ID: 927847060

View in Genome Browser
Species Human (GRCh38)
Location 2:26477104-26477126
Sequence TCTGGGGCCCCTCAGGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 192}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927847060_927847072 16 Left 927847060 2:26477104-26477126 CCCTGATCCTGAGGGGCCCCAGA 0: 1
1: 0
2: 1
3: 21
4: 192
Right 927847072 2:26477143-26477165 AGGCAAAGCCCCGACCCCTTGGG 0: 1
1: 0
2: 1
3: 8
4: 139
927847060_927847071 15 Left 927847060 2:26477104-26477126 CCCTGATCCTGAGGGGCCCCAGA 0: 1
1: 0
2: 1
3: 21
4: 192
Right 927847071 2:26477142-26477164 GAGGCAAAGCCCCGACCCCTTGG 0: 1
1: 0
2: 1
3: 15
4: 118
927847060_927847067 -4 Left 927847060 2:26477104-26477126 CCCTGATCCTGAGGGGCCCCAGA 0: 1
1: 0
2: 1
3: 21
4: 192
Right 927847067 2:26477123-26477145 CAGAGAGCCAGCCCTGGATGAGG 0: 1
1: 0
2: 4
3: 24
4: 372
927847060_927847063 -10 Left 927847060 2:26477104-26477126 CCCTGATCCTGAGGGGCCCCAGA 0: 1
1: 0
2: 1
3: 21
4: 192
Right 927847063 2:26477117-26477139 GGGCCCCAGAGAGCCAGCCCTGG 0: 1
1: 1
2: 5
3: 69
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927847060 Original CRISPR TCTGGGGCCCCTCAGGATCA GGG (reversed) Intronic
900139148 1:1132204-1132226 TGTGGGGCCTCTCAGGGGCAAGG + Intergenic
900736165 1:4300762-4300784 GCTGGGGCCCGTGAGGGTCAGGG - Intergenic
901849569 1:12006978-12007000 TCTGGGGCCCATCACTACCAGGG - Intronic
901877191 1:12173627-12173649 TCTGGGAACCCACAGGTTCAAGG + Intronic
902030806 1:13420801-13420823 TCTGGTGCCACTCAGGTCCAGGG - Exonic
902311554 1:15585089-15585111 TCAGGGGCGCCCTAGGATCAAGG + Exonic
902803466 1:18846007-18846029 TCTGTGACTCCTCAGGCTCAAGG + Intronic
903014418 1:20352689-20352711 TCTGGGGCCCCTCAGGGCTTGGG + Intronic
903179796 1:21599453-21599475 TCAGGGGCCCCACAGGAGCTTGG - Intronic
904465605 1:30705483-30705505 TTTGGGGCACCTCTGGTTCATGG - Intergenic
905296783 1:36959454-36959476 TCAGGGGCCACACAGGCTCATGG - Intronic
905885317 1:41488569-41488591 CCTGGGGCCACTCAGCCTCAGGG + Intergenic
906884913 1:49634218-49634240 ACTGGGGCCCCTCAGGGTTGGGG - Intronic
907497578 1:54855014-54855036 ACTGGGGACCCTCAGGAACATGG - Intronic
908823877 1:68115166-68115188 TCTGGGGCTCCTTAGGGTTATGG + Intronic
913106229 1:115616427-115616449 TCGGGGGCCACTCCTGATCAGGG + Intergenic
914980520 1:152410741-152410763 TCTGGGGCCTCGCAGGAGCTGGG - Exonic
915064934 1:153217180-153217202 CCTGGGGCCTCTCTGGGTCAAGG - Intergenic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916999158 1:170337266-170337288 TTTGGGGACCCTCAGGAGCGTGG - Intergenic
917017950 1:170555804-170555826 CCTGGGGCCACTCTGGATCAGGG + Intergenic
918534288 1:185557356-185557378 TCTGAGTCCCCTAAGGCTCATGG + Intergenic
920641425 1:207755036-207755058 ACTGGAGCCCCTCATGGTCAAGG + Intronic
920696562 1:208185231-208185253 GGTGGGGCCTCTCAGGATTAAGG + Intronic
