ID: 927841743

View in Genome Browser
Species Human (GRCh38)
Location 2:26449433-26449455
Sequence CTGCCCTCTGAACCTGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927841736_927841743 19 Left 927841736 2:26449391-26449413 CCACTGAGGGCAGCTGCTGCTGA 0: 1
1: 0
2: 6
3: 53
4: 356
Right 927841743 2:26449433-26449455 CTGCCCTCTGAACCTGCAGCTGG 0: 1
1: 0
2: 3
3: 31
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927841743 Original CRISPR CTGCCCTCTGAACCTGCAGC TGG Intronic
900706847 1:4086292-4086314 CAGCCCTCTGCAGCTGCAGCTGG - Intergenic
900790126 1:4674519-4674541 CTGACCTCTGAACCTAAAGCAGG - Intronic
900906530 1:5563598-5563620 CGGCCCACTGCACCAGCAGCAGG + Intergenic
901225890 1:7612811-7612833 ATGCCCTCTTAACCTGCAAAGGG - Intronic
902533145 1:17103261-17103283 CTGCCCTCTCAGCCAGCAGGAGG - Intronic
903005991 1:20299244-20299266 CTTCCCTCTTAACCTTCAGCTGG + Intronic
904497036 1:30892923-30892945 CTGGCCTCTGATCCTGCCGGGGG - Intronic
905250282 1:36643935-36643957 CTGCCCTCTGTACCCAGAGCTGG - Intergenic
905309734 1:37041099-37041121 CTCCCCTCTGGACCTGGGGCAGG - Intergenic
905868115 1:41387362-41387384 CTCCCCTGAGCACCTGCAGCAGG + Intergenic
906210128 1:44008244-44008266 CAGCGGGCTGAACCTGCAGCAGG + Intronic
906524448 1:46486052-46486074 CCGCCCTCTCAACCTCCAGGCGG - Intergenic
906637114 1:47416975-47416997 CAGCCTGGTGAACCTGCAGCCGG + Exonic
907305177 1:53509275-53509297 CTGCCCTGGTAACCTGCAGACGG + Exonic
908228267 1:62078179-62078201 CTGCCTTCTGGATCTGCAGTTGG - Intronic
912414730 1:109500152-109500174 CTGCTCTCTGAGCTTGCAGAGGG - Intronic
912491491 1:110065071-110065093 CTGCCTGCTGAGCCTCCAGCTGG + Intronic
916501281 1:165389421-165389443 GGGCCCTCTGTACCTGCAGCTGG + Intergenic
918387748 1:184027484-184027506 CTGGCCTCTGAACCTGTATTTGG + Intronic
920659432 1:207902780-207902802 CTGTCCTCAGAACTAGCAGCAGG - Intronic
922909831 1:229206180-229206202 CTGGCCTCTGCATCAGCAGCAGG + Intergenic
923036071 1:230286128-230286150 CACCCCTTTGACCCTGCAGCAGG - Intergenic
924498811 1:244616536-244616558 CTGCCATCTGATGATGCAGCAGG - Intronic
924800802 1:247328803-247328825 CAGCCCTCTGGACCAGGAGCAGG - Exonic
1065266750 10:23984212-23984234 ATGCCCTCTTAAGATGCAGCTGG - Intronic
1065998680 10:31083990-31084012 CTTCCCTCTGGACAAGCAGCTGG + Intergenic
1069844897 10:71364134-71364156 CTACCCTCTCCACCTGCTGCTGG - Intergenic
1071602203 10:86963784-86963806 CTCCCCGCTGGACCTGGAGCTGG + Intronic
1072039991 10:91597794-91597816 CTGCCCCCTGGACCTACAGCTGG - Intergenic
1073592301 10:104768889-104768911 CTGCCCTCTGTACCTCCCTCTGG - Intronic
