
1115008551 14:28516543-28516565 ATGAAGAAGCTGTTTCATAAAGG - Intergenic
1115272397 14:31568281-31568303 GTGAAGTAACTATGTAATAAGGG + Intronic
1115795983 14:36936203-36936225 ATGAAGAAATTATTTGAAGAGGG - Intronic
1115930632 14:38488703-38488725 AACAATAAACTATCTGAAAAAGG - Intergenic
1116059596 14:39905130-39905152 TTGAAGAAACAAGCTGAAAATGG - Intergenic
1118113972 14:62752932-62752954 ATAAAGATACTATCTGAGACTGG - Intronic
1118153875 14:63219344-63219366 TTAAACAAAGTATCTGATAATGG + Intronic
1118826794 14:69390757-69390779 ATAAAACATCTATCTGATAAAGG + Intronic
1118873608 14:69764434-69764456 ATAAAAAAACTATCTGAAACTGG - Intronic
1119979052 14:79058989-79059011 ATGAAGATACTACCTGAAACTGG - Intronic
1120292555 14:82593932-82593954 ATCAAGAATCTACCTGAGAATGG - Intergenic
1120337468 14:83175127-83175149 TTGAAGTAACTATTTCATAAAGG + Intergenic
1121748061 14:96318341-96318363 CTGAAGAAACTGTCTCATAAAGG + Intronic
1122218147 14:100217916-100217938 ATGTAGAGACTATCAGAAAAAGG + Intergenic
1124586156 15:31009986-31010008 ATGTTGAAATTATCTGACAAAGG - Intronic
1124804533 15:32867994-32868016 ATGAATAAACTACCAGTTAAAGG + Intronic
1124863494 15:33466336-33466358 ATGAAGAAAGTATTTTAAAAAGG + Intronic
1126644868 15:50865437-50865459 ATGAAGAAACAGCCTCATAAAGG + Intergenic
1126731002 15:51682129-51682151 ATGAATAGACTGTCTGAGAAAGG - Intronic
1128196475 15:65761671-65761693 AAGAAAAAACTAGCAGATAAGGG + Intronic
1129102554 15:73279711-73279733 AATAACAAACTACCTGATAAAGG + Intronic
1130585849 15:85181547-85181569 AGGAAGAAATTAGCTTATAAAGG - Intergenic
1131967785 15:97862998-97863020 GTAAAGAATATATCTGATAAAGG - Intergenic
1131987614 15:98060834-98060856 ATGAAGAGATTATCTGAAACTGG + Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1134319841 16:13152730-13152752 ATGAAGACTCTATCTGAAGAAGG + Intronic
1136991671 16:35155264-35155286 AAGAAAAAACTAACTGAAAACGG + Intergenic
1137269280 16:46892834-46892856 GTAAACAAAATATCTGATAATGG - Intronic
1137781974 16:51105142-51105164 AGGAAGAAACCATCTGGAAAAGG + Intergenic
1137857766 16:51813219-51813241 TTGCAGAAAATGTCTGATAATGG - Intergenic
1138380040 16:56593770-56593792 ATAAAGATACTATCTGAGACTGG - Intergenic
1138430226 16:56963647-56963669 AAGAAAAAAATATATGATAAAGG - Intronic
1142447008 16:90147106-90147128 ATCATGATACTATCTGACAAGGG - Intergenic
1142460484 17:88225-88247 ATCATGATACTATCTGACAAGGG + Intergenic
1143355420 17:6324328-6324350 ATTTAGAAATAATCTGATAATGG + Intergenic
1144187398 17:12809491-12809513 CTGAAGAAATTATTTTATAAAGG - Intronic
1146131349 17:30279004-30279026 ATTTAGAACCAATCTGATAAAGG + Intronic
1147483634 17:40790893-40790915 ATAAAGAAACTACCTGAGACTGG - Intergenic
1148318878 17:46732020-46732042 CTGAAAAAACTATATGCTAATGG - Intronic
1151103872 17:71589360-71589382 ATAAAGACACTATCTGAGACTGG + Intergenic
1153068076 18:1070267-1070289 GTGAGGAAACTATCTGAGATTGG - Intergenic
1153124700 18:1776861-1776883 ATGATAAAAATATCTGAAAAAGG + Intergenic
1155623807 18:27811553-27811575 ATAAAGATACTATCTGAGACTGG - Intergenic
1156240776 18:35251820-35251842 ATGAAGATACTACCTGATACTGG - Exonic
1156904298 18:42335892-42335914 ATAAAGATACTATCTGAGACTGG + Intergenic
1157431538 18:47631636-47631658 ATGGAGAAACCATGTGAAAAGGG - Intergenic
1157734572 18:50035393-50035415 ATAAAGAAACCATCTTCTAAAGG + Intronic