922905488 1:229170608-229170630 TCTCAGGCCACACAGGATCAAGG - Intergenic
923623308 1:235594954-235594976 GCTGGGTCCCTTCAGGCTCAGGG - Intronic
923908923 1:238417605-238417627 GCTGGGGGCCCTCACCATCACGG - Intergenic
924499734 1:244626041-244626063 TCTAGGGCCCTTCAGAATTATGG - Intronic
924795294 1:247288442-247288464 TCAGGGGCCCTGCAGGCTCACGG + Intergenic
1065131216 10:22622258-22622280 TGTGGAGCCCCTCAGCATCTGGG - Intronic
1067081572 10:43215473-43215495 CCTGAGGCCCACCAGGATCATGG - Intronic
1067222350 10:44353207-44353229 CCTGGGCCCCCTCAGGACCTTGG - Intergenic
1067617040 10:47764018-47764040 TCTGGGAGCCCTCAGGGCCAGGG + Intergenic
1072791442 10:98321070-98321092 ACTGGGGCCCCTGGGGATCTGGG + Intergenic
1074824093 10:117202168-117202190 GCTGGGGCCCCTCATGCTGAAGG + Intronic
1076439806 10:130473464-130473486 TCTCGGGACCCACAGAATCAGGG + Intergenic
1078188374 11:9071659-9071681 TCTGGTGCACCCCAAGATCAGGG + Intronic
1079115907 11:17640596-17640618 CCTGGGGCCCCTCAGCAGCCTGG - Intronic
1081630265 11:44684818-44684840 TCTGGGGCCCCTGAAGAGCCGGG + Intergenic
1081687545 11:45053425-45053447 CCTGGGGCTCCTCAGGATGGGGG - Intergenic
1082971560 11:59028158-59028180 CCTGGGGCCCTTAAGGATTATGG - Intronic
1083908496 11:65690409-65690431 TCTGGGGCAACTCTAGATCATGG - Intergenic
1085041218 11:73327479-73327501 TCTGAGGCCCTTCAGGACCTAGG + Intronic
1085309672 11:75508796-75508818 TCTGGAGCTGCTCAGGAACAAGG + Intronic
1086690108 11:89780202-89780224 CCTCGGGCCCCTCAGCAGCAAGG + Intergenic
1086698555 11:89872770-89872792 CCTCGGGCCCCTCAGCAGCAGGG - Intronic
1086707614 11:89971726-89971748 CCTCGGGCCCCTCAGCAGCAAGG + Intronic
1086715746 11:90059755-90059777 CCTCGGGCCCCTCAGCAGCAAGG - Intergenic
1087137230 11:94732918-94732940 TCTGAAGCCTCTCAGGGTCAGGG + Intronic
1089144242 11:116312872-116312894 TGTGGGGGCCCTCAGGATAATGG + Intergenic
1089654163 11:119935051-119935073 GCTGGGGCTCCTCAGCCTCAGGG - Intergenic
1089679469 11:120111244-120111266 TCTGGGGACCCTCAGGGAAATGG + Intergenic
1090404144 11:126467174-126467196 CCTGGGGCCCCGCAGAGTCACGG - Intronic
1091949745 12:4582944-4582966 TCTGAGGCCACTCAGGAGGAAGG + Intronic
1097200333 12:57272856-57272878 TCTGAGGACTCTCAGGGTCAGGG + Intronic
1097446839 12:59681832-59681854 TCTTAGGCCCCTGAGGAACATGG + Intronic
1097918087 12:65040993-65041015 TCTGGGGCCCCAAAATATCATGG - Intergenic
1099154576 12:79158475-79158497 TGTGTGGCCTCTCAGGACCAAGG - Intronic
1106337381 13:28796278-28796300 TGTCGGGCCTCTCAGGATGAAGG - Intergenic
1107869742 13:44735527-44735549 TCTAGGACCCCTCAGCTTCAGGG - Intergenic
1121794616 14:96724719-96724741 TCTGGAGCCTCTCAGGAGAATGG + Intergenic
1122692581 14:103538261-103538283 TCTGGGGACCCTCTCGCTCAAGG - Intergenic
1125612949 15:40984719-40984741 TCTTCGGCCCATTAGGATCAGGG - Intronic
1127867447 15:63043604-63043626 GCTGGGGCCCCTCGGGCTCGGGG - Intronic
