ID: 927846621

View in Genome Browser
Species Human (GRCh38)
Location 2:26475631-26475653
Sequence TTAAAATCAAGGCTAATATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927846618_927846621 20 Left 927846618 2:26475588-26475610 CCTGGGGGCAGGAGTGACAGGTG 0: 1
1: 0
2: 5
3: 39
4: 426
Right 927846621 2:26475631-26475653 TTAAAATCAAGGCTAATATGAGG 0: 1
1: 0
2: 3
3: 27
4: 234
927846616_927846621 28 Left 927846616 2:26475580-26475602 CCACGGAACCTGGGGGCAGGAGT 0: 1
1: 0
2: 1
3: 15
4: 205
Right 927846621 2:26475631-26475653 TTAAAATCAAGGCTAATATGAGG 0: 1
1: 0
2: 3
3: 27
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927846621 Original CRISPR TTAAAATCAAGGCTAATATG AGG Intronic
904264064 1:29307679-29307701 TTCAAATTAAGGCTAAATTGAGG - Intronic
904478447 1:30779151-30779173 TTCAAACAAAGGCTAATGTGTGG - Intergenic
906298789 1:44666159-44666181 TCAAAATCAAAGCCACTATGAGG + Intronic
908606579 1:65804293-65804315 TGAAGATCAATGCTAATGTGTGG + Intronic
908720170 1:67117014-67117036 TTACAATCTAGGATAAGATGGGG - Intronic
908767661 1:67569028-67569050 TTAAACCCAAGGCTGATATTTGG - Intergenic
909209556 1:72806784-72806806 TTAAAATCAAGGCAAAATTCTGG - Intergenic
909539865 1:76779352-76779374 TTGCAATCAAGGCTATTATTTGG + Intergenic
910487779 1:87734305-87734327 TTAAAATAAATTCTAATATTAGG - Intergenic
910488290 1:87740121-87740143 ATAAAATCAAGGCTGTTATGAGG - Intergenic
910601602 1:89038610-89038632 TTAGAAACAAGTCTATTATGGGG - Intergenic
910704169 1:90109069-90109091 TTAAAAAGAAGGCTATTATGAGG - Intergenic
911437445 1:97879335-97879357 TTAAAAACAAGTCTAATAATTGG + Intronic
913322812 1:117601132-117601154 TAAGAATCAAGACTGATATGAGG + Intergenic
913371657 1:118106380-118106402 TCAAACTCAAAGCTAATATGTGG + Intronic
916444987 1:164863983-164864005 TTAAAAGCAGGGATAATAAGAGG + Intronic
917249238 1:173039230-173039252 TTAAAATGCAGACTACTATGTGG + Intergenic
920610467 1:207431553-207431575 TTAAAATATAAGCTAATATTAGG - Intergenic
922097034 1:222451287-222451309 TTAAAACTAAGTCTAACATGAGG + Intergenic
923584707 1:235257781-235257803 TTGAAATAAAGGATGATATGTGG - Intronic
1065407403 10:25384727-25384749 CTAAAATGAAAGCTAAGATGAGG - Intronic
1066162745 10:32751592-32751614 TTAAAATGAAAGCCAATATATGG - Intronic
1068214600 10:53967590-53967612 TTAAAATAAAAGCAAATATTTGG - Intronic
1070886062 10:79900699-79900721 ATAAAATGATGGCTAAAATGAGG - Intergenic
1071743045 10:88384095-88384117 TCAAAATCAAGGATATTATGTGG - Intronic
1074167985 10:110902969-110902991 TTCAATTCAAGGCTAATCAGGGG - Intronic
1074515198 10:114160870-114160892 TTTAAATCAAGGTTAATTTTTGG - Intronic
1075471863 10:122697145-122697167 TTAAGATCAAGGCTCATAACTGG - Intergenic
1076428791 10:130387351-130387373 TTAACATGTAAGCTAATATGAGG + Intergenic