1158071843 18:53479660-53479682 ATGAAGAAGGGATCTGACAAAGG + Intronic
1158518589 18:58151253-58151275 GGGAAGAAACTATTTGAGAATGG + Intronic
1158571286 18:58598696-58598718 ATAAAGAAATTACCTGACAAGGG - Intronic
1158927363 18:62281705-62281727 ATGAAAAATCTATATGACAAAGG - Intronic
1159496407 18:69213219-69213241 ATAAAGATACTATCTGAGACTGG + Intergenic
1159518019 18:69482759-69482781 AATAAGAAACTATATGAAAAAGG + Intronic
1159978217 18:74742219-74742241 ATGAAGGAACTATTACATAAGGG + Intronic
1160003961 18:75054409-75054431 ATGAAGATACTATAATATAAAGG + Intronic
1160650199 19:220725-220747 ATCATGATACTATCTGACAAGGG + Intergenic
1165298871 19:34954638-34954660 TGGGAGAAAATATCTGATAAAGG + Intergenic
1202670588 1_KI270709v1_random:46610-46632 ATTAAGAAACTCACTGAAAACGG + Intergenic
926068025 2:9859895-9859917 ATGAAGATACTACCTGAGACTGG + Intronic
926458582 2:13099648-13099670 ATAAAGATACTACCTGATACTGG + Intergenic
926973833 2:18493607-18493629 ATGAAGTAAATTTCTGTTAAAGG - Intergenic
927835519 2:26395236-26395258 ATGAAGAAACTATCTGATAAAGG - Exonic
928276283 2:29903022-29903044 ATCATGAAACTAACTGATGATGG + Intronic
929391400 2:41472479-41472501 ATAAAGAAACTACCTGAGACTGG - Intergenic
929671123 2:43877012-43877034 ATGAAGAAACTGTGTGAATATGG + Intronic
930077244 2:47416701-47416723 GTGAAGAAACTATGACATAAAGG - Intronic
930593807 2:53361069-53361091 ATATAGAAAGCATCTGATAAAGG - Intergenic
930946386 2:57081899-57081921 ATGAAGACATTCTCAGATAAAGG - Intergenic
931172922 2:59823740-59823762 AGGTGGAAACTATCTGATGATGG + Intergenic
931212311 2:60208837-60208859 ATGAAGAAACTAGCTCAAAGAGG + Intergenic
931394223 2:61871517-61871539 ATGATGGAACTATCTGTTTAGGG - Intronic
931862994 2:66376643-66376665 ATGAACCAACTGTCTGATGATGG - Intergenic
932020938 2:68085842-68085864 ATGAAGACACTTTCAAATAAAGG - Intronic
932039737 2:68286477-68286499 AGAAAGTGACTATCTGATAAAGG + Intronic
932097468 2:68864362-68864384 ATGAACAAAACATTTGATAAAGG + Intergenic
932309527 2:70728554-70728576 TTGAAGACACTCTCTGAAAAAGG + Intronic
935212295 2:100948722-100948744 ATCAAGAAACCAACTGAAAACGG + Intronic
935805091 2:106737695-106737717 ATAAAGATACTATCTGAGACTGG - Intergenic
935921421 2:108019566-108019588 ATGTAGAAATTATATGACAAGGG + Intergenic
935953356 2:108350933-108350955 ATGAATAAAATATCTGATGCTGG - Intergenic
935977704 2:108595359-108595381 ATGAACAAACTACCTTATATGGG + Intronic
936396434 2:112135405-112135427 AGGAATAAACTAGCTGATAAGGG + Intergenic
937734330 2:125271469-125271491 ATGAGAAAACTATCTGTAAATGG - Intergenic
938233538 2:129681937-129681959 ATGTTAAAATTATCTGATAAGGG + Intergenic
939053632 2:137335073-137335095 ATGAAGAAAATACCTGAGACTGG - Intronic
939478755 2:142720534-142720556 GTTAATAAAATATCTGATAAAGG + Intergenic
939515285 2:143159215-143159237 CTGAACAAACAATCTGTTAATGG - Intronic
939854654 2:147343807-147343829 ATAAAGATACTATCTGAGACTGG - Intergenic
940877922 2:158916691-158916713 ATGAAGAAACTAAATACTAATGG - Intergenic
941137468 2:161735099-161735121 ATAAAGATACTACCTGATACTGG - Intronic
941203807 2:162546975-162546997 ATAAAGATACTATCTGAGACTGG + Intronic
941575125 2:167220522-167220544 AAGAAGAAGAAATCTGATAAAGG - Intronic
941913252 2:170787574-170787596 GTGAAGAAACTATCTGAATCTGG - Intronic
941976487 2:171410628-171410650 ATGAGGACATTATCTGAAAATGG - Intronic
