ID: 927841357

View in Genome Browser
Species Human (GRCh38)
Location 2:26446767-26446789
Sequence GCAATCTGTCTGTACATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927841357_927841358 -3 Left 927841357 2:26446767-26446789 CCAGGGATGTACAGACAGATTGC 0: 1
1: 0
2: 1
3: 12
4: 109
Right 927841358 2:26446787-26446809 TGCTATATTTTAAAGTCACCTGG 0: 1
1: 1
2: 1
3: 21
4: 273
927841357_927841360 12 Left 927841357 2:26446767-26446789 CCAGGGATGTACAGACAGATTGC 0: 1
1: 0
2: 1
3: 12
4: 109
Right 927841360 2:26446802-26446824 TCACCTGGAGCCAGGTGCGATGG 0: 1
1: 0
2: 6
3: 31
4: 353
927841357_927841359 4 Left 927841357 2:26446767-26446789 CCAGGGATGTACAGACAGATTGC 0: 1
1: 0
2: 1
3: 12
4: 109
Right 927841359 2:26446794-26446816 TTTTAAAGTCACCTGGAGCCAGG 0: 1
1: 0
2: 6
3: 35
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927841357 Original CRISPR GCAATCTGTCTGTACATCCC TGG (reversed) Intronic
903323754 1:22557493-22557515 GCAATTAGTCTGTGCATGCCTGG + Intergenic
908350910 1:63285985-63286007 GCAATCTGTAGGTACTGCCCTGG - Intergenic
916723423 1:167502430-167502452 ACAATCTGTCTGTACCTCTGAGG + Intronic
918674178 1:187261270-187261292 TCAATGTGACTGTACATGCCAGG - Intergenic
918751697 1:188280355-188280377 TCAGTCTCTCTGTACTTCCCTGG + Intergenic
919858720 1:201724288-201724310 GCCATCTGTCCTTCCATCCCTGG + Intronic
919994367 1:202734519-202734541 TCCATCTGTCTGTAGACCCCTGG - Intronic
1067251586 10:44591185-44591207 GCAATCTGGATGTCCATCACTGG - Intergenic
1078294775 11:10057021-10057043 GCAACAGGTCTGTACCTCCCTGG + Intronic
1081589735 11:44413214-44413236 GCAATCTGTCTGTGGTTCCTAGG - Intergenic
1082635237 11:55585949-55585971 CCAATGTATCTCTACATCCCTGG + Intergenic
1083230072 11:61311717-61311739 GCAAGCTTTCTGTACAGGCCAGG - Intronic
1085085779 11:73665800-73665822 GCAAACTGTCTGAGCAGCCCAGG + Intergenic
1085335141 11:75687787-75687809 GAGTTCTGTCTGTACACCCCTGG + Intergenic
1086839513 11:91667505-91667527 GCAACAGGTCTGTACCTCCCTGG + Intergenic
1087606612 11:100384755-100384777 GCAATAAGTCTGTACACCCTGGG + Intergenic
1088257387 11:107914044-107914066 GCAATATGTGTGTACGTACCAGG + Intronic
1088556154 11:111063367-111063389 GCAAGGTGTCTGTACATCATAGG - Intergenic
1089711549 11:120318455-120318477 GCAATCTGTCTGTATATAGAAGG - Exonic
1091697913 12:2640454-2640476 GCATTCTGTCTGAGCATCCCAGG - Intronic
1091722387 12:2822825-2822847 GATATATGTCTGTCCATCCCAGG - Exonic
1091928175 12:4372379-4372401 GCAATCTGGCTCCAGATCCCAGG - Intronic
1095835851 12:46638043-46638065 GCAACAGGTCTGTACCTCCCTGG + Intergenic
1096675265 12:53222642-53222664 CCCATCTGTGTGTGCATCCCAGG + Intronic
1096788931 12:54033408-54033430 GCCTTCTGACTGTACATCCCGGG - Exonic
1098398016 12:70042774-70042796 GCAATCTCGCTGTACTTCTCTGG - Intergenic
1100330183 12:93573817-93573839 GCAATCTGCCGGTGCCTCCCCGG - Intronic
1102432871 12:112897287-112897309 GCAATCAGGGTGTACATCTCAGG - Exonic
1102998795 12:117369515-117369537 GCAGTTTGCCAGTACATCCCAGG + Intronic
1104799792 12:131546841-131546863 GAAACCTGTCTCTAAATCCCAGG - Intergenic
1107661361 13:42643026-42643048 GAATTCTGTCTGTAAACCCCTGG + Intergenic
1112963679 13:105160145-105160167 GCAATATGCCTGTAAATCCTTGG - Intergenic
