ID: 927846134 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:26473750-26473772 |
| Sequence | AGGGTGGGGCTGCCCGGAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 499 | |||
| Summary | {0: 1, 1: 0, 2: 4, 3: 44, 4: 450} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 927846123_927846134 | 16 | Left | 927846123 | 2:26473711-26473733 | CCAGGAGAGCAGAGGAGGGGCAG | 0: 1 1: 0 2: 7 3: 136 4: 921 |
||
| Right | 927846134 | 2:26473750-26473772 | AGGGTGGGGCTGCCCGGAGAAGG | 0: 1 1: 0 2: 4 3: 44 4: 450 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 927846134 | Original CRISPR | AGGGTGGGGCTGCCCGGAGA AGG | Intronic | ||