942442335 2:176049459-176049481 ATAAAGACACTATCTGAGACTGG - Intergenic
942492230 2:176500911-176500933 ATGCAGAAAGTAACTGATTAAGG - Intergenic
942643926 2:178090798-178090820 CTGAAGGAATTATCTGATAAGGG - Intronic
942906810 2:181192634-181192656 ATCAAGAAAGTATCTAATATTGG + Intergenic
943147814 2:184067252-184067274 CTGAAGAAACTATTTGAGTATGG + Intergenic
943237494 2:185340871-185340893 ATAAAAAAACTACCTGATACTGG + Intergenic
943520266 2:188940768-188940790 AAGAAGAAACTGGTTGATAAAGG + Intergenic
944017548 2:195061263-195061285 AAGAAGAAGCTAACTAATAAAGG - Intergenic
944432572 2:199649717-199649739 ATGACAAAAATATCTGAAAAAGG - Intergenic
944454269 2:199877108-199877130 ATGAACAAACAAACTGAAAAGGG + Intergenic
945475036 2:210272097-210272119 ATGAAGATACTACCTGAAACTGG + Intergenic
945529135 2:210927836-210927858 ATAAAGAAACTACCTGAGACTGG - Intergenic
945753627 2:213818965-213818987 ATGAAGTTACTATCTGAGACTGG - Intronic
946628468 2:221640969-221640991 ATCAAGGCACTGTCTGATAATGG + Intergenic
948241575 2:236441607-236441629 ATGTAGAAATTATGTGATTATGG - Intronic
948428023 2:237900923-237900945 ATGCAGTGACTGTCTGATAAAGG - Intronic
1169152934 20:3304772-3304794 GTGAATAAACTATCAGCTAATGG + Intronic
1169572828 20:6925178-6925200 TTGAAGAAAATATCTTTTAAAGG + Intergenic
1170413263 20:16113137-16113159 ATGAAGTAAGTAACTGATACAGG - Intergenic
1170868108 20:20178284-20178306 ATGAAGAAAATGTATCATAAAGG - Intronic
1173767363 20:45625033-45625055 ATGAAGATACTACCTGAGACTGG + Intronic
1174618452 20:51855079-51855101 ATGAGGAATCTTTATGATAATGG - Intergenic
1174645395 20:52081021-52081043 ATGCAGAAACTAAAGGATAAGGG - Intronic
1176889261 21:14294510-14294532 ATATAGATACTATCTGATACTGG + Intergenic
1176964828 21:15200543-15200565 ATAAAGAAACTGTGCGATAAGGG + Intergenic
1177688039 21:24465623-24465645 ATAAAGATACTATCTGAGACTGG - Intergenic
1177767493 21:25474811-25474833 ATAAAGATACTACCTGAGAATGG - Intergenic
1178027549 21:28485392-28485414 TTGAAGAAACTTTCTCAGAAAGG + Intergenic
1181838836 22:25636671-25636693 ATGAAGGAACTTTCTAAGAATGG - Intronic
1183775708 22:39963514-39963536 ATGAAGAAAGTATCTGTTGGTGG + Intronic
949155709 3:825341-825363 ATGAAGAGACTATCTGAGACTGG - Intergenic
949835255 3:8261864-8261886 ATGTAGAAATAATTTGATAAAGG - Intergenic
950251835 3:11472035-11472057 TTGAAGAAATTATCTGAAAAAGG - Intronic
951443852 3:22754084-22754106 GTAGAGAAACTAACTGATAAGGG - Intergenic
952659628 3:35829746-35829768 ATGATGATTCTATCTGAAAATGG + Intergenic
953275573 3:41493264-41493286 ATTAAGAAACTCACTGAAAACGG + Intronic
954476270 3:50749116-50749138 AGAAAGAAACTAACTGATGAAGG - Intronic
954482693 3:50816250-50816272 ATGAAAAAAAAATCTGAGAATGG - Intronic
955179050 3:56648988-56649010 ATGGAGGAACCATCTGATAAGGG + Exonic
956211004 3:66801519-66801541 ATGAAACACATATCTGATAAAGG - Intergenic
956500653 3:69880459-69880481 ATGAAGAAACCAACTGAAATTGG + Intronic
957212027 3:77271800-77271822 ATGATGAAACTACATGATAAAGG - Intronic
957522516 3:81337527-81337549 ATGAAGATACTACCTGAGACTGG - Intergenic
958081737 3:88754381-88754403 ATGAATAAATTATTTGAAAATGG - Intergenic
958659322 3:97045245-97045267 TTAAAGAAAATATCTGATACTGG + Intronic
958704534 3:97637936-97637958 ATGAAGTATCTTTCTGATATGGG + Exonic
959053688 3:101548781-101548803 ATGAAAAAACTAGCTGAGCATGG - Intergenic