1113146804 13:107216790-107216812 GGAATCAGTCTGAACATCACAGG + Intronic
1114209383 14:20602275-20602297 GCTTTCTGACTGGACATCCCAGG - Intronic
1116944722 14:50825907-50825929 GTATTCTATCTGTATATCCCTGG - Intronic
1130030385 15:80308421-80308443 GAGCTCTGTCTGTAAATCCCTGG + Intergenic
1130779261 15:87017386-87017408 GCAACATGTCCGTACTTCCCTGG + Intronic
1133969827 16:10559493-10559515 TCATTCTGTCTGTGCAGCCCTGG + Intronic
1135343835 16:21670939-21670961 GCCATCTGTCTGTCCCTCCAAGG - Intergenic
1140978370 16:80082749-80082771 TCCATCTGTCTTTCCATCCCCGG + Intergenic
1144441395 17:15285968-15285990 GAAACCGGTCTGTACATCCAGGG - Intergenic
1147594829 17:41710229-41710251 GCAACCTCTCTGTGCCTCCCAGG + Intergenic
1150705346 17:67481820-67481842 TCAATCAGACTGTAAATCCCTGG - Intronic
1151438100 17:74110777-74110799 GTAATCTGTCTGCTCCTCCCAGG + Intergenic
1151606413 17:75139991-75140013 GCAATCTATCTCCACCTCCCAGG + Intronic
1156179290 18:34584076-34584098 GCAACCAGGCTGTACTTCCCAGG + Intronic
1157194346 18:45608594-45608616 GGAATTTGTCTGGACATCACTGG - Intronic
1157558752 18:48631500-48631522 GCTATTTGTCTTTACATCCCAGG - Intronic
1157914403 18:51650751-51650773 CCAATGTGTGTGTCCATCCCAGG + Intergenic
1158234637 18:55299973-55299995 TCCATCTTTCTGTACATCCCAGG - Intronic
1160379355 18:78439724-78439746 CCAATCTGTCTGTCCAACACAGG + Intergenic
927115612 2:19898762-19898784 GCTACCTGGCTGTACAGCCCAGG - Intronic
927841357 2:26446767-26446789 GCAATCTGTCTGTACATCCCTGG - Intronic
928911640 2:36427780-36427802 GCAATCTGTCTGTACACCAAGGG - Intronic
929414409 2:41732651-41732673 GCAATCTGTCTATATTTGCCTGG + Intergenic
934918825 2:98324476-98324498 GCAATCTGTCTGTGCATATATGG - Intergenic
935657528 2:105437922-105437944 GTAATTTGTCTTTTCATCCCAGG + Intronic
940388539 2:153103576-153103598 TCATTCACTCTGTACATCCCAGG - Intergenic
941834902 2:170005283-170005305 GCACTCTTTCTCTACATCCTAGG - Intronic
948664878 2:239528578-239528600 GCAATCTCTCTTTACCCCCCAGG - Intergenic
1173385851 20:42587308-42587330 GCAATGTGTCTGTAAATGCTGGG - Intronic
1174804975 20:53597251-53597273 GGAAACTGTGTGTAAATCCCTGG + Intronic
1176523022 21:7838841-7838863 GCAACATGTCAGTACATTCCTGG + Intergenic
1177003849 21:15646613-15646635 GCAATCTTTCTATAAATCCAAGG + Intergenic
1178657042 21:34468853-34468875 GCAACATGTCAGTACATTCCTGG + Intergenic
1182022887 22:27095983-27096005 GCAGTCTGTCATTCCATCCCTGG - Intergenic
1182488691 22:30655137-30655159 GCAAACTGTCCCTACAACCCTGG - Intronic
1184955846 22:47885472-47885494 TCCATCTGTCTGCACATGCCAGG + Intergenic
951197009 3:19835882-19835904 GCAACAGGTCTGTACCTCCCTGG + Intergenic
953732157 3:45459004-45459026 GCTTCCTGTCTGTACATCCATGG - Intronic
957277912 3:78112786-78112808 GCAATTCCTCTGTTCATCCCCGG + Intergenic
958426158 3:93980418-93980440 GCCATCAGACTGAACATCCCGGG - Exonic
959957279 3:112252901-112252923 GCAAAATGTCTGTACCTCCCTGG + Intronic
960841507 3:121963582-121963604 GCAATAGGTCTGTACCTCCCTGG + Intergenic
960932180 3:122864078-122864100 GCAATCTTTCTGTAGTTCACTGG + Intronic
961506706 3:127375045-127375067 CCAGTCTGGCTGTGCATCCCAGG + Intergenic
964014811 3:151931787-151931809 GCAATCAGTCAGTACATACTAGG + Intergenic
964883412 3:161450565-161450587 CCAATCCGTCTTTAGATCCCTGG - Intergenic
