ID: 927843503

View in Genome Browser
Species Human (GRCh38)
Location 2:26459667-26459689
Sequence CCAGCAAATTAGGGTAGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927843503_927843510 19 Left 927843503 2:26459667-26459689 CCGGCTCTACCCTAATTTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 130
Right 927843510 2:26459709-26459731 TTCACCTCTTTGGCTTAATGTGG 0: 1
1: 0
2: 1
3: 12
4: 147
927843503_927843509 9 Left 927843503 2:26459667-26459689 CCGGCTCTACCCTAATTTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 130
Right 927843509 2:26459699-26459721 AGCAAGCTACTTCACCTCTTTGG 0: 1
1: 0
2: 13
3: 105
4: 590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927843503 Original CRISPR CCAGCAAATTAGGGTAGAGC CGG (reversed) Intronic
902846296 1:19113176-19113198 CCAGCAATTTGGGGTTGAGGGGG + Intronic
903163687 1:21506916-21506938 CCAGCAAGCCAGGGCAGAGCTGG + Intergenic
903389695 1:22955144-22955166 CCAGCAAGACAGGGGAGAGCTGG - Intronic
908402663 1:63786084-63786106 GCAGCAACTTAGGGATGAGCTGG - Intronic
911163018 1:94700507-94700529 CCTGAAGATTAGGGTAGAGGAGG - Intergenic
913119561 1:115727346-115727368 CTAGCAAATGAGGGTCGGGCAGG + Intronic
916492247 1:165312304-165312326 ACAGCAAATAGGGGCAGAGCTGG - Intronic
918013166 1:180606467-180606489 CCAGCGCATTAAGGTAGAACTGG + Intergenic
919465610 1:197919395-197919417 CCTGAAAATTAGGGAACAGCAGG + Intronic
919861548 1:201741984-201742006 CCAGCCTACTAGGGTGGAGCTGG + Intronic
921532902 1:216307334-216307356 CCAGGAAAGTAGGGGAAAGCTGG + Intronic
1063208658 10:3858351-3858373 ACAGCAAATGAGAGTTGAGCAGG - Intergenic
1065297280 10:24289198-24289220 CCTGCAAATTTGGGAAGAGCTGG + Intronic
1066090963 10:32019931-32019953 CCAGAAAATGATGTTAGAGCAGG - Exonic
1076540477 10:131211278-131211300 CCAGCAGATGAGGCTAGAACCGG + Intronic
1077632569 11:3820941-3820963 CCAGCTAATAAAGGCAGAGCTGG + Intronic
1080056402 11:27911096-27911118 CCAGTAAATTTGGGAAGTGCTGG + Intergenic
1081637505 11:44730210-44730232 CCAGCAGTTTTGGGTAGAGAGGG + Intronic
1083310090 11:61779563-61779585 CCAGCAAGGTAGGGGTGAGCAGG + Exonic
1085260177 11:75200102-75200124 ACAGCCAGTTGGGGTAGAGCTGG - Intronic
1085417251 11:76327706-76327728 ACAGCAAGTTAGTGAAGAGCTGG + Intergenic
1086423371 11:86659687-86659709 CCAGCTAAATAGGGTATGGCTGG - Intronic
1090412040 11:126515918-126515940 CCAGCAAAGGAAGGCAGAGCTGG - Intronic
1092916676 12:13195821-13195843 ACAGCAAATTTGTGGAGAGCTGG + Intergenic
1097643787 12:62212127-62212149 ACAGCAAATCAGGGAAAAGCAGG + Intronic
1098621701 12:72608888-72608910 ATTGCAAATAAGGGTAGAGCTGG - Intronic
1098689460 12:73468350-73468372 TCAACAAATTAGGGTAGGGATGG + Intergenic
1100199007 12:92278688-92278710 CCAGTAAATGTGGGTAGATCTGG + Intergenic