959760108 3:109952267-109952289 ATGAAGACATTACCTGAAAATGG - Intergenic
960475536 3:118120058-118120080 CTGAAGAAACTATCAGCAAATGG - Intergenic
961800873 3:129448093-129448115 ATGAAGAAGATATTTGAAAAAGG - Intronic
962081892 3:132148806-132148828 AAGAAGAAACCATCTGAAGAGGG + Intronic
963658870 3:148098068-148098090 ATGTAGTAAGTATATGATAAAGG + Intergenic
965169725 3:165247440-165247462 ATGAAGATACTATCTGAGACTGG + Intergenic
965258829 3:166453038-166453060 AAGAAGAAAGTATCTCATAAAGG - Intergenic
965301403 3:167010357-167010379 ATGAAGACACTACCTGAGACTGG + Intergenic
966007913 3:175038975-175038997 ATAAACAAACTCTCTGATAGTGG + Intronic
966164683 3:177004248-177004270 AAAAAAAAAGTATCTGATAAAGG + Intergenic
967027837 3:185579976-185579998 AGGAAACAACTGTCTGATAAAGG - Intergenic
967822828 3:193854028-193854050 ATGATGAGACTATGTGGTAAAGG - Intergenic
968367648 3:198199404-198199426 ATCATGATACTATCTGACAAGGG - Intergenic
969179885 4:5431551-5431573 ATGAAGTAGCTTTCTGATACTGG + Intronic
969886548 4:10220365-10220387 TGGAAGAAGCCATCTGATAAAGG - Intergenic
970087079 4:12361891-12361913 ATAAAGATACTACCTGATACTGG + Intergenic
970289660 4:14557463-14557485 AAGAAGAAATTAACTGATAGAGG - Intergenic
970758429 4:19453775-19453797 ATAAAGATACTATCTGAGACTGG - Intergenic
971039357 4:22734127-22734149 ATAAAGATACTATCTGAGACTGG - Intergenic
971640162 4:29121093-29121115 AATAAGAAACTATTTGTTAAAGG + Intergenic
972479814 4:39486600-39486622 ATGAAGAGACCATCTGCCAAGGG + Intergenic
972586849 4:40445373-40445395 AAGAAGAAAATATCTGATGAAGG + Intronic
972906426 4:43753312-43753334 AGTAAGAAGCTATCTTATAAAGG - Intergenic
973324366 4:48843338-48843360 ATGAACTATCTATCTGGTAATGG + Intronic
974323095 4:60377728-60377750 ATGAATGAATTATCTGATAACGG - Intergenic
974431449 4:61802446-61802468 TGGAAGAAATTATCTGAAAAAGG - Intronic
974827405 4:67149065-67149087 ATAAAGAAACTACCTGAGACTGG + Intergenic
975065792 4:70061976-70061998 ATGAGAAATCTTTCTGATAATGG - Intergenic
975969998 4:80022029-80022051 ATGAAGAAACAAGCTTATAAAGG + Intronic
976163552 4:82229219-82229241 GTCAGGAAACCATCTGATAATGG + Intergenic
976185391 4:82438015-82438037 AGGATGAAACCAGCTGATAATGG + Intronic
976521320 4:86030691-86030713 ATTAAGAAAATATCAGATAAAGG - Intronic
977045348 4:92062259-92062281 ATGAAGAAGGTTGCTGATAAAGG + Intergenic
977072326 4:92406929-92406951 ATAAAGATACTATCTGAAACTGG + Intronic
978121964 4:105090727-105090749 ATAAAGAAACTACCTGAGATTGG - Intergenic
978696440 4:111585425-111585447 ATAAAGATACTATCTGAGACTGG + Intergenic
979135191 4:117102850-117102872 ATAAAGAAACCATTTAATAAGGG + Intergenic
979256062 4:118609116-118609138 ATCATGATACTATCTGACAAGGG - Intergenic
979332282 4:119431421-119431443 ATCATGATACTATCTGACAAGGG + Intergenic
980428084 4:132653251-132653273 ATGAAGAGACAACCTGATGAAGG - Intergenic
980482848 4:133411050-133411072 ATGAAGAAAGAAGCAGATAAAGG - Intergenic
980551075 4:134335900-134335922 ATAAAGATACTACCTGAGAATGG - Intergenic
980626319 4:135379285-135379307 ATGAAGAAAATAAATGTTAAGGG - Intergenic
981287510 4:143036171-143036193 CTGAAGAAGCTCTCAGATAAGGG + Intergenic
981711451 4:147712802-147712824 ATGACAAAACTAAGTGATAAAGG + Intergenic
982822831 4:159965912-159965934 ATCAACAAACTATATGATACAGG - Intergenic
983022349 4:162693456-162693478 ATAAAGATACTATCTGAGAGTGG + Intergenic