1074134906 10:110617891-110617913 CTGGGCTCTGCACCTGCTGCTGG - Intergenic
1076853216 10:133103135-133103157 CTGCCCTCCACATCTGCAGCTGG + Intronic
1077151683 11:1075635-1075657 CTGCCCTCTGAGGGAGCAGCGGG - Intergenic
1078057098 11:8017883-8017905 CTGTCCTCTGCACCGGGAGCAGG - Intergenic
1078248888 11:9601200-9601222 CTGCCGTCTGCTCCTTCAGCAGG + Intergenic
1081428898 11:42954606-42954628 CCGCCCTTTGCTCCTGCAGCTGG - Intergenic
1083630541 11:64092942-64092964 GTGCCCTGTGACCCTGCAGAGGG + Intronic
1084445953 11:69203919-69203941 CTGCCCTCAGGACATGGAGCGGG + Intergenic
1088202825 11:107358826-107358848 GGGACCTCTGAACCTGCAGCTGG + Intronic
1088811978 11:113398160-113398182 GTGCTTTCTGAACATGCAGCTGG - Intronic
1089553427 11:119299793-119299815 TGGTCCTCTAAACCTGCAGCAGG - Exonic
1089864812 11:121622554-121622576 CTTCCCGCAGAAGCTGCAGCTGG + Intronic
1090398288 11:126433347-126433369 CTGGCCTCTGAAGATGCTGCTGG + Intronic
1094317530 12:29149590-29149612 CTGCCCCCTGAAGCTGCCCCCGG + Intronic
1095814305 12:46404758-46404780 CTGCCACGTGAACATGCAGCAGG + Intergenic
1096096648 12:48939894-48939916 CTGCCCCCAGGAGCTGCAGCAGG + Intronic
1097181729 12:57175533-57175555 CTGCCCTCTGGGCATGGAGCTGG + Exonic
1100036419 12:90257991-90258013 CTGCCCTAGGAATCAGCAGCAGG - Intergenic
1101829511 12:108246444-108246466 CTGCCCTCTGATTCTCCAGCTGG + Intronic
1105426797 13:20301591-20301613 TTGCCCTCTGGAACGGCAGCAGG + Intergenic
1106689651 13:32100830-32100852 CTGCCATGTGAAGATGCAGCGGG - Intronic
1107508953 13:41061904-41061926 CAGCCCCCTGAACCGGCCGCCGG - Intronic
1110068598 13:71143286-71143308 GTGCCCTCTGAACCTCATGCGGG + Intergenic
1110874462 13:80491149-80491171 CTGCAATCTGAAGCTCCAGCAGG + Intergenic
1112012546 13:95304023-95304045 CTCCCACCTGAACCTCCAGCTGG - Intergenic
1114074420 14:19148820-19148842 ATGCCCTCTTAACCTGAGGCAGG + Intergenic
1114087848 14:19251155-19251177 ATGCCCTCTTAACCTGAGGCAGG - Intergenic
1116888889 14:50248387-50248409 CTGCCCTCTAAGACTTCAGCTGG + Intronic
1119260163 14:73233424-73233446 CTGCCATCTGAACTTCCACCTGG + Intergenic
1119480611 14:74955589-74955611 CTCCCTTCTGAGACTGCAGCCGG + Exonic
1119894136 14:78205671-78205693 CATCCCTCTCATCCTGCAGCTGG - Intergenic
1120842437 14:89097563-89097585 CTTCCATTTGAATCTGCAGCTGG + Intergenic
1123203649 14:106691899-106691921 CGGCCCTCAGAACCTGCAGGGGG - Intergenic
1123888032 15:24747613-24747635 CTCCCCACTCAGCCTGCAGCTGG + Intergenic
1124214987 15:27798977-27798999 CAGATCTCTCAACCTGCAGCTGG - Intronic
1125454763 15:39845651-39845673 CTGCCCTTCCCACCTGCAGCAGG - Intronic