1128570423 15:68729650-68729672 GCTGGAGCCCCTCAAGAGCAGGG - Intergenic
1130300996 15:82679985-82680007 TCAGCGGCCCCTCAGGATCCAGG + Intronic
1132668039 16:1090807-1090829 GCTGGGGCCCCACAGCAACAGGG + Intronic
1133328892 16:4959000-4959022 TCTGGGGGCCCTCAGTGTGAAGG + Intronic
1133673551 16:8047700-8047722 TCTAGGGCCCTTCTGGCTCAGGG + Intergenic
1135680073 16:24448770-24448792 TCTAGGGGCCCTCAGGAAAAAGG - Intergenic
1136684174 16:31984347-31984369 TCTGGGGGCTCTCAGGGTCTTGG + Intergenic
1136784802 16:32927899-32927921 TCTGGGGGCTCTCAGGGTCTTGG + Intergenic
1136884981 16:33925907-33925929 TCTGGGGGCTCTCAGGGTCTTGG - Intergenic
1136990166 16:35147174-35147196 TCTGGGGCCCCAGGGGATCAGGG - Intergenic
1137023456 16:35452228-35452250 GCTGGTGCCCCTCAGGGGCAGGG - Intergenic
1137071515 16:35908419-35908441 TCATGGGCCCCGCAGGACCACGG - Intergenic
1137686524 16:50390623-50390645 TCTGGGGCCGCTCCGGAGCTGGG + Intergenic
1138510754 16:57507405-57507427 TCTGGGGCACCCCAGGAGCCAGG + Intergenic
1138609269 16:58110104-58110126 TATGGGTCTCCTCAGGAGCATGG + Intergenic
1139255177 16:65534276-65534298 TCTGGGTCCCTTGAGGACCAGGG - Intergenic
1139636418 16:68260977-68260999 TGTGGGGCCACTCAGGAACAAGG - Exonic
1139851041 16:69951745-69951767 TCTGGGGCTCCTCCGGGCCACGG - Intronic
1139880021 16:70174657-70174679 TCTGGGGCTCCTCCGGGCCACGG - Intronic
1140227096 16:73087298-73087320 ACTGGGGCCTCTGAGGATCCGGG + Intergenic
1140372490 16:74420860-74420882 TCTGGGGCTCCTCCGGGCCACGG + Intronic
1140522951 16:75597934-75597956 TCTGTGGCCTGTCAGGAACAAGG - Intronic
1142438191 16:90076507-90076529 TTTGGGGTCCCTCAGGCTGAGGG + Intronic
1203087463 16_KI270728v1_random:1191905-1191927 TCTGGGGGCTCTCAGGGTCTTGG + Intergenic
1147374829 17:40017237-40017259 GGTGGGGACCCTCAGGACCAGGG - Exonic
1150337644 17:64342262-64342284 TCCGTGGCCCCTCAGGTCCAGGG - Intronic
1151473516 17:74332359-74332381 TCTGGGGCCCCAGAGGAGCCAGG + Intronic
1152310972 17:79549598-79549620 TCTGGGGACACCCAGGATGATGG + Intergenic
1152868623 17:82738521-82738543 CCTGGAGGCCCTCAGGAGCACGG + Exonic
1153503237 18:5769810-5769832 TCTGGGCCCCTTCAGCAGCAGGG + Intergenic
1156174354 18:34525226-34525248 TCAGGGGCCCCAGAGGTTCAGGG + Intronic
1157717763 18:49900753-49900775 TCTGGGGCACCTCAGAAGCCTGG + Intronic
1160631193 18:80247379-80247401 TCTGCGGCCCCTGAGGAGCGAGG - Exonic
1162027198 19:7901049-7901071 TCTGGGGCCCAGGAGGATCTGGG + Exonic
1162384040 19:10350628-10350650 TGTTGGGTCCCTCAAGATCATGG + Exonic
1163827957 19:19534115-19534137 GCTGGGGCCACGCAGAATCAGGG + Intronic
1164014168 19:21237372-21237394 TGTGGGTGCCCTCAGGAACAAGG + Intronic
1167489325 19:49782476-49782498 TCTGGGGCCACTCAGTCACAAGG + Intronic
925767015 2:7245949-7245971 TCTGGGGGCACTCAGCATCATGG + Intergenic
925910504 2:8570735-8570757 TCTGGGCCCCCTTAGGCTCCTGG + Intergenic