983424431 4:167564845-167564867 TTGAAGAAAGTATTTGATAATGG + Intergenic
984348090 4:178557457-178557479 AAGAAGGAACTAATTGATAATGG + Intergenic
984350738 4:178589063-178589085 ATGCAGAAAATATAGGATAAGGG - Intergenic
984670696 4:182483669-182483691 ATAAAAAAACTACCTGATACTGG + Intronic
984823161 4:183901837-183901859 ATAAAGCATATATCTGATAAGGG - Intronic
985020321 4:185682075-185682097 ATGAAGAAAATAAATGAAAAGGG - Intronic
985031648 4:185796259-185796281 ACAGAGAAACTATCTTATAAAGG + Intronic
985815122 5:2122427-2122449 ATGAAGAAATTATCAGAGGAAGG - Intergenic
986260795 5:6144449-6144471 TTCAAGAAAATATCTGTTAACGG - Intergenic
986529766 5:8724118-8724140 ATAAAGATACTACCTGATACTGG - Intergenic
986598063 5:9443894-9443916 ATGAAGAAATTATAGGATGAAGG + Intronic
986819697 5:11452058-11452080 AGGAAGAAACTTTCTGAAAATGG + Intronic
987064690 5:14277827-14277849 ATGAAGAAAAAATCTTAGAAAGG - Intronic
987743234 5:21936983-21937005 ATAAAGATACTACCTGAGAATGG - Intronic
988650497 5:33143899-33143921 ATGAAGAAACAAGTTGAGAAAGG + Intergenic
990015775 5:51060919-51060941 ATAAAGATACTATCTGAGACTGG + Intergenic
990602012 5:57368517-57368539 ATAAAGAAATGATTTGATAAGGG + Intergenic
990729407 5:58792098-58792120 ATGAGGAAATTAGTTGATAATGG + Intronic
991604945 5:68392018-68392040 ATAAAAAAACTACCTGATACTGG + Intergenic
991749683 5:69787536-69787558 ATAAAGATACTACCTGAGAATGG + Intergenic
991763427 5:69947104-69947126 ATAAAGATACTACCTGAGAATGG - Intergenic
991783900 5:70171025-70171047 ATAAAGATACTACCTGAGAATGG + Intergenic
991801262 5:70367350-70367372 ATAAAGATACTACCTGAGAATGG + Intergenic
991827337 5:70642692-70642714 ATAAAGATACTACCTGAGAATGG - Intergenic
991842656 5:70822164-70822186 ATAAAGATACTACCTGAGAATGG - Intergenic
991876345 5:71171400-71171422 ATAAAGATACTACCTGAGAATGG + Intergenic
993923129 5:93831804-93831826 ATGGAGATAATATCTGTTAATGG + Intronic
994132740 5:96249053-96249075 ATGTAGCAACTATGTGACAAAGG - Intergenic
994515455 5:100766692-100766714 ATGAAGAACACAACTGATAAAGG + Intergenic
994834057 5:104826226-104826248 ATGATGAAACTATAAGGTAAAGG - Intergenic
994884176 5:105537874-105537896 ATGAAGAAAATACCTGAGACTGG - Intergenic
995095692 5:108233154-108233176 GTGAAACAAATATCTGATAAGGG - Intronic
995418533 5:111936478-111936500 ATTAAGAAACTACCTGAGACTGG - Intronic
995995495 5:118293192-118293214 ATGAAGATACTACCTGAGACTGG - Intergenic
996132640 5:119800173-119800195 ATGAAGGAACTAAATGACAAAGG + Intergenic
996179000 5:120395739-120395761 CTGAAGAAACTCTCTGGTAAAGG - Intergenic
997286843 5:132686035-132686057 ATGAATAAACTATCTGTAACTGG + Intergenic
997908646 5:137845913-137845935 ATGGAGAAGCTGTCTGAGAAAGG + Intergenic
998194302 5:140054126-140054148 GTGAAGAAAGTATCTTAAAAAGG + Intergenic
998576931 5:143327080-143327102 ATAAAGATACTATCTGAGACTGG + Intronic
998618115 5:143763422-143763444 ATTCACAAACTATATGATAAAGG - Intergenic
999355167 5:150921433-150921455 ATAAAGATACTCTCTGATAACGG + Intergenic
1000175501 5:158748533-158748555 AAGAAGACACTATGTGAAAATGG - Intronic
1001552446 5:172612882-172612904 GTGAAGAAACTATCTGAGCCTGG + Intergenic
1001928861 5:175658592-175658614 ATGGAGCAACTTTCTGCTAAAGG + Intronic
1002726868 5:181304633-181304655 ATCATGATACTATCTGACAAGGG - Intergenic
1003366982 6:5484251-5484273 GTGAAGGAATTATCTGGTAATGG + Intronic