1126070482 15:44861477-44861499 CTGGACTATGAATCTGCAGCTGG + Intergenic
1126087545 15:45023639-45023661 CTGGACTATGAATCTGCAGCTGG - Intronic
1127773195 15:62246625-62246647 CTGCCCCCGGAGCCTCCAGCAGG - Intergenic
1129164748 15:73770173-73770195 CTGCCCTCTGCAGCTCCAGCTGG + Intergenic
1129460059 15:75696104-75696126 CTGCCCTCTGAGCCAGGAGAAGG + Intronic
1130562682 15:84971015-84971037 ATGGCATTTGAACCTGCAGCCGG - Intergenic
1132220741 15:100103262-100103284 CTGCACCGTGACCCTGCAGCTGG - Intronic
1132461540 16:57742-57764 CTGTCCACCGAACCTGCTGCAGG - Intergenic
1132583150 16:694423-694445 CCGCCCTCTGACCCCGCCGCAGG - Exonic
1132800178 16:1748156-1748178 CTGCCCTCGGAACCTGAGTCTGG - Intronic
1134569790 16:15281304-15281326 CTCCACTCTAGACCTGCAGCGGG - Intergenic
1134732591 16:16474744-16474766 CTCCACTCTAGACCTGCAGCGGG + Intergenic
1134934850 16:18237223-18237245 CTCCACTCTAGACCTGCAGCGGG - Intergenic
1135992416 16:27226101-27226123 CTGCACTCAGATCCTGCAGGTGG + Intronic
1136648904 16:31648620-31648642 CTGCCTTCTGAACATGCTCCAGG + Intergenic
1137479082 16:48836328-48836350 AAGCCCTCTTATCCTGCAGCAGG + Intergenic
1137674344 16:50296937-50296959 ATGGCTTCTGAACCAGCAGCTGG + Intronic
1137764614 16:50968242-50968264 CTGCCCTCTGCACCCACACCTGG - Intergenic
1138400035 16:56738201-56738223 CAGCCCTCTGACCCTGGGGCTGG - Intronic
1138702798 16:58882165-58882187 CTTCACACTGAACCTGCAGCTGG - Intergenic
1140063948 16:71594125-71594147 CTGCCCTCTAGACCTAAAGCTGG + Intergenic
1141501809 16:84449880-84449902 CTGGCCTCTAAATCTGCACCTGG + Intronic
1141713837 16:85715849-85715871 CTGCCCTGCCCACCTGCAGCTGG - Intronic
1141842654 16:86584060-86584082 CTGCCCCCTCAGCCTGCAGCAGG + Intergenic
1142170093 16:88617283-88617305 CTCCCCCCTGGACCTGCGGCTGG + Intronic
1142220844 16:88854228-88854250 CTGGCGTCTGAACCTGCAACAGG - Intronic
1142668976 17:1478708-1478730 GAGCCCGCTGAACCTGGAGCAGG - Exonic
1143513642 17:7408570-7408592 CTGCCCGCAGAACCTGCACGGGG + Exonic
1144363583 17:14520430-14520452 CTGCCCTCAACATCTGCAGCTGG + Intergenic
1146108402 17:30063673-30063695 CTGCCCTGAGCACCTGCAACTGG + Intronic
1146693694 17:34893353-34893375 ATGCCCTCTGACCCTGCACTAGG - Intergenic
1146945479 17:36870270-36870292 TTCTCCTGTGAACCTGCAGCTGG - Intergenic
1150630847 17:66879463-66879485 GGGACCTCTGAACTTGCAGCTGG - Intronic
1150867639 17:68870407-68870429 TGTCCCACTGAACCTGCAGCCGG - Intronic
1151177534 17:72301082-72301104 TGGCCCTCTGCACCTGCAGAAGG + Intergenic
1152784913 17:82242498-82242520 CTGCCCCCTGGGCCTGCTGCCGG - Intronic
1152806202 17:82357515-82357537 CTGCCCTCTCCACCCACAGCAGG + Intergenic
