ID: 927846134

View in Genome Browser
Species Human (GRCh38)
Location 2:26473750-26473772
Sequence AGGGTGGGGCTGCCCGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 450}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927846123_927846134 16 Left 927846123 2:26473711-26473733 CCAGGAGAGCAGAGGAGGGGCAG 0: 1
1: 0
2: 7
3: 136
4: 921
Right 927846134 2:26473750-26473772 AGGGTGGGGCTGCCCGGAGAAGG 0: 1
1: 0
2: 4
3: 44
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927846134 Original CRISPR AGGGTGGGGCTGCCCGGAGA AGG Intronic