1004706588 6:18129849-18129871 ATGGAGAAACCATGTGAAAAGGG + Exonic
1005491406 6:26350613-26350635 TTGCAGAATTTATCTGATAAGGG - Intergenic
1005736668 6:28754351-28754373 ATGAAGACACTACCTGAGACTGG + Intergenic
1006439043 6:34041959-34041981 ATGAAGAAACTAACTGGGCATGG + Intronic
1006956762 6:37880659-37880681 ATGAAGGATATATTTGATAATGG + Intronic
1007059761 6:38927252-38927274 AAAAAGAAACTATCTAATTAAGG - Intronic
1008948958 6:57133326-57133348 ATGAAAAAATTATATCATAATGG - Intronic
1009194331 6:60666275-60666297 ATAAAGATACTACCTGATACTGG + Intergenic
1009370324 6:62892996-62893018 ATAAAGAAACTACCTGAGAATGG + Intergenic
1009763402 6:68037926-68037948 ATAAAGATACTACCTGAGAATGG + Intergenic
1010038477 6:71354120-71354142 AAGAATAAACTGTCAGATAAAGG - Intergenic
1011614883 6:89188660-89188682 ATAAATCATCTATCTGATAAAGG - Intronic
1011879522 6:92007354-92007376 ATGAAGATACTACCTGAGACTGG + Intergenic
1012153300 6:95783420-95783442 ATAAAGATACTATCTGAGACTGG + Intergenic
1012577471 6:100820725-100820747 ATCATGTATCTATCTGATAAGGG + Intronic
1012733663 6:102911562-102911584 ATGAAGAAACTACCTGAGACTGG - Intergenic
1013034887 6:106371998-106372020 AGGAAGAAACTACATGATGATGG - Intergenic
1014760387 6:125350132-125350154 ATGAGGGAACTTTTTGATAAGGG - Intergenic
1015080991 6:129225639-129225661 ATTAAGAAACTCACTGAAAACGG - Intronic
1015562135 6:134527314-134527336 GTGAGGAAACTCTCTGATGAAGG - Intergenic
1015580893 6:134723688-134723710 ATGAAAAAAGTATATGACAAAGG + Intergenic
1015586647 6:134783213-134783235 AAAAAGAAACCTTCTGATAATGG - Intergenic
1015634432 6:135261907-135261929 ATGAAGAAACTAGGTGATTGTGG - Intergenic
1015661328 6:135577317-135577339 GAGAAGAAACTATCTGAGATTGG + Intergenic
1015669351 6:135671003-135671025 ATGAACCATCTATCTGATAAAGG + Intergenic
1016124742 6:140386245-140386267 ATGAAGATACTACCTGAAACTGG + Intergenic
1016170724 6:141012435-141012457 ATGAAGAAACTACCTGAGTTGGG + Intergenic
1016737780 6:147499005-147499027 ATGAAGATACTACCTGAGACTGG + Intergenic
1018692378 6:166357906-166357928 ATGAAGATACTACCTGAGACTGG + Intergenic
1020704700 7:11529745-11529767 ATAAAGATACTATCTGAGACTGG - Intronic
1020858201 7:13454970-13454992 ATGATGAAACAATATGATAAAGG - Intergenic
1021010122 7:15452324-15452346 ACAAATAAAATATCTGATAAAGG + Intronic
1021787044 7:24162912-24162934 ATAAAGATACTATCTGAGAATGG - Intergenic
1022440040 7:30425845-30425867 ATGAAGGAACTATCTGCAAAGGG - Intronic
1022652625 7:32290975-32290997 ATTATGAAAATATCTTATAATGG + Intronic
1024071766 7:45792246-45792268 ATCATGATACTATCTGACAAGGG - Intergenic
1027431501 7:78118440-78118462 ATGAAAGATGTATCTGATAAAGG + Intronic
1027530963 7:79332054-79332076 AAGAAGATACTATGTGTTAAAGG - Intronic
1028030377 7:85904590-85904612 ATAAAGATACTATCTGAGACTGG - Intergenic
1028125809 7:87111882-87111904 ATGAATAAAATTTTTGATAAAGG + Intergenic
1028458404 7:91063219-91063241 TTGAAGGAGCTATGTGATAATGG - Intronic
1028827512 7:95290383-95290405 AAAAAGAAACTAAATGATAAGGG + Exonic
1030436415 7:109527457-109527479 ATGATGAAACTAACAGAAAAGGG - Intergenic
1030488194 7:110198325-110198347 ATGAAGAAAATATTTGAGCAAGG - Intergenic
1031225829 7:119036605-119036627 ATCAAGAACCTACCTGAGAAAGG - Intergenic
1031465891 7:122111369-122111391 ATGAAGACATTTTCAGATAAAGG + Intronic
1031789183 7:126078737-126078759 CTGAAGCATATATCTGATAAAGG - Intergenic