1076551994 10:131286452-131286474 TTACAAATAAGGCTAGTATGCGG - Intronic
1079503705 11:21131176-21131198 TGAAAATCATCTCTAATATGAGG + Intronic
1079667370 11:23122833-23122855 CTAAAATGAAGGCTCATTTGAGG - Intergenic
1079709969 11:23669830-23669852 TTAAAGTCAAGGCAAGGATGAGG - Intergenic
1079986468 11:27205446-27205468 TAAAATTCAAGCCTAATATTTGG + Intergenic
1081257761 11:40918269-40918291 TTTAAAGTAATGCTAATATGTGG + Intronic
1083645266 11:64168478-64168500 TTAAAATCAAGGGGAACACGAGG + Intergenic
1084646046 11:70458733-70458755 TTAAAAACAATGCTATTTTGAGG - Intergenic
1086622810 11:88908082-88908104 TTAAAATGAGGGAAAATATGAGG + Intronic
1087838502 11:102898408-102898430 TTCAAAACATGGCTTATATGAGG + Intergenic
1087844537 11:102957680-102957702 ATGAAATGAAGGCTAAAATGAGG + Intergenic
1087978221 11:104576786-104576808 TGAAAATAAAGGCTAATAACAGG - Intergenic
1090219769 11:125009244-125009266 TTATAATGAAATCTAATATGAGG + Intronic
1090464802 11:126924593-126924615 TTTAAATCAAGACTACTCTGGGG - Intronic
1095169085 12:39012073-39012095 TTCCAATCAAGGCAAAAATGAGG + Intergenic
1095461392 12:42447985-42448007 ATAAAATCACTGCTCATATGAGG - Intronic
1098811042 12:75092856-75092878 TGAAAATTAAGCCTAATATGTGG + Intronic
1100703172 12:97169819-97169841 TGAAAATCAGAGATAATATGTGG + Intergenic
1101183167 12:102242084-102242106 TTAAAATGAAGGATAAGAGGAGG - Intergenic
1102322090 12:111944911-111944933 TTAAAAGCAAGCCTAATTAGTGG + Intronic
1102436388 12:112927359-112927381 TTAGAATCAATGCTAATTTCAGG - Intronic
1102481190 12:113224694-113224716 TTAAAATAATAGTTAATATGCGG - Intronic
1103276893 12:119719300-119719322 TTAAAAGGAATGCTAAAATGAGG + Intronic
1103279145 12:119740635-119740657 TTAAAATCCAAGCTTATATAAGG + Intronic
1103982932 12:124748436-124748458 GTAAAATCAAGACTCATCTGTGG - Intergenic
1104615638 12:130266114-130266136 TCAAAATCACGGGTAACATGAGG - Intergenic
1106278680 13:28241844-28241866 TTAATAACAAGGCCAATATCTGG - Intronic
1107384928 13:39897940-39897962 TTAGAAACAAGGCTGAAATGTGG - Intergenic
1110385012 13:74900273-74900295 CAAAAAGCAAGGCTAATATATGG + Intergenic
1110601071 13:77374815-77374837 TGAAAAACAAGGCTAATTTGGGG - Intergenic
1111453205 13:88446408-88446430 TTAAAAACAACTATAATATGGGG + Intergenic
1112647202 13:101347768-101347790 TTAAAAGCAAAGCTCATGTGAGG + Intronic
1112736612 13:102427631-102427653 TTAAAAATTAGACTAATATGTGG + Intergenic
1113681260 13:112246651-112246673 TTAACATCAAGGCTGATGAGTGG + Intergenic
1114860960 14:26521124-26521146 TGAAAATCAATGCTCATTTGAGG + Intronic
1115783633 14:36799647-36799669 TTAAAATAGAGGTTAATATCTGG + Intronic
1116472252 14:45299063-45299085 TAAAAATCAAGCCTAATATCTGG + Intergenic
1118534298 14:66742536-66742558 TAAAAATCAATTCTACTATGGGG - Intronic
1119174347 14:72558179-72558201 TCAAAATCCAGGCTATTATGGGG - Intronic
