ID: 927846580

View in Genome Browser
Species Human (GRCh38)
Location 2:26475436-26475458
Sequence GATGCTGGTGTTCGACAACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927846580_927846592 28 Left 927846580 2:26475436-26475458 CCAGGTTGTCGAACACCAGCATC 0: 1
1: 0
2: 0
3: 4
4: 66
Right 927846592 2:26475487-26475509 TCAGCACCTGCAGCATGGGATGG 0: 1
1: 0
2: 2
3: 32
4: 314
927846580_927846586 -2 Left 927846580 2:26475436-26475458 CCAGGTTGTCGAACACCAGCATC 0: 1
1: 0
2: 0
3: 4
4: 66
Right 927846586 2:26475457-26475479 TCTGGTCCCAGGTGGGACACAGG 0: 1
1: 0
2: 1
3: 27
4: 239
927846580_927846590 23 Left 927846580 2:26475436-26475458 CCAGGTTGTCGAACACCAGCATC 0: 1
1: 0
2: 0
3: 4
4: 66
Right 927846590 2:26475482-26475504 CTCATTCAGCACCTGCAGCATGG 0: 1
1: 2
2: 1
3: 16
4: 244
927846580_927846583 -10 Left 927846580 2:26475436-26475458 CCAGGTTGTCGAACACCAGCATC 0: 1
1: 0
2: 0
3: 4
4: 66
Right 927846583 2:26475449-26475471 CACCAGCATCTGGTCCCAGGTGG 0: 1
1: 0
2: 2
3: 26
4: 229
927846580_927846591 24 Left 927846580 2:26475436-26475458 CCAGGTTGTCGAACACCAGCATC 0: 1
1: 0
2: 0
3: 4
4: 66
Right 927846591 2:26475483-26475505 TCATTCAGCACCTGCAGCATGGG 0: 1
1: 1
2: 2
3: 16
4: 161
927846580_927846593 29 Left 927846580 2:26475436-26475458 CCAGGTTGTCGAACACCAGCATC 0: 1
1: 0
2: 0
3: 4
4: 66
Right 927846593 2:26475488-26475510 CAGCACCTGCAGCATGGGATGGG 0: 1
1: 0
2: 4
3: 23
4: 253
927846580_927846587 -1 Left 927846580 2:26475436-26475458 CCAGGTTGTCGAACACCAGCATC 0: 1
1: 0
2: 0
3: 4
4: 66
Right 927846587 2:26475458-26475480 CTGGTCCCAGGTGGGACACAGGG 0: 1
1: 0
2: 2
3: 20
4: 295
927846580_927846594 30 Left 927846580 2:26475436-26475458 CCAGGTTGTCGAACACCAGCATC 0: 1
1: 0
2: 0
3: 4
4: 66
Right 927846594 2:26475489-26475511 AGCACCTGCAGCATGGGATGGGG 0: 1
1: 1
2: 2
3: 32
4: 277
927846580_927846584 -9 Left 927846580 2:26475436-26475458 CCAGGTTGTCGAACACCAGCATC 0: 1
1: 0
2: 0
3: 4
4: 66
Right 927846584 2:26475450-26475472 ACCAGCATCTGGTCCCAGGTGGG 0: 1
1: 0
2: 4
3: 19
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927846580 Original CRISPR GATGCTGGTGTTCGACAACC TGG (reversed) Exonic
900004973 1:39160-39182 GATGCTGGTGTTCCCTAAACAGG - Intergenic
914378944 1:147099054-147099076 GATACTGGTGATGGACAAACTGG + Intergenic
1068405522 10:56583783-56583805 CAAGCTGGTGATCAACAACCAGG + Intergenic
1073481583 10:103789272-103789294 GATGCAGGTGGTCTACATCCTGG + Intronic
1073515840 10:104074835-104074857 GGTGCTGGTGTTGGAGAAGCAGG - Intronic
1081643019 11:44770476-44770498 GATGCTGGGGTGCTACACCCAGG + Intronic
1083090534 11:60194816-60194838 GATGCTTATGTTTGACAACAAGG + Intergenic
1084683807 11:70682022-70682044 GAAACAGGAGTTCGACAACCTGG + Intronic
1084685229 11:70689947-70689969 GAAACTGGAGTTCTACAACCTGG + Intronic
1084785866 11:71441334-71441356 GATGATGGTGGGCGAGAACCAGG + Exonic
1085594149 11:77792454-77792476 GGTGCTGGTGTACGTCACCCTGG + Intronic
1085776654 11:79372605-79372627 AATGCTGGTCTGCAACAACCAGG + Intronic
1085873055 11:80373021-80373043 GATGCTAGAGTTGGACCACCTGG + Intergenic
1091378951 12:43338-43360 GATGCTGGTGTTCCCTAAACAGG - Intergenic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1101753838 12:107605788-107605810 GATGCTGGTCTTTGAGACCCAGG + Intronic
1103548320 12:121717546-121717568 GACACTGGTGTTCAACAGCCTGG - Intronic
1113397289 13:109960415-109960437 GGTGCTGCTGTTCGATAACCAGG - Intergenic
1121388518 14:93553450-93553472 GATGCAGGTCTCTGACAACCTGG - Intronic
1121518890 14:94572125-94572147 GATTCTGTTTTTCAACAACCAGG + Intronic