926743343 2:16130225-16130247 TGTGGGGCCCCTCAGTCTCCAGG + Intergenic
927446614 2:23167873-23167895 TCTGGGGTCCTTCAAGATGATGG + Intergenic
927847060 2:26477104-26477126 TCTGGGGCCCCTCAGGATCAGGG - Intronic
934063212 2:88316145-88316167 CCTGGGGCCTGTCAGGAGCAAGG - Intergenic
935103517 2:100019055-100019077 GCTGTGGCCACTCAGGCTCATGG + Intronic
936708065 2:115099519-115099541 TTTGTGGCCCCTCAAGGTCAAGG + Intronic
936813762 2:116434113-116434135 GCTGGGGGTCCTCACGATCATGG + Intergenic
938017635 2:127880700-127880722 CCTGCGGCCTCTCAGGCTCAGGG - Intronic
938152824 2:128901657-128901679 CCTGGGTCCCCTGAGGGTCACGG - Intergenic
938762232 2:134436412-134436434 TCTGGTGCTCCCCAGGAGCATGG - Intronic
943941532 2:194003581-194003603 TCTGGGAGGCCTCAGAATCATGG + Intergenic
946228966 2:218279975-218279997 CCTGGGGCCCCTCAGGCTGTGGG - Intronic
946978077 2:225175343-225175365 TCTAGCACCCCTCAGGATCCAGG - Intergenic
947638674 2:231693871-231693893 TCTGTGACCCCCCAGGGTCAGGG + Intergenic
1170575011 20:17655873-17655895 TGTGGGGCCAGTCAGGATCCAGG - Intronic
1170874867 20:20240922-20240944 TCAGGGTCACCTCAGGTTCAAGG - Intronic
1171972429 20:31572819-31572841 TCTGGGGTCCCTGAGGAGCAAGG + Intronic
1173595746 20:44257670-44257692 TCTGGGGCCACTCATGCTGAAGG - Intronic
1173790813 20:45826775-45826797 TCTGGGAGCCCTGAGGATGATGG - Intronic
1175913593 20:62415736-62415758 GCTGGGCCCCCGCAGGACCAGGG - Intronic
1175928874 20:62484303-62484325 GCTCTGGCCCCTCAGCATCAAGG - Intergenic
1175943752 20:62549539-62549561 TCTGGGGCCCCACAGGACTGGGG - Intergenic
1176268748 20:64224300-64224322 TCTGGGGCCAGACAGGATCCTGG + Intronic
1181054795 22:20255747-20255769 GCTGGGGCCCCTCAGGAGCCGGG + Intronic
1181627420 22:24131283-24131305 TCTGGGGCTCCTCCGGAACTTGG - Intronic
1181808563 22:25390193-25390215 ACTGGGTCCCCTCAGGACCATGG + Intronic
1184983075 22:48108625-48108647 TCTGGGGTCCTTCAGGATGAGGG - Intergenic
952445124 3:33373679-33373701 TGTGCAGCCCCTCAGGAGCAGGG - Exonic
953901634 3:46846975-46846997 GCTGGGGCCGCTAAGGTTCAAGG - Intergenic
954115754 3:48466097-48466119 TCTGGGGTCCCCCGGGAGCAGGG + Exonic
954361085 3:50123185-50123207 TCTGGTGCCTCTCAGGATTTGGG - Intergenic
954616570 3:51971712-51971734 TCTGTGGCCCCTCATCATCGTGG - Intronic
954753950 3:52828967-52828989 CCTGGGGCCACACAGGAACAGGG - Intronic
955997204 3:64688918-64688940 TCTGGCGCCCCTCACTACCAGGG + Intergenic
961222452 3:125211860-125211882 TTTGGGGCCCTTCTGGAGCAGGG + Intronic
961565938 3:127763433-127763455 GCACGGGCCCCTCAGGCTCAAGG + Intronic
963112845 3:141701079-141701101 TCTGGGGCCCTGCAGGCCCATGG - Intergenic
968593512 4:1471310-1471332 TGTGGGGTCCCTCATGAGCAGGG + Intergenic
969313523 4:6368087-6368109 TCGGGGGCCCCTGTGGATCCTGG - Intronic
969440224 4:7212639-7212661 TCTGGCTTCCCTCAGGAGCAGGG - Intronic
972263835 4:37439819-37439841 TCTGGGGCCTCTCATAAACAAGG + Intronic