1102026463 12:109716577-109716599 ACAGCAGATTGGGGGAGAGCCGG + Intronic
1102032261 12:109747441-109747463 CAAGGAAATTTGGGTAGAGGGGG - Intronic
1102434283 12:112908652-112908674 CCAGGAAATTAGGAGACAGCTGG + Exonic
1102659495 12:114513641-114513663 CCAGCAAATAAGGTGGGAGCTGG - Intergenic
1105910528 13:24861312-24861334 ACAGCAAAATAGGGTAAAGATGG - Exonic
1106695305 13:32166450-32166472 TCAGGAAAGTAGCGTAGAGCTGG - Intronic
1107070206 13:36260169-36260191 GCAGCTAATAATGGTAGAGCTGG + Intronic
1109128172 13:58544842-58544864 GCAGCACATTAGTGTGGAGCAGG - Intergenic
1111418914 13:87984220-87984242 CAACCAAATTAGGGGAGATCAGG - Intergenic
1114505292 14:23207507-23207529 CCACCAAATTTGGGGAGATCAGG + Intronic
1116449148 14:45045464-45045486 GCAGCAAACTTGGATAGAGCTGG - Intronic
1124596547 15:31096440-31096462 CCAGACAATCAGGGTAGACCCGG - Intronic
1126531234 15:49713296-49713318 CCAAGAAAAGAGGGTAGAGCTGG - Intergenic
1127263161 15:57340390-57340412 CCAGCCATTAAAGGTAGAGCTGG + Intergenic
1133191130 16:4134325-4134347 CCTGCAAGTTAGGATAGAGCTGG + Intergenic
1135175227 16:20221866-20221888 TCAGCAAATAAGGATAGAGGAGG - Intergenic
1137693602 16:50446668-50446690 ACAGCAAGTTATGGCAGAGCTGG + Intergenic
1139549778 16:67666859-67666881 CCAGCAAGCGAGGGCAGAGCTGG - Exonic
1139694572 16:68664818-68664840 CCAGCTAATTTTGGTAGAGATGG + Intronic
1139893788 16:70271815-70271837 CCAGCACATTAGGGTCGTCCTGG + Exonic
1144662811 17:17082190-17082212 CCAGGAGTTTAGGGTGGAGCAGG + Intronic
1144968682 17:19093706-19093728 ACAGCAGATTGGGGTAGAGCCGG - Exonic
1144979232 17:19158360-19158382 ACAGCAGATTGGGGTAGAGCCGG + Exonic
1144988990 17:19219872-19219894 ACAGCAGATTGGGGTAGAGCCGG - Exonic
1145746900 17:27326807-27326829 ACAGCAAGTTAGTGCAGAGCTGG + Intergenic
1148795441 17:50194675-50194697 CCAGGCAATGAGGGTGGAGCGGG + Intronic
1149778630 17:59378504-59378526 CCAGCTAATTTTGGTAGAGACGG + Intronic
1150266676 17:63836828-63836850 CAAGCAAGTTGGGCTAGAGCCGG - Intronic
1157495608 18:48154990-48155012 CCACCAAATGTGGGAAGAGCTGG + Intronic
1158285639 18:55878534-55878556 CTCTCAAATTATGGTAGAGCAGG + Intergenic
1161654343 19:5504557-5504579 CCAGTAAATTGGGGCAGAGCTGG + Intergenic
1162324297 19:9989653-9989675 ACAGCAAGTTTGGGCAGAGCTGG - Intronic
925276932 2:2656780-2656802 CCAGCAATGTGGGGAAGAGCTGG - Intergenic
927843503 2:26459667-26459689 CCAGCAAATTAGGGTAGAGCCGG - Intronic
929209746 2:39342298-39342320 CCAGCTAATTTTGGTAGAGATGG + Intronic
930430580 2:51270530-51270552 CCAGCAAATGAGGGTGGGGTAGG + Intergenic
931376683 2:61714204-61714226 CCAGCAAAGTAGTTAAGAGCAGG - Intergenic
931783021 2:65596212-65596234 CCAGAAAAATAGGGAAGAGAAGG - Intergenic