1152820798 17:82436798-82436820 TGGCCCTGTGACCCTGCAGCCGG + Intronic
1152933455 17:83122349-83122371 CTTGGCACTGAACCTGCAGCTGG - Intergenic
1155153805 18:23142104-23142126 ATGCCCCCAGACCCTGCAGCAGG - Intronic
1160805146 19:989393-989415 CTGCACTCAGGACCTGCAGGCGG - Intronic
1161014249 19:1975669-1975691 CTGCCCCCTGAATCAGCTGCAGG - Intronic
1161057592 19:2198440-2198462 CTGCCCTCTGGATCTGCGTCTGG + Intronic
1161252829 19:3290221-3290243 CAGCCCTCGGGACCTGCAGGTGG - Exonic
1161442156 19:4298094-4298116 CAGCCATCTCACCCTGCAGCTGG - Exonic
1161574936 19:5049889-5049911 CTGCCCTCCCAACTTGCAGGGGG + Intronic
1161839029 19:6667469-6667491 CTGCGGTAAGAACCTGCAGCGGG + Intronic
1162514913 19:11142167-11142189 CTGCCCTCTGGAGCTCGAGCAGG + Intronic
1163518057 19:17776668-17776690 CTGCCCCCAGAACCAGCAGGTGG + Exonic
1163644587 19:18481385-18481407 CTGGCCTCTTCACCTGCTGCAGG + Intronic
1165126716 19:33603278-33603300 CTGCCTTTTGCACCTGCTGCTGG + Intergenic
1165341716 19:35217088-35217110 CTGCTCTCTCATCCTCCAGCAGG - Intergenic
1165711524 19:38014438-38014460 CTGCCCCCAGAACCTTCAGCTGG - Intronic
1166368386 19:42288685-42288707 CTGCCCTCTGGGGTTGCAGCAGG - Intronic
1167149843 19:47702250-47702272 CAGCATCCTGAACCTGCAGCAGG + Exonic
1167499095 19:49835655-49835677 CTGCGCTCTGTGCCTGCAGAAGG + Intronic
1168551686 19:57301744-57301766 CTGCCCTGAGCACCTGCACCTGG - Intergenic
925005638 2:441111-441133 CTGCCATCTGAAACTGCCGGTGG - Intergenic
925317880 2:2939273-2939295 CTGCCTGCAGAACCTGGAGCGGG - Intergenic
925829438 2:7879631-7879653 CTGCACTCTGTACATGCCGCAGG + Intergenic
926914665 2:17879792-17879814 CTGTCCTCTGCCCCTGCTGCGGG - Intronic
927637550 2:24827246-24827268 CTGGCTTCTGAGCCTGCAGCAGG - Intronic
927678048 2:25121428-25121450 CTGTCCTCTGCTCCCGCAGCAGG + Intronic
927841743 2:26449433-26449455 CTGCCCTCTGAACCTGCAGCTGG + Intronic
928694607 2:33836586-33836608 CTGCCCTGTGGACCAGCAGCTGG - Intergenic
929464623 2:42133473-42133495 CTGGGCTCTGAACGTGCTGCTGG + Intergenic
929886247 2:45881187-45881209 TTGCCTTCAGAGCCTGCAGCTGG + Intronic
930107674 2:47652840-47652862 CTGCCCTCTCCACCTGTACCTGG - Intergenic
931089125 2:58866785-58866807 CAACCTTCTGAACTTGCAGCAGG - Intergenic
932104036 2:68926824-68926846 CTGGGCTCTGAACCTCCAGGAGG + Intergenic
933199741 2:79435303-79435325 CTGCACTCTGAACATTAAGCAGG - Intronic
933721183 2:85398652-85398674 CTGCCCTGGGACCCGGCAGCAGG - Intronic
933796735 2:85926068-85926090 CCGCTCTCTGCTCCTGCAGCTGG - Intergenic
935328170 2:101956663-101956685 ATGGCCTCTCAGCCTGCAGCAGG + Intergenic