1119683448 14:76610878-76610900 TTAAAATCATTGCTAAAATGAGG + Intergenic
1119982861 14:79101788-79101810 TTAAAATGGAAGCTAAGATGGGG + Intronic
1120034772 14:79684315-79684337 TTAGAAACAAGCCTAATATGCGG + Intronic
1120466757 14:84868172-84868194 TTAAAGTTATGACTAATATGTGG - Intergenic
1120566674 14:86068016-86068038 TTAAAATCAAGCACAATATGCGG - Intergenic
1125711829 15:41793184-41793206 TTAATAAGAACGCTAATATGTGG + Intronic
1125885652 15:43227348-43227370 TTAAAATACTGGCTAATATGGGG + Intergenic
1127701570 15:61506374-61506396 TTAAAATAAAGACTAATGTGGGG - Intergenic
1128662162 15:69509650-69509672 TAAAAATCAAGTCTTTTATGGGG + Intergenic
1130795704 15:87207197-87207219 ATAAGATCAAGGCTAATAACAGG + Intergenic
1131464021 15:92640252-92640274 TTAAAGTCAAGGTAAATAGGCGG + Intronic
1133669152 16:8000515-8000537 CTAAAATAAAGACTAAGATGAGG + Intergenic
1135725100 16:24848177-24848199 ATAAAATGAATGCTAGTATGTGG + Intronic
1138573995 16:57895139-57895161 TTAGAATGAATTCTAATATGTGG + Intronic
1140645443 16:77024682-77024704 TAAAAATCCATTCTAATATGTGG + Intergenic
1143851005 17:9812017-9812039 TTCAAAGCAAGGCTAAGGTGGGG - Intronic
1144189314 17:12829514-12829536 TTAAAATCCAGGTTTAAATGAGG - Intronic
1145201940 17:20953450-20953472 CTAAAATAAAGGCTAATATGTGG + Intergenic
1146768059 17:35542078-35542100 TTTAAATAAAGCATAATATGTGG - Intergenic
1147864528 17:43544080-43544102 TTAAAATAAACCCTAAGATGGGG + Intronic
1151069583 17:71193321-71193343 TTATAATACAGGTTAATATGGGG + Intergenic
1155328302 18:24688506-24688528 TTAAAATAAAGACTAACACGAGG + Intergenic
1155849274 18:30750668-30750690 TTGAAATCCAGGCTAAGATAAGG + Intergenic
1156422122 18:36965857-36965879 ATAAAATCTAGGCTTATAAGTGG - Intronic
1156851167 18:41728151-41728173 TAAAAATCAATGCTAAGATAAGG - Intergenic
1158068283 18:53439728-53439750 GTAGAATCAAAGCTAATATGTGG + Intronic
1158304999 18:56095551-56095573 TAAAATTCAATCCTAATATGGGG + Intergenic
1164836776 19:31360131-31360153 TGAAAATAAAGGCTTATATTTGG + Intergenic
1167997667 19:53419564-53419586 TTAAAAGAAAGTCTAATATCCGG + Intronic
924971306 2:129828-129850 TTTAAATCAAGGCTAACTTCCGG - Intergenic
925519333 2:4724399-4724421 CTAAAATCATGGGTAATATTAGG - Intergenic
925538549 2:4941555-4941577 TAAAAATAAATGCTAATATCCGG - Intergenic
927846621 2:26475631-26475653 TTAAAATCAAGGCTAATATGAGG + Intronic
927847346 2:26478378-26478400 AAAAAATCAAGGCTAATATGAGG - Intronic
930331046 2:49984311-49984333 CTAGAATGAAGGCTAAAATGTGG - Intronic
932020194 2:68076927-68076949 TAAAAAAAAAGGTTAATATGTGG - Intronic
932362651 2:71121806-71121828 ATAAAATAAAGGCTAATATTAGG + Intronic
932682592 2:73838672-73838694 TTAACAGCAAGACTGATATGGGG + Intronic
932725646 2:74178134-74178156 TTAAAATCAAAGCCAGTAAGTGG + Intronic
