ID: 927843176

View in Genome Browser
Species Human (GRCh38)
Location 2:26457894-26457916
Sequence GAGCCTGCCTCCTGCTTGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 162}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927843176_927843181 -2 Left 927843176 2:26457894-26457916 CCCCGCAAGCAGGAGGCAGGCTC 0: 1
1: 0
2: 4
3: 16
4: 162
Right 927843181 2:26457915-26457937 TCGGCCCAAGGCATGAAGAGTGG 0: 1
1: 0
2: 2
3: 4
4: 98
927843176_927843184 5 Left 927843176 2:26457894-26457916 CCCCGCAAGCAGGAGGCAGGCTC 0: 1
1: 0
2: 4
3: 16
4: 162
Right 927843184 2:26457922-26457944 AAGGCATGAAGAGTGGACGCTGG 0: 1
1: 1
2: 2
3: 37
4: 295
927843176_927843187 24 Left 927843176 2:26457894-26457916 CCCCGCAAGCAGGAGGCAGGCTC 0: 1
1: 0
2: 4
3: 16
4: 162
Right 927843187 2:26457941-26457963 CTGGGCTCCTCAGGCTCCCCAGG 0: 1
1: 1
2: 6
3: 80
4: 512
927843176_927843189 26 Left 927843176 2:26457894-26457916 CCCCGCAAGCAGGAGGCAGGCTC 0: 1
1: 0
2: 4
3: 16
4: 162
Right 927843189 2:26457943-26457965 GGGCTCCTCAGGCTCCCCAGGGG 0: 1
1: 1
2: 1
3: 43
4: 341
927843176_927843188 25 Left 927843176 2:26457894-26457916 CCCCGCAAGCAGGAGGCAGGCTC 0: 1
1: 0
2: 4
3: 16
4: 162
Right 927843188 2:26457942-26457964 TGGGCTCCTCAGGCTCCCCAGGG 0: 1
1: 0
2: 4
3: 56
4: 325
927843176_927843186 15 Left 927843176 2:26457894-26457916 CCCCGCAAGCAGGAGGCAGGCTC 0: 1
1: 0
2: 4
3: 16
4: 162
Right 927843186 2:26457932-26457954 GAGTGGACGCTGGGCTCCTCAGG 0: 1
1: 0
2: 2
3: 17
4: 125
927843176_927843185 6 Left 927843176 2:26457894-26457916 CCCCGCAAGCAGGAGGCAGGCTC 0: 1
1: 0
2: 4
3: 16
4: 162
Right 927843185 2:26457923-26457945 AGGCATGAAGAGTGGACGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927843176 Original CRISPR GAGCCTGCCTCCTGCTTGCG GGG (reversed) Exonic