935724893 2:106015217-106015239 CTGCCCCCTGAAGCTGCTCCAGG - Intergenic
938400496 2:130987112-130987134 CTGCTCCCTGGCCCTGCAGCAGG - Intronic
940855843 2:158728209-158728231 CTACCCTCTGAATCTGCTGTAGG - Intergenic
945514058 2:210740248-210740270 CGTCCTACTGAACCTGCAGCTGG - Intergenic
945940741 2:215947059-215947081 CTTCCCTTCGAACCTGCCGCAGG + Exonic
946807788 2:223489072-223489094 CTGCTATCTCAAACTGCAGCTGG - Intergenic
946864434 2:224030248-224030270 CTGCCCACTGAGAGTGCAGCAGG + Intronic
947922313 2:233888008-233888030 CTCCCCTCTGAACCTGCAACAGG - Intergenic
948382092 2:237557903-237557925 CTGCCCTCAGGCCCTGCAGATGG - Intergenic
948499251 2:238379630-238379652 CCACCGTCTAAACCTGCAGCAGG - Intronic
1170119942 20:12900861-12900883 CTGCCCTCTGTGGCTGCAGAGGG + Intergenic
1171096536 20:22337413-22337435 CTGCCCTCCGCAAATGCAGCAGG - Intergenic
1174385679 20:50187447-50187469 CTGCCCTCAGAACCTAGAGCCGG - Intergenic
1174404232 20:50293346-50293368 CTGTGCTCTGAACCAGCACCTGG + Intergenic
1175221092 20:57416888-57416910 CTGCCCTCCTAACCTGCAGCTGG + Intergenic
1175951892 20:62587997-62588019 GTGCTCTCTGGACCTGCAGCTGG + Intergenic
1176020154 20:62958629-62958651 CAGCGCTCTGAACCTGATGCCGG - Intronic
1180055588 21:45357622-45357644 CTGCCCTCAGCTCCTGCAGCTGG + Intergenic
1180290065 22:10841760-10841782 ATGCCCTCTTAACCTGAGGCAGG + Intergenic
1180492863 22:15871182-15871204 ATGCCCTCTTAACCTGAGGCAGG + Intergenic
1180661701 22:17473154-17473176 CTACTCTCTGAAGCTGCAGAGGG + Intronic
1181010349 22:20036688-20036710 CTGCCCTCCGAACCTGCAACAGG - Intronic
1181818749 22:25459397-25459419 CTCCCCTCTGGCCCTGCAGGTGG + Intergenic
1181911635 22:26242970-26242992 TTGCCCTCAGAACCTCCAGAAGG - Intronic
1181968219 22:26671361-26671383 GAGGCCTCTGAAGCTGCAGCTGG + Intergenic
1182087723 22:27573209-27573231 CTGCTCTCAGAACCTGAAGTCGG + Intergenic
1182243993 22:28940676-28940698 CTGCCCTTTGAACCTTCTGAAGG - Intronic
1182327878 22:29528004-29528026 GGACCCTCTGCACCTGCAGCTGG + Intronic
1183005607 22:34899064-34899086 CTGTCTTCTCATCCTGCAGCAGG - Intergenic
1183377543 22:37473902-37473924 CTGCCCTCTGACACTGTAGATGG - Intronic
1183714680 22:39526812-39526834 CTAAGCTCTGAGCCTGCAGCTGG + Intergenic
1184649235 22:45912152-45912174 CTGCCCACTGCAGCTGCAGAAGG + Intergenic
1185044122 22:48520473-48520495 CTGCCATCTGATTCTGCAGGTGG + Intronic
949328061 3:2889221-2889243 CTCCCCTCAGAAGCTGCATCAGG - Intronic
949877107 3:8633654-8633676 CTGGCCTCTCACCCTGCAGAGGG + Exonic
950580054 3:13856070-13856092 CTGCCCTCCCACCCTGCAGAAGG + Intronic
951728184 3:25783159-25783181 CTGCCCTCTGAAGCTCAGGCCGG + Intronic