1032048382 7:128629852-128629874 ATCATGATACTATCTGACAAGGG - Intergenic
1033675052 7:143532740-143532762 AGGAAGAAACAATTGGATAAAGG - Intergenic
1033696784 7:143796701-143796723 AGGAAGAAACAATTGGATAAAGG + Intergenic
1034127394 7:148685731-148685753 ATGCAGAAACTAACTCAAAATGG + Intergenic
1035233138 7:157478295-157478317 ATGAAGAAAATACCTGTTCAAGG + Intergenic
1035551349 8:529453-529475 ATGAAAAAACTCTCTGGTAAAGG - Intronic
1036527301 8:9547150-9547172 ATGCAGGCACTATCTGAAAATGG - Intergenic
1036584330 8:10109080-10109102 AGGAAGAAACTAAGTGAGAAAGG - Intronic
1036597135 8:10224142-10224164 AAGAAGCTACTATCTGTTAAGGG - Intronic
1037341041 8:17845450-17845472 ATGAAGAAACAGTCAGATAGAGG - Intergenic
1039535980 8:38313118-38313140 ATGAATAAAATATTTTATAAGGG + Intronic
1040132333 8:43811822-43811844 AGAAAGAAGCTATCTGTTAATGG + Intergenic
1040834194 8:51715092-51715114 ATGTAGTATATATCTGATAAGGG + Intronic
1042036280 8:64537893-64537915 ATTAACAAACTACCTGTTAATGG - Intergenic
1042966225 8:74356328-74356350 TGGAACAAACTGTCTGATAAAGG + Intronic
1043610013 8:82051190-82051212 ATAAAGATACTACCTGAGAATGG + Intergenic
1044346719 8:91112927-91112949 AGGAATAAAGTATCTGAAAAGGG + Intronic
1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG + Intronic
1045069454 8:98486153-98486175 ATAAGGAAACTATATGTTAAAGG - Intronic
1046352337 8:113032096-113032118 ATAAAGATATTATCTGAGAATGG - Intronic
1047638745 8:126795554-126795576 ATAAAGATACTACCTGATACTGG - Intergenic
1047688578 8:127327194-127327216 CTGAAGAAAATTTCAGATAAAGG - Intergenic
1048077438 8:131087546-131087568 ATGAAGAAACAATCTAGAAATGG + Intergenic
1048114059 8:131500617-131500639 ATGAAAAAATTAACTGAAAATGG + Intergenic
1048486760 8:134855585-134855607 ATGAAGAAACAATCTTATCCAGG - Intergenic
1049048222 8:140169891-140169913 ATGCAGAAACTAGCTGAGCATGG - Intronic
1049281137 8:141745592-141745614 ATGAAAGAACTAACTGAGAATGG + Intergenic
1049912448 9:282336-282358 ATGAAAAACCTGGCTGATAACGG - Intronic
1051063418 9:13072673-13072695 ATGAAGAAAATATATAATGAAGG - Intergenic
1051368216 9:16336167-16336189 ATGAAGAAGCTATCTGAAAAGGG + Intergenic
1051938205 9:22470388-22470410 ATGAGTAAACAATCTGAGAAAGG + Intergenic
1052261865 9:26526033-26526055 AGGATGAAAATATATGATAAAGG - Intergenic
1053125756 9:35579520-35579542 ATAAAGAAACTACCTGAGACTGG - Intergenic
1053579405 9:39388242-39388264 AGGGAGAACATATCTGATAAAGG - Intergenic
1053843918 9:42216324-42216346 AGGGAGAACATATCTGATAAAGG - Intergenic
1054100991 9:60947051-60947073 AGGGAGAACATATCTGATAAAGG - Intergenic
1054122368 9:61222425-61222447 AGGGAGAACATATCTGATAAAGG - Intergenic
1054585360 9:66959832-66959854 AGGGAGAACATATCTGATAAAGG + Intergenic
1055516961 9:77043143-77043165 TTAAAGTAACTATCTTATAATGG - Intergenic
1055894531 9:81159978-81160000 ATGAAGAATATATATGATGAGGG - Intergenic
1056588005 9:87940769-87940791 ATGAAGAAACAACCAGAGAATGG - Intergenic
1056608862 9:88112176-88112198 ATGAAGAAACAACCAGAGAATGG + Intergenic
1060540631 9:124427968-124427990 ATGAGGAAACTTTCTGATGGTGG - Intergenic
1060576611 9:124701716-124701738 AAGAAAAAAAAATCTGATAAAGG - Intronic
1062515925 9:136935806-136935828 ATGCTGAAATTATCTGACAAGGG - Intronic
1062751989 9:138262109-138262131 ATCATGATACTATCTGACAAGGG - Intergenic
1185846651 X:3443601-3443623 ATGAAGCACCTATCTGATTAGGG - Intergenic