933232787 2:79828716-79828738 TGAAAACCAGAGCTAATATGTGG - Intronic
936961108 2:118075651-118075673 GTAAAATCATTGCTGATATGTGG + Intergenic
938753557 2:134359073-134359095 TTAAAATCATTGCTAATGTTTGG + Intronic
939554290 2:143655579-143655601 CTAAAATCAACTCTACTATGGGG - Intronic
941016129 2:160359189-160359211 TTAAATTAGAGGCTAATATAAGG - Intronic
941134315 2:161695262-161695284 TTAAAATCAATGCTAATTATAGG - Intronic
941159544 2:162020651-162020673 TTACCATCAAGGGTAAAATGAGG + Exonic
942058440 2:172206475-172206497 TCAAAATCAAGGCAGATTTGGGG + Intergenic
943011611 2:182456406-182456428 ATAAAATTTAGGCTAATAAGGGG - Intronic
943315502 2:186382455-186382477 TTAAAAGCAAAACAAATATGGGG + Intergenic
943476304 2:188360861-188360883 TTAAAATCAAGACTGTTATTTGG - Intronic
943919535 2:193686198-193686220 TTAAAATTAAGGCTAAATTGTGG + Intergenic
945247710 2:207735130-207735152 TAAAAATTAAGACTAAAATGGGG - Intronic
945911216 2:215651591-215651613 TTAAAATCAGGGATAATTTCAGG - Intergenic
946996132 2:225394082-225394104 TTAAAATAAAATCTAAAATGTGG + Intergenic
948202247 2:236137521-236137543 TTAAAATCAAGTTTAATCTCAGG - Intergenic
948404976 2:237710584-237710606 TTTAAATCAATTCTAATATGGGG - Intronic
1170065941 20:12310912-12310934 TTAACATCAAGACCCATATGTGG + Intergenic
1170861698 20:20110485-20110507 TAAAAATCAAGATTAATATCTGG + Intronic
1174104096 20:48149793-48149815 GTAAAATCCAGGCTTTTATGTGG + Intergenic
1174331587 20:49823762-49823784 GTAAGTTCAAGGCTAAAATGTGG + Intronic
1174924722 20:54746460-54746482 TTAAAATCAAGGATTTTATATGG + Intergenic
1177774565 21:25553647-25553669 TTAGAATTAAGGTTAAAATGAGG + Intergenic
1183855584 22:40631736-40631758 TTCACATGGAGGCTAATATGTGG - Intronic
950168650 3:10820645-10820667 TAAAACTCAATGCTAATAGGAGG - Intronic
952052149 3:29397436-29397458 TTAAAACCAAGGCCAATTTGGGG - Intronic
956469082 3:69546366-69546388 TTAAAACCAAGGTTAAAAGGAGG + Intergenic
956495490 3:69821629-69821651 TAACCATCAAGGCTAATATTAGG + Intronic
956503776 3:69915202-69915224 TTACAATCAAATGTAATATGTGG - Intronic
956856444 3:73279816-73279838 ACAAAATCAAGGATACTATGTGG + Intergenic
958130147 3:89408342-89408364 CTAAAATAAAGGGTAATCTGTGG + Intronic
959795219 3:110419025-110419047 TTAACATCAAGGCTAAAACAGGG + Intergenic
963382037 3:144542598-144542620 TTGAAATCAAGGCTTATTTAAGG + Intergenic
970271169 4:14349305-14349327 TTAAAATCATGGCCAAAATATGG - Intergenic
970394386 4:15651398-15651420 TTTAAATGAAGGATAATATTTGG + Intronic
972060888 4:34871836-34871858 ATAAAATCAAGCTTAATAAGGGG + Intergenic
972190176 4:36581608-36581630 TTAAAAACAAGGAAAATCTGAGG + Intergenic
972337400 4:38119702-38119724 TGAAAATCATAGCTAAAATGTGG - Intronic
974306467 4:60148900-60148922 ATTAAATCAAAGCTACTATGTGG - Intergenic
974348990 4:60720500-60720522 TTAAAATTCTGGCTAATATGTGG - Intergenic