960445137 3:117738993-117739015 CAGGGCTCTGAACCTGCAGCTGG + Intergenic
960761641 3:121078648-121078670 CAGGGCTCAGAACCTGCAGCTGG - Intronic
960761646 3:121078672-121078694 CAGGGCTCAGAACCTGCAGCGGG - Intronic
961713818 3:128845841-128845863 CTCCCAGCTGAGCCTGCAGCAGG - Intergenic
962872222 3:139507340-139507362 CTCCCCTTGGAACCTGCAGAAGG - Intergenic
964310295 3:155385151-155385173 CTGGCCTCTGAAACTCCAGAGGG - Intronic
967868493 3:194210034-194210056 CTGCCTTCTCAATCTGCAGCAGG - Intergenic
968064142 3:195748889-195748911 CAGCCCTATGCACCTGCAGCGGG + Exonic
968127450 3:196170186-196170208 CTGGCCTCTGAACCTTCTGCTGG - Intergenic
968304527 3:197640777-197640799 CTCCTCTCTGACTCTGCAGCTGG + Intergenic
968570477 4:1337927-1337949 CTGCCCTCTGGGCCTGAGGCAGG - Intronic
968614095 4:1569594-1569616 CTGCCGTCTGGCCCTGCCGCTGG - Intergenic
968795073 4:2697952-2697974 TTGCCCTCTGACCTTGCAGGTGG + Intronic
968920390 4:3519302-3519324 CTGTCCTCACCACCTGCAGCCGG - Intronic
969521029 4:7677880-7677902 CTGCCCTCTGAGCCTCTAGGAGG + Intronic
970859390 4:20684250-20684272 CTGCCTTCTGCTCCTGCAGAAGG + Intergenic
975724693 4:77280486-77280508 TTGCCCCCTGAGCCTGCAACAGG + Intronic
975999297 4:80353689-80353711 CTGCCCTCTCAACCTGCCCAGGG - Intronic
977295275 4:95202688-95202710 CTGCCCTCTTCACCTCCACCTGG - Intronic
978803263 4:112775072-112775094 CTGGCCTCTCCACCTCCAGCTGG - Intergenic
987595059 5:19987575-19987597 CTGAGCACTGAAACTGCAGCAGG - Intronic
990285506 5:54297294-54297316 CTGCCCCAGGAACCTGAAGCTGG - Intronic
991701005 5:69316496-69316518 CTTCCCACTGAACCTCCAGAAGG + Intronic
993597574 5:89878292-89878314 ATGCTATCTGAACCTGGAGCTGG - Intergenic
993971211 5:94422173-94422195 CTGCCCTTTTACCCTGAAGCAGG + Intronic
994164685 5:96596389-96596411 CTCCCCTCAGAACCTCCAGAAGG + Intronic
995658405 5:114452998-114453020 CATCTCTCTGAGCCTGCAGCTGG + Intronic
996559391 5:124812538-124812560 CTTCCCTCTGTTTCTGCAGCTGG - Intergenic
997469147 5:134107132-134107154 CTCACCTCAGAGCCTGCAGCTGG + Intergenic
997857349 5:137384060-137384082 CTGCCCTCTGAGTCCCCAGCTGG + Intronic
998191322 5:140027364-140027386 GTTCCCTCTGAAGCTGCAGTGGG - Intronic
998568973 5:143240066-143240088 CTGCCCTGTGAATCAACAGCTGG + Intergenic
999128027 5:149260956-149260978 ATGCTCTCTTTACCTGCAGCTGG - Intergenic
1001774646 5:174320099-174320121 CTTCCCTCTGTACCTGCTGCTGG + Intergenic
1002329370 5:178430953-178430975 CTGCCCTGTGCTCCTGCAGCAGG - Intronic
1002392785 5:178928850-178928872 GTGGCCTCTGCCCCTGCAGCAGG + Intronic
1003265681 6:4563443-4563465 CTGGCCTCTGATTCTGCAGCAGG + Intergenic