932924697 2:75959296-75959318 CCAGAAAACTAGTTTAGAGCAGG + Intergenic
933811203 2:86033834-86033856 CCCCCAAATGAGGGTAGGGCTGG - Intronic
936065289 2:109326870-109326892 CCAGCAGGTGAGGGGAGAGCAGG + Intronic
940007844 2:149024822-149024844 ACCGCAAATAATGGTAGAGCAGG - Exonic
940895339 2:159076492-159076514 CCAGCACATCTGGGTAGAGGAGG - Intronic
941013748 2:160331272-160331294 GCAGGAAATTAAGGTGGAGCAGG - Intronic
948928166 2:241112919-241112941 GCAGCAATTTGGGGCAGAGCTGG + Intronic
1169539955 20:6588782-6588804 CCAGCAAATTGAGGAAGACCAGG - Intergenic
1170158741 20:13291632-13291654 CCAGTAAGTTTGAGTAGAGCTGG + Intronic
1170178236 20:13497118-13497140 CCAAAAATGTAGGGTAGAGCAGG + Intronic
1172122140 20:32604692-32604714 ACAGCAAATTAGGGCAGAGCAGG + Intronic
1173210482 20:41028453-41028475 CCAGCAATCTTGGGCAGAGCTGG - Intergenic
1173458224 20:43220865-43220887 CCAGGAAACTAGGACAGAGCTGG + Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174868051 20:54157052-54157074 CCAGCAAGTTAGAGGTGAGCTGG + Intronic
1175333877 20:58182444-58182466 CCAGTAAGTGAGGGTAGAGCTGG - Intergenic
1178102727 21:29287208-29287230 TCAGCAAATTAGGCTTGGGCAGG + Intronic
1178500387 21:33121343-33121365 CCAGCCAGTAAGTGTAGAGCTGG - Intergenic
1179912903 21:44459774-44459796 CCAGCAAATTGGGGCAGGGAGGG - Exonic
952884821 3:38005995-38006017 CCCACAAATTAGGGTAGGGCTGG - Intronic
954842742 3:53526238-53526260 CCAGGAACTTAGGGTAGAGTTGG - Intronic
955726084 3:61934494-61934516 CCAGCAATTTAGGGCTGATCTGG + Intronic
957696364 3:83643491-83643513 CCAGCAAAATAGGGTACATATGG + Intergenic
964518636 3:157540476-157540498 CTAGCAAATGAGGGAAGAACAGG + Intergenic
967604189 3:191424803-191424825 CCATCAAAATAGAGTAGAACAGG - Intergenic
972990183 4:44814710-44814732 CAAGCTAACTAGGGCAGAGCTGG - Intergenic
978880966 4:113701869-113701891 CCAGCAAATTTTTGTAGAGATGG + Intronic
981154859 4:141422955-141422977 ACATGAAATTAGGCTAGAGCAGG - Intergenic
983078959 4:163361708-163361730 CCAGCAAGTTGGGCTTGAGCAGG - Intergenic
983551888 4:169026105-169026127 CCAGCTAATTTTGGTAGAGACGG - Intergenic
984542424 4:181056149-181056171 ACAACAAATTGGGGAAGAGCAGG - Intergenic
988382406 5:30514696-30514718 CCAAAAAATTAGAGTAGAGGAGG - Intergenic
991003418 5:61805257-61805279 CCAGCATGTTAGGGCAGATCTGG - Intergenic
991450535 5:66746209-66746231 CCAGCCAATTAGGATTGAACTGG + Intronic
996504278 5:124252042-124252064 CCAGCAAATGAGGGTAGCATGGG + Intergenic
999099675 5:149012871-149012893 ACAGCTGATTGGGGTAGAGCTGG - Intronic
1003153202 6:3570139-3570161 GCAGCAGATGTGGGTAGAGCAGG - Intergenic
1004758180 6:18636389-18636411 CCAGCTAATTAAGGGAAAGCAGG + Intergenic
1008928480 6:56912128-56912150 CCAACAAATTCTGGGAGAGCAGG + Intronic