974713071 4:65628487-65628509 ATAATCTCAAGGCTAATATCAGG - Intronic
976432529 4:84979426-84979448 TAAAAATCATGTTTAATATGGGG + Intergenic
976654080 4:87469074-87469096 TTAAAATCAAATCTACAATGAGG + Intergenic
977078125 4:92484824-92484846 TTAAGATCAAAGCTAAAAAGTGG - Intronic
977208072 4:94186078-94186100 TAAAAATCAAGACTAAGCTGAGG - Intergenic
977431974 4:96941075-96941097 TTAAAATAAATGCTATGATGGGG - Intergenic
978559190 4:110013793-110013815 TAGAAATCAAGGCTAATAGTTGG - Intergenic
978819439 4:112948804-112948826 CTAAAAACAAGGAGAATATGGGG - Intronic
979912355 4:126383336-126383358 TTAAAATGAAGTAAAATATGAGG - Intergenic
980294810 4:130898483-130898505 TTGAAATCAAGTCTTATATAAGG + Intergenic
980317921 4:131228979-131229001 TTAAAACTACGGTTAATATGTGG - Intergenic
980809920 4:137864044-137864066 TGAAAACCAAAGCAAATATGAGG + Intergenic
981171341 4:141627121-141627143 TTATTATCAAGGCTAATTTAGGG - Intergenic
981281058 4:142959131-142959153 TTAAAATCTAGGCTTACATGGGG + Intergenic
981410988 4:144431630-144431652 TTATAATTAAAGCAAATATGTGG - Intergenic
982958220 4:161798998-161799020 TTAATATCAAACCTAATATAGGG - Intronic
983253880 4:165377168-165377190 GTAAAATCATGCCTACTATGTGG - Intronic
983294663 4:165850883-165850905 TTAAACTTAAGGCTAATATGAGG - Intergenic
983816167 4:172129364-172129386 TTAAAATCAATGCCATCATGGGG - Intronic
984383255 4:179022435-179022457 TTAAATTCCAGTCTAATATTTGG + Intergenic
984557368 4:181230786-181230808 TTACAATGATGGGTAATATGAGG + Intergenic
986825318 5:11514294-11514316 TTAAAATAAAGCCTAATACCTGG + Intronic
986978113 5:13415993-13416015 TTTATATCAAGACTAATAGGAGG - Intergenic
987590076 5:19913176-19913198 TTATAATCATGACTAATATGAGG - Intronic
988897431 5:35692915-35692937 GTAAAATCGAGGATATTATGTGG + Intronic
988989217 5:36653058-36653080 TCAATCTCAAGGCAAATATGAGG - Intronic
989433060 5:41377788-41377810 TTAAAATCATGCCTAATATTTGG - Intronic
989536948 5:42574899-42574921 TGAAATTCCAGGCTAAAATGAGG + Intronic
990887731 5:60614191-60614213 ATAAAATCAAGGCTCAGATGGGG - Intronic
993201313 5:84818523-84818545 CCAAAATCAAGTCAAATATGTGG - Intergenic
993880375 5:93353598-93353620 TTAAAATCAAGGCAAGAATAAGG + Intergenic
994074366 5:95634318-95634340 TTGAGATGAAGGCTAATCTGGGG - Intergenic
996476399 5:123927209-123927231 TAATAATAAAGGCTAATAAGAGG - Intergenic
996673367 5:126145978-126146000 TTAAAATTAAACATAATATGAGG + Intergenic
997042501 5:130274916-130274938 TTAGAATCAAGGAAAACATGTGG + Intergenic
1000765327 5:165282340-165282362 GGAAAATCAAGACTGATATGTGG + Intergenic
1004657984 6:17683203-17683225 TTCAAGTCAAGGCTAATTTGGGG - Intronic
1004687971 6:17965873-17965895 ATAAAAGTAAGGCTAAAATGGGG + Intronic
1008004228 6:46393064-46393086 TTAAAAGTAAGGCCAATATTAGG - Intronic