1003705774 6:8527019-8527041 CTGCCTTGTGATACTGCAGCTGG - Intergenic
1004000703 6:11594437-11594459 CTGGCCTCTGAACCTGCTCCTGG + Intergenic
1005452965 6:25992011-25992033 CTGCCGCCTGGATCTGCAGCTGG + Intergenic
1006202821 6:32311932-32311954 CTGCCCACTGAACCCTCAGGAGG - Intronic
1010332368 6:74638636-74638658 CTGCCCTTTGAAACTTCATCTGG + Intergenic
1011778589 6:90760943-90760965 CTGCCCTCTGAAGGTGGGGCGGG - Intergenic
1011934047 6:92753392-92753414 CTGCTGTCAGAACCTGCACCTGG - Intergenic
1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG + Exonic
1013289776 6:108709953-108709975 CCGCCCGCTGAACCTCCAGCAGG + Intergenic
1013957268 6:115855438-115855460 CTGGGCTCAGGACCTGCAGCCGG + Intergenic
1014546389 6:122741501-122741523 GCCCCATCTGAACCTGCAGCAGG + Intergenic
1015274176 6:131367320-131367342 CTGCCGACTGAACCTGGAGTAGG - Intergenic
1015982643 6:138854498-138854520 CCGCCTTCTGAACCTGGAGTAGG + Intronic
1017048875 6:150372214-150372236 CTGACCTGTGAACATGCAGTAGG - Intronic
1017398464 6:154030938-154030960 CTGCTCTCTGAACCTGCAAATGG + Intronic
1018242898 6:161795552-161795574 CTGCTTTATGAACCTGCACCAGG + Intronic
1019146890 6:169981388-169981410 CTGCTCACTGAACCTGGAGGGGG + Intergenic
1019574134 7:1728125-1728147 CTGTCCTCGCAACCTGGAGCAGG - Intronic
1019622968 7:2001567-2001589 CTGCCCTCTGTGAATGCAGCAGG - Intronic
1020017957 7:4842484-4842506 CTGCCCTCTCTGCCAGCAGCGGG - Intronic
1020192253 7:6009258-6009280 CTCCCTTCTGACCCTGCTGCGGG - Exonic
1020245472 7:6425792-6425814 CTGGGTTCTGAACCTGCACCAGG + Intronic
1020961251 7:14805470-14805492 CTGACCTTTGAACCTGCTTCTGG + Intronic
1022963616 7:35453642-35453664 CTGCCCTCAGAGGCTGAAGCTGG + Intergenic
1023911560 7:44560247-44560269 CTTCCATCAGAACCTGCAGCTGG - Intergenic
1024237058 7:47406827-47406849 TTGCTCAGTGAACCTGCAGCAGG + Intronic
1024776198 7:52789301-52789323 CAGCACCCTGAACCTGCACCTGG + Intergenic
1025085591 7:56020689-56020711 CTGCCCTCCCGCCCTGCAGCTGG - Intronic
1025605912 7:63039697-63039719 CTGCTCTCTGAACTTGGTGCTGG - Intergenic
1026745168 7:73005888-73005910 CTCCCTTCTGACCCTGCTGCGGG + Intergenic
1026760536 7:73122761-73122783 CTGCCCTCTGGAGCAGCAGGTGG + Intergenic
1026807674 7:73438090-73438112 CTGCCCTGAAAACCAGCAGCAGG - Intergenic
1027031276 7:74890558-74890580 CTCCCTTCTGACCCTGCTGCGGG + Intergenic
1027036878 7:74931582-74931604 CTGCCCTCTGGAGCAGCAGGTGG + Intergenic
1027086685 7:75269877-75269899 CTGCCCTCTGGAGCAGCAGGTGG - Intergenic
1027098574 7:75359217-75359239 CTCCCTTCTGACCCTGCTGCGGG - Intergenic