1125508351 15:40280148-40280170 GATGCTAGAGTTCGAGACCCGGG - Intronic
1126154138 15:45549335-45549357 GAGGCTGGTGTTGGGCAAACGGG - Intergenic
1126439368 15:48671340-48671362 GAGGCTGGTGTTCTACAGGCAGG + Intergenic
1132448536 15:101951784-101951806 GATGCTGGTGTTCCCTAAACAGG + Intergenic
1137736695 16:50729814-50729836 GATGCAGTTATTGGACAACCTGG - Exonic
1138580358 16:57937126-57937148 GAAGCTGGAGTTGGACAAGCTGG + Intronic
1140736869 16:77906363-77906385 TATGCTGGTGATGGAGAACCAGG - Intronic
1141611461 16:85183455-85183477 GAGGCTGGTGTTCCACAGCCAGG + Intronic
1146884140 17:36459689-36459711 GATGCTGGTGAGCGGCAAGCAGG - Intergenic
1154398828 18:14015645-14015667 GATGCTGGTCTTTTACAACGTGG + Intergenic
1158570839 18:58595890-58595912 GATGCTGGTGGTCCAAGACCAGG + Intronic
1164443539 19:28298490-28298512 GATGCTGGTGTTAACCAGCCTGG - Intergenic
1165706903 19:37982788-37982810 GAGGCTGGGGCTGGACAACCTGG + Intronic
925670352 2:6304104-6304126 GAGGCTGGTGATCAGCAACCCGG - Intergenic
927846580 2:26475436-26475458 GATGCTGGTGTTCGACAACCTGG - Exonic
937480229 2:122250817-122250839 GATTCTGGGGTTCTACAAGCAGG + Intergenic
1168768140 20:396201-396223 GAAGCTGGTGCTGGAGAACCTGG + Exonic
1174459997 20:50675772-50675794 TGTGCTGGTGTTCCACAGCCCGG - Intronic
1175188894 20:57198293-57198315 GATGCTGGTGTCAGAGACCCGGG - Intronic
1183133431 22:35862645-35862667 GTTGCTTGTGTACTACAACCAGG - Intronic
1184571498 22:45327883-45327905 GATGGAGGTGTTTGACGACCTGG + Exonic
1185117920 22:48948714-48948736 GATGCCGGTGTTAGATACCCAGG + Intergenic
953052598 3:39359345-39359367 GATACTGGTGTTCTCAAACCTGG + Intergenic
961559360 3:127718068-127718090 GATGCTGGTTTTCAACAAGCTGG - Intronic
966142735 3:176774143-176774165 GGTGCTGGTGCTGGAAAACCTGG + Intergenic
966882504 3:184358273-184358295 GATGCTGGTGTTCAAGCCCCGGG + Exonic
971233418 4:24819296-24819318 GACCCTGGAGTTGGACAACCTGG - Intronic
984136606 4:175948434-175948456 GATGCTGGGGGTCCAAAACCAGG - Intronic
986136590 5:4985562-4985584 GATGCTGGAGTTGGACACCAGGG - Intergenic
987915944 5:24214703-24214725 GTTCCTGGTGCTCAACAACCTGG + Intergenic
991243853 5:64488892-64488914 GATCCTGGTGTTCAGCAGCCAGG - Intergenic
992460881 5:76958781-76958803 GATGCTGGTGTGGAACTACCAGG - Exonic
993711201 5:91227155-91227177 TATGCTGGTGATCCTCAACCTGG + Intergenic
995731423 5:115246558-115246580 GATGGTGCTGTTTGATAACCTGG - Intronic
996121705 5:119680656-119680678 GATGAAGGTCTTCCACAACCAGG + Intergenic
996817088 5:127586441-127586463 GATGCTGGAGTCCCACAATCTGG - Intergenic
1002393273 5:178933255-178933277 GATGCTCTTGTTCCACAATCTGG + Intergenic
1003117389 6:3292428-3292450 GATGCCAGTGTCCCACAACCTGG - Intronic
1006742331 6:36318235-36318257 TTTGCTGGTGTTGGACAAACAGG - Intronic
1008884279 6:56414922-56414944 AATGCTGGTGATGGACAGCCTGG + Intergenic
1017296474 6:152801459-152801481 GATTCTGGTGATAGACTACCTGG - Intergenic
1018028340 6:159822691-159822713 GATGTTGGTGTTCAAGGACCTGG + Intergenic
1020914389 7:14174216-14174238 GATGCTGGAGTCAGACTACCTGG + Intronic
1030837788 7:114310668-114310690 GTTGTTGTTGTTGGACAACCTGG + Intronic
1043305129 8:78784269-78784291 GAAGCTGGTAGTCCACAACCTGG + Intronic
1045856361 8:106769769-106769791 GATGCTGGTGTGCTTGAACCTGG - Exonic
1046593924 8:116238196-116238218 TAAGCTGGTGTACTACAACCTGG + Intergenic
1060550609 9:124483191-124483213 GATGGTGGTGTTTGTCAACCAGG - Intronic
1060882720 9:127129638-127129660 GGTGCTGGTGCTGGACAACAGGG + Intronic
1186225864 X:7398313-7398335 CATGGTGGTGTTTGAAAACCAGG - Intergenic
1201345318 Y:12976967-12976989 GATGCTGCTGTTGGAGAGCCAGG - Intergenic