1186140133 X:6563261-6563283 ATAAAGATACTACCTGATACTGG + Intergenic
1188099179 X:26061656-26061678 ATCACAAATCTATCTGATAAAGG - Intergenic
1188274696 X:28185293-28185315 ATGAAGAAATGAACTGATGAAGG - Intergenic
1189769529 X:44410211-44410233 ATCAAGACACTTTCAGATAAAGG + Intergenic
1189871002 X:45382385-45382407 ATGAAGAGACAACCTGTTAATGG - Intergenic
1189958813 X:46305863-46305885 ATAAAGATACTATCTGAGACTGG + Intergenic
1190080315 X:47351807-47351829 ATGATGGAATTATCTGACAAGGG - Intergenic
1190407255 X:50100535-50100557 ATTAAGAGAATGTCTGATAAAGG - Intergenic
1190496913 X:51035269-51035291 ATGATGAAATTTTCTGAAAATGG + Intergenic
1190509110 X:51158957-51158979 ATGATGAAATTTTCTGAAAATGG - Intergenic
1190989484 X:55531318-55531340 ATGAAGAAACTTGATGATGAAGG - Intergenic
1191205280 X:57827252-57827274 ATTAAGAAACTCACTGAAAACGG - Intergenic
1191915738 X:66199471-66199493 ATGATGAAACTAACTAGTAATGG - Intronic
1192399977 X:70825449-70825471 ATGTTAAAACTATCTGATAAGGG + Intronic
1192878812 X:75260180-75260202 AGGAAGAAACTATCAATTAATGG + Intergenic
1192998604 X:76539219-76539241 ATGAGCAAACAATCTAATAAAGG + Intergenic
1192998927 X:76542160-76542182 AGGAAGAAGCTATCTGTTTAGGG + Intergenic
1193525780 X:82586613-82586635 ATGAAGATCCTTTCTGAGAAAGG - Intergenic
1193772466 X:85604338-85604360 ATGAAGAAAGTATGTCAAAAAGG - Intergenic
1194037036 X:88887395-88887417 ATAAAGAAACTATTTGAGACTGG - Intergenic
1194053666 X:89104109-89104131 ATAAAAAAACTATCTGAGACTGG + Intergenic
1194517888 X:94879659-94879681 ATGCAAAAACTAACTGAAAATGG + Intergenic
1194540629 X:95166738-95166760 CTGAAGAAACCAAATGATAAGGG - Intergenic
1194704715 X:97161359-97161381 ATGATGAAACTATGTTATACTGG + Intronic
1195656327 X:107334629-107334651 ATAAAGATACTATCTGAGACTGG - Intergenic
1195822254 X:108957624-108957646 ATAAAGATACTATCTGAGACTGG - Intergenic
1195981972 X:110588683-110588705 ATGAAGAAACTATCTAAATTTGG + Intergenic
1196141458 X:112267369-112267391 GTGAAGAAAGTATTTGAGAAAGG - Intergenic
1196402636 X:115332284-115332306 ATGAAGAAACAAGCTTATAGAGG - Intergenic
1196725695 X:118893109-118893131 ATGTTGAAATTATCTGACAAGGG + Intergenic
1196965019 X:121046326-121046348 ATGAAGTAAATATCTAAAAAGGG - Intergenic
1197350785 X:125380560-125380582 TTGAGGAAACAATCTGTTAAGGG + Intergenic
1197651454 X:129069584-129069606 GCAAAGAAAATATCTGATAAAGG + Intergenic
1197723941 X:129763151-129763173 ATGGAGAAACTCTCTACTAAGGG + Intronic
1197789044 X:130232432-130232454 TAGGAGAAACTATCTGAGAAAGG + Intronic
1198262917 X:134982469-134982491 AGGAAGAAAATATTTGAAAACGG + Intergenic
1198444984 X:136704484-136704506 ATAAAGATACTATCTGAGACTGG + Intronic
1198468830 X:136927515-136927537 AAGAAGAAAATATCTGGCAATGG - Intergenic
1199061526 X:143361268-143361290 ATAAAGATACTATCTGAGACTGG + Intergenic
1199085618 X:143627016-143627038 AGGAATAAAGTAACTGATAATGG - Exonic
1199328409 X:146529414-146529436 ATTGAAAAACCATCTGATAAGGG - Intergenic
1199338186 X:146643707-146643729 ATAAAGATACTACCTGAGAATGG - Intergenic
1200817873 Y:7552721-7552743 ATGAAGCACCTATCTGATTAGGG + Intergenic
1201670438 Y:16514497-16514519 ATGAAGAAAAAATATGTTAAGGG - Intergenic
1201780093 Y:17711178-17711200 ATTAAGAAACTCACTGAAAACGG + Intergenic
1201821462 Y:18194814-18194836 ATTAAGAAACTCACTGAAAACGG - Intergenic