1008502683 6:52199370-52199392 TTAAAATAAAAGCTGATGTGGGG - Intergenic
1010576728 6:77540933-77540955 TTAAAAAAAAGGATAATATATGG + Intergenic
1010932723 6:81821825-81821847 TTCTTATCCAGGCTAATATGAGG - Intergenic
1011107078 6:83794218-83794240 TTAAAATAAAGGCAAGTATTTGG + Intergenic
1012151228 6:95757197-95757219 TGACATCCAAGGCTAATATGGGG + Intergenic
1013489243 6:110629246-110629268 TGAAATTATAGGCTAATATGAGG - Intronic
1014050654 6:116949824-116949846 TTAAAAACAAGGCAAGTATTCGG - Intergenic
1014719504 6:124898848-124898870 CTAAAATCATGGCTAATAATGGG - Intergenic
1015579991 6:134713853-134713875 TAAAAATCAAGGCTAAAATAAGG - Intergenic
1015656179 6:135521805-135521827 TTAAAATGAATGGTAATAGGAGG - Intergenic
1015851934 6:137583289-137583311 TTAAAAGCTAGGCAAATATAGGG + Intergenic
1017578208 6:155830323-155830345 TAAAAATAAACACTAATATGTGG - Intergenic
1017663962 6:156701066-156701088 TAAAAATCAAGACAAATCTGAGG + Intergenic
1021245327 7:18254579-18254601 GTAAAATCAAGGTTTATCTGAGG + Intronic
1023674944 7:42619191-42619213 TTAAAATCAAGACTAAGGTTTGG - Intergenic
1023963542 7:44948282-44948304 TTAGAATTAATGCTAATTTGGGG - Intergenic
1024284896 7:47748564-47748586 TTGAAATAAAGACTAAGATGAGG + Intronic
1024850440 7:53709041-53709063 TTAATATAAATGCTAGTATGAGG - Intergenic
1026574189 7:71558213-71558235 GCAAAATCAAGGATATTATGTGG + Intronic
1027817416 7:82994302-82994324 TTAAAATTATGGATAATATTAGG + Intronic
1028089194 7:86676613-86676635 TTAAAAGAGAGGCTAATATCGGG - Intronic
1028117281 7:87013368-87013390 TTAAACTCAAGTTTAGTATGAGG - Intronic
1029380510 7:100211383-100211405 TAAAAATCAAGGGTAAGAAGAGG - Intronic
1030320110 7:108157658-108157680 CTAAAATCAAGGTTGATATTTGG - Intronic
1031262325 7:119536597-119536619 GTAAAAGCAAGGTTAATGTGAGG - Intergenic
1032380653 7:131476662-131476684 TTAAAATAAAGGCCAATTTGGGG - Intronic
1033974509 7:147083205-147083227 GTAAAATCAAGGCTTGTCTGAGG + Intronic
1034394787 7:150814012-150814034 TAAAACCCAAGGCTAATGTGAGG + Intergenic
1035038480 7:155910677-155910699 TAAATATCAATGCTATTATGGGG + Intergenic
1035520074 8:268537-268559 CTAAAAGCAAAGATAATATGAGG - Intergenic
1035645658 8:1216863-1216885 TACAAATCAAGGTAAATATGAGG + Intergenic
1037286472 8:17306552-17306574 TTAAAATCAATACAAATTTGAGG - Intronic
1038607464 8:29022856-29022878 TTAAAATCAGGGAAAAAATGGGG + Intronic
1038750483 8:30290669-30290691 TTAAAAACAAGACATATATGTGG - Intergenic
1039220854 8:35328805-35328827 TTCATCTCAACGCTAATATGTGG - Intronic
1039392459 8:37192527-37192549 TTAAAATAAAAGTTAAAATGAGG + Intergenic
1040730418 8:50439997-50440019 TTAAAAACTAGGTTAAAATGTGG - Intronic
1040851940 8:51909905-51909927 TTAAAATTAAAGTTAAAATGAGG - Intergenic
1042573302 8:70190929-70190951 TAAAAATCAAGGATCATTTGTGG + Intronic