971219019 4:24688051-24688073 GCAATTTGTCGGTACAGGCCGGG + Intergenic
973686600 4:53376824-53376846 GCAATCTGGGTGTACATCAATGG + Intergenic
975022070 4:69502412-69502434 GCAACAGGTCTGTACCTCCCTGG + Intronic
977474237 4:97484881-97484903 TCAAACTGTCCCTACATCCCTGG - Intronic
978563996 4:110062710-110062732 GCAGTCTTTCTGGCCATCCCTGG + Intronic
980955617 4:139426197-139426219 CCAACCTGTCTGTCCATTCCTGG + Intergenic
983748926 4:171238643-171238665 CCAAGCTGTCTGTTCATTCCTGG - Intergenic
991301366 5:65132295-65132317 GCAACCTGTCTGTACATCACTGG - Intergenic
993018472 5:82563479-82563501 GCAACGGGTCTGTACCTCCCTGG + Intergenic
995694896 5:114867510-114867532 GCAACTTGTCAGTACACCCCTGG + Intergenic
996901908 5:128552192-128552214 GCAACATGTCTGTACCTCCCTGG + Intronic
999333965 5:150699356-150699378 GAAATGTGTCTGGAAATCCCTGG + Intronic
999932694 5:156450985-156451007 CCAATCTGTCTGCCCATCCCTGG - Intronic
1005026327 6:21466174-21466196 CCAAGCTGTCTGTACTTCCCTGG + Intergenic
1006712174 6:36083675-36083697 GAATTCTGTCTGTAAACCCCTGG - Intronic
1007681795 6:43638822-43638844 GCAAGCTGTGTGTGCATGCCTGG + Intronic
1015494424 6:133865588-133865610 GCAATAGGTCTATACCTCCCTGG - Intergenic
1016704770 6:147093942-147093964 GCAATCTATATGCACATGCCAGG + Intergenic
1017344923 6:153369621-153369643 GCAACAGGTCTGTACTTCCCTGG + Intergenic
1022057090 7:26748859-26748881 GCAATCTGAATGTAAATCCAGGG - Intronic
1024960375 7:54968249-54968271 GGAAGCTGTCAGTACAGCCCAGG + Intergenic
1029052124 7:97700338-97700360 GTAACATGTCTGTACTTCCCTGG + Intergenic
1029590958 7:101506758-101506780 GCACTCTGGCTGGAAATCCCCGG - Intronic
1030904281 7:115163045-115163067 GCAAACTGCCTGGACATCCAGGG + Intergenic
1033532130 7:142274737-142274759 CCAATATGTCTGCACCTCCCTGG - Intergenic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1042574447 8:70202434-70202456 GCAATCTATATGTACATCAATGG + Intronic
1042958417 8:74276769-74276791 CCATTCTGTCTGTAAATCCTTGG + Intronic
1044125848 8:88457337-88457359 GCAACAGGTCTGTACCTCCCTGG + Intergenic
1046986882 8:120397962-120397984 GAGATCTGTCTGTATAACCCTGG - Intronic
1051103810 9:13553882-13553904 GCTATATATCTGTACATCCCTGG + Intergenic
1053437797 9:38088337-38088359 GCCATCCGTCTGTTCATCCTTGG - Intergenic
1061407285 9:130399489-130399511 GCCGTCTGTCTGTCCACCCCAGG + Intronic
1187607842 X:20905749-20905771 GCAATCTGTTTGGGCATCCAAGG + Intergenic
1188997856 X:36907580-36907602 GCATTATGTGTGTACATACCTGG - Intergenic
1190600557 X:52088541-52088563 GCAACAGGTCTGTACTTCCCTGG - Intergenic
1191701568 X:64047890-64047912 GAAATCTGTCTGTATAACCCTGG - Intergenic
1192658347 X:73016093-73016115 GTAATCTGTCTGTATAATCCTGG + Intergenic
1192676247 X:73199681-73199703 GTAGTCTGTCAGTACACCCCAGG + Intergenic
1193176492 X:78400763-78400785 GAATTCTGTCTGTATAGCCCTGG - Intergenic
1194151253 X:90326832-90326854 GCAACAGGTCTGTACCTCCCTGG + Intergenic
1195104724 X:101593241-101593263 GCAACAGGTCTGTACCTCCCTGG - Intergenic
1196582276 X:117392291-117392313 GCAACAGGTCTGTACCTCCCTGG + Intergenic
1198889169 X:141373856-141373878 CCAATCTATCAGTAAATCCCAGG - Intergenic
1200497623 Y:3903586-3903608 GCAAGAGGTCTGTACCTCCCTGG + Intergenic