1009408953 6:63343465-63343487 GAAGCAACTAAGGGTAGAGCAGG - Intergenic
1010163917 6:72893118-72893140 GCAGAAGAGTAGGGTAGAGCTGG + Intronic
1015396827 6:132744022-132744044 CAAGCAAATGAGGCTGGAGCTGG + Exonic
1017762990 6:157585438-157585460 CCAGAAAAATTGAGTAGAGCAGG + Intronic
1018459693 6:163986086-163986108 CCAGCTAATTAGAGGCGAGCAGG + Intergenic
1018596715 6:165488805-165488827 CCAGAAAAGTGGGGTAAAGCCGG - Intronic
1019987224 7:4666477-4666499 CCAGCAAATTTTGGTAGAATTGG - Intergenic
1022632239 7:32096105-32096127 CCTCCAAAATAGGGTACAGCAGG + Intronic
1024847918 7:53671587-53671609 ACAGCATATTAGTGAAGAGCTGG - Intergenic
1027867292 7:83663881-83663903 ACATCAACTTAGAGTAGAGCAGG + Intergenic
1031925183 7:127632156-127632178 CCAGCTAAGTAGGGTAAAGCAGG - Intergenic
1033169586 7:139071785-139071807 CGAGCCAACTAGAGTAGAGCAGG - Intronic
1034553289 7:151834610-151834632 CCAGCAAGTAGGGGTAGTGCTGG - Intronic
1037064583 8:14561733-14561755 CCTGCAATTCAGGGAAGAGCTGG + Intronic
1038052635 8:23827913-23827935 TCAGCCACTCAGGGTAGAGCTGG - Intergenic
1038486019 8:27935755-27935777 CCAGCAGATAGGGGGAGAGCAGG + Intronic
1039925767 8:41930865-41930887 CCAGCACAGTAGGGCAGATCTGG - Exonic
1042902682 8:73745689-73745711 CCATTCAATTAGGGTAGACCTGG - Intronic
1043158550 8:76817030-76817052 TAAGCAAATTAGGGTAGATTAGG + Intronic
1043712928 8:83445309-83445331 CTAGCAAATTAGGGTATGGAAGG + Intergenic
1043934652 8:86129639-86129661 CCAGCTAATTTTGGTAGAGATGG - Intronic
1045818944 8:106312183-106312205 GAAGCAAAAGAGGGTAGAGCAGG - Intronic
1047122636 8:121923503-121923525 ACAGCAGATTAGGCTAGAGATGG - Intergenic
1048116506 8:131530203-131530225 TCACCATATTAGGATAGAGCTGG - Intergenic
1048593633 8:135844406-135844428 CCAGCAAGTTAGGGTAACTCAGG + Intergenic
1053432322 9:38051095-38051117 CCTGCAAACTAGGGTAGAAGTGG - Intronic
1053442394 9:38127154-38127176 CCAGCAAATCAGGGCAGCGCTGG + Intergenic
1059023253 9:110598712-110598734 CTAGCACTTTTGGGTAGAGCAGG + Intergenic
1062095290 9:134700006-134700028 CCAGCAGATTGGGCTGGAGCTGG + Exonic
1186271503 X:7893084-7893106 CCAGCTAATTAACGTAGAGATGG - Intergenic
1186707075 X:12152734-12152756 CTAGCAAATTAAGATAAAGCTGG + Intronic
1189297751 X:39930686-39930708 CCCGCAAATCAGAGTAGCGCCGG + Intergenic
1190643024 X:52498472-52498494 CTCACAAATTATGGTAGAGCTGG - Intronic
1190644649 X:52514395-52514417 CTCACAAATTATGGTAGAGCTGG + Intronic
1190954259 X:55176386-55176408 CTCACAAATTATGGTAGAGCTGG - Intronic
1192981961 X:76353756-76353778 TCAGGAAATTAGGGGAAAGCTGG - Intergenic
1194468178 X:94257876-94257898 CCAGAAAAGTAGGGAAAAGCTGG - Intergenic
1196433459 X:115652616-115652638 TCAGCATATTAGGATAGAGGGGG - Intergenic
1196889243 X:120276366-120276388 CAAGCAACTTAGCCTAGAGCTGG + Intronic