1042702777 8:71634960-71634982 TTAAAATGTAGGCAAAAATGCGG - Intergenic
1043498738 8:80831871-80831893 TTTAAATCAATCCTAATGTGGGG - Intronic
1045071537 8:98510417-98510439 TGAAAATGAAGGCAAATATATGG - Intronic
1045955113 8:107896892-107896914 TTAAAATCAGGATTAAAATGAGG + Intergenic
1046249737 8:111613518-111613540 TTAAATTAAAGCCCAATATGGGG - Intergenic
1046407597 8:113794246-113794268 TTAAAATCAATTATAATATAAGG - Intergenic
1047106778 8:121740205-121740227 TTAAAATGAACTCTAAAATGTGG + Intergenic
1047243706 8:123119134-123119156 TAAAAATCATTGATAATATGCGG + Intronic
1048445241 8:134488307-134488329 TAGAAAACAAGGCTAACATGGGG + Intronic
1048499733 8:134964716-134964738 TTAAGGACAAGGCCAATATGAGG + Intergenic
1050379456 9:5011598-5011620 TTAAAATAAATTCTAATATTTGG + Intronic
1050589018 9:7143378-7143400 TTCAAATGAAGACTAATATCTGG + Intergenic
1051652177 9:19338944-19338966 TTAAAATCAAAACTAAGATCAGG - Intronic
1052371020 9:27664446-27664468 TAAAAATCAAGCATAATGTGAGG - Intergenic
1052499314 9:29269325-29269347 TGTAAATCAAGACTACTATGAGG + Intergenic
1052528180 9:29648674-29648696 ATAATATAAATGCTAATATGAGG - Intergenic
1057369423 9:94456826-94456848 TTAAAATTAAGACTGCTATGTGG + Intronic
1057485546 9:95480193-95480215 TTAATAGCAAGGCTAATGGGAGG + Intronic
1058312532 9:103522176-103522198 GAAAAATCAAGGCTAAAAGGCGG - Intergenic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1186578428 X:10791062-10791084 TTAAAAGCAATGTTAATATAAGG + Intronic
1186949167 X:14603669-14603691 ATAAAAACAAAGATAATATGTGG + Intronic
1187513746 X:19946306-19946328 TTAAAGGAAAGGCTAGTATGAGG + Intronic
1189175349 X:38951552-38951574 TTAAAATCAAGGTTATTTTAGGG - Intergenic
1189469516 X:41302805-41302827 TTAAAATGAAAGGTTATATGGGG - Intergenic
1189528814 X:41856872-41856894 TGAAAAGCAAGGGTATTATGTGG + Intronic
1190619937 X:52276786-52276808 TTACTATGATGGCTAATATGAGG + Intergenic
1194425873 X:93737771-93737793 TTACATTCAAGTTTAATATGTGG + Intergenic
1194734932 X:97500977-97500999 TTAAAAAGATGGCTAATATATGG + Intronic
1195420314 X:104668032-104668054 TTAAAATAAGAGCAAATATGTGG + Intronic
1195644799 X:107217774-107217796 TTAAAATAATGGCTAAAATGAGG + Intronic
1195949855 X:110258359-110258381 TTAACCTCATGGCTAAAATGAGG + Intronic
1196671711 X:118375280-118375302 TTAAAATTAAGCCCCATATGAGG - Intronic
1197187953 X:123609191-123609213 TTAAAAGAAAGGTTAAAATGAGG + Intronic
1197255200 X:124255673-124255695 ATAAAATCAAGGCATATGTGTGG - Intronic
1197407825 X:126074702-126074724 ATAAAATGAAGGCCAATATATGG - Intergenic
1199246219 X:145607498-145607520 TTAAAATCAAAACTACAATGAGG + Intergenic
1200927060 Y:8664144-8664166 GAAAAATCAAGGCTCATCTGAGG - Intergenic
1200960937 Y:8995387-8995409 TTAAAATGAAAGCTACTCTGTGG - Intergenic
1200972827 Y:9175090-9175112 TTAAAATAAAGACAAAAATGAGG + Intergenic