1027260110 7:76458787-76458809 CTGACTTCTGAAATTGCAGCAGG - Intergenic
1027311485 7:76956891-76956913 CTGACTTCTGAAATTGCAGCAGG - Intergenic
1027953567 7:84851247-84851269 CTGACCTCTGAAATTTCAGCTGG - Intergenic
1029399683 7:100336100-100336122 CTCCCTTCTGACCCTGCTGCTGG - Intronic
1032264115 7:130358845-130358867 CTGCCCTCTGTATGGGCAGCGGG + Intronic
1032785135 7:135194608-135194630 GCGCCCACTGAAACTGCAGCTGG + Intronic
1034759653 7:153659341-153659363 CTGTCTTCTGAACCTTTAGCTGG - Intergenic
1035396730 7:158539878-158539900 TTGCACTGTGAGCCTGCAGCTGG + Intronic
1035469950 7:159103325-159103347 CTGAGCCCTGAGCCTGCAGCAGG - Intronic
1035563490 8:626503-626525 CTCACCTTTGTACCTGCAGCAGG - Intronic
1036824882 8:11968276-11968298 CTGTCATCTGCAGCTGCAGCTGG - Intergenic
1038405641 8:27320437-27320459 CTGGCATCTGAAGCTGGAGCGGG - Intronic
1038995881 8:32922886-32922908 CAGCCCTCTGAACTACCAGCTGG + Intergenic
1040422918 8:47257517-47257539 CTGCCATGTGAAGATGCAGCAGG + Intergenic
1043087062 8:75848753-75848775 CTTCTCTGTGAGCCTGCAGCTGG + Intergenic
1043694233 8:83200718-83200740 CTGGCCTCTGACCCTGGACCAGG - Intergenic
1045272175 8:100671184-100671206 CTGCACACTCAGCCTGCAGCAGG - Intergenic
1046785427 8:118260657-118260679 CTGCCTTCTGAAACTCCTGCTGG - Intronic
1047210706 8:122837739-122837761 CTGCATTCTGTACCTCCAGCAGG - Intronic
1049172015 8:141167343-141167365 CTGCCCTCGGAACCTTCCCCTGG + Intronic
1049477004 8:142801525-142801547 CTGCCCTCTGAAACTGCCACTGG + Intergenic
1050308317 9:4328202-4328224 CTGCCCTCTGAAGCTGCAAAGGG - Intronic
1056317336 9:85402642-85402664 AAGTCCTCTGATCCTGCAGCTGG + Intergenic
1058006769 9:99924226-99924248 CTGCCCTCCGAACCTGCCAATGG - Intronic
1059332260 9:113542998-113543020 CTGCCTGCTGCACCTCCAGCTGG + Intronic
1059923126 9:119179795-119179817 CTGCCCTCTAAACCCCCAACTGG + Intronic
1060224743 9:121783973-121783995 CACCCCTCTGCCCCTGCAGCTGG + Exonic
1060461999 9:123865247-123865269 CTGAGCTTTGATCCTGCAGCAGG + Intronic
1060462631 9:123871898-123871920 CTGGCATCTTAGCCTGCAGCGGG - Intronic
1061043916 9:128154189-128154211 CTGGCCTCTGAACTTGCACGGGG - Intergenic
1062409944 9:136418536-136418558 CTGCCCTCCGTCCCTGCAGGAGG + Exonic
1185594969 X:1300674-1300696 CTGACCTCTGTGCCTGCTGCAGG - Intronic
1187273823 X:17801584-17801606 CTCCCCTCTGGTCCTGCCGCAGG - Exonic
1189909365 X:45794515-45794537 CTACCCTCTGAACCACCTGCTGG + Intergenic
1195306083 X:103585549-103585571 CTGCCCTCTGTCCCCGCGGCTGG + Exonic
1195446414 X:104957451-104957473 CCTCCCTCTGAACCCCCAGCTGG - Intronic
1200884575 Y:8254571-8254593 CTGCCATCTTACCCAGCAGCAGG + Intergenic