972357820 4:38297403-38297425 TCAGGATCACCTCAGGATCAGGG - Intergenic
977996859 4:103505035-103505057 TCTGTAGCCCCTCAGGCTCTGGG + Intergenic
978567855 4:110103112-110103134 GCTGGGGAACCTCAGAATCATGG - Intronic
979531872 4:121777142-121777164 TGTGTGGCCCCTCATAATCATGG + Intergenic
980999370 4:139813703-139813725 ACTGGGTCCCCACAGGATCAAGG + Intronic
987862911 5:23508416-23508438 TTTGGGGTCCCTCAGGCTGAGGG - Intronic
990093546 5:52084170-52084192 TCTGGGAGGCCTCAGAATCATGG + Intergenic
991366907 5:65878237-65878259 TCTAGGGCCCTTAAGGATTATGG + Intergenic
994303157 5:98171232-98171254 TCTGTGGCCTGTTAGGATCAGGG - Intergenic
996287651 5:121813424-121813446 GTTGGGGCCCCTCAAGTTCAGGG - Intergenic
998103607 5:139454713-139454735 CCTGGGGACCCTCCGGCTCATGG + Intronic
999268562 5:150282986-150283008 TCTAGGGCCCCTCAGGCCCCAGG + Intronic
1000244376 5:159437088-159437110 TCTGGGGTCCCTGAGGAGCAGGG + Intergenic
1001329410 5:170751892-170751914 TCTGAGGACCCTCGGGACCAAGG + Intergenic
1002541010 5:179906939-179906961 TCCGGGGCCCCTCATGCTCCAGG - Intronic
1002973938 6:2054869-2054891 TCTGGGTCTACTCAGGGTCAGGG - Intronic
1003495613 6:6660840-6660862 TCTGGGTCCCCTCAGGTTCATGG - Intergenic
1006526059 6:34606121-34606143 ACTGGGGCCTCTCTGGGTCATGG + Intronic
1006779609 6:36623431-36623453 TCTGGTGGCCCTGAGGATCGGGG + Intergenic
1007298645 6:40848791-40848813 TCTGGGCCCCCTCAGGAAGCTGG - Intergenic
1008784927 6:55157429-55157451 TCTGGATCCACTCAGGACCAGGG + Intronic
1015001283 6:128219540-128219562 TCTGTGGCCTGTCAGGAACAGGG - Intronic
1017560513 6:155623551-155623573 GCTGGGGGCTCCCAGGATCATGG - Intergenic
1018997725 6:168723013-168723035 GCTGGGGAGCCTCAGAATCATGG - Intergenic
1019031757 6:169019397-169019419 TCTGGGGCCACTCAGGTCCAAGG - Intergenic
1023652351 7:42385494-42385516 TCTGGGAGGCCTCAGGAACATGG + Intergenic
1023821247 7:43981791-43981813 TGAGGGGCCCCGCAGGAGCAGGG - Intergenic
1023868261 7:44249171-44249193 GCTGGGCCCCTTCAGGAACAAGG - Intronic
1025768701 7:64483178-64483200 ACTGGGGCCACTCAGGGTAAAGG + Intergenic
1029749516 7:102535215-102535237 TGAGGGGCCCCGCAGGAGCAGGG - Intergenic
1029767464 7:102634318-102634340 TGAGGGGCCCCGCAGGAGCAGGG - Intronic
1029881389 7:103814664-103814686 TCTGAGGGCCCAGAGGATCATGG + Intronic
1031721943 7:125187540-125187562 TCTGGCTCCCCTCTGGCTCAGGG - Intergenic
1032078547 7:128847626-128847648 TCCGAGGCTCCTCAGCATCAGGG + Intronic
1033152743 7:138930280-138930302 TCTGGGGCCCTTAAGAATTATGG - Intronic
1034232166 7:149539017-149539039 CCTGGGTAGCCTCAGGATCAGGG - Intergenic
1037720453 8:21439315-21439337 TGTGGGGCCCATCAGGGTCCAGG - Intergenic
1039583191 8:38683474-38683496 TCTGGGACCCCTCAGGGTCTTGG + Intergenic
1043672438 8:82904281-82904303 TCTGGGGCCCCTTATCATAAAGG - Intergenic
1043859949 8:85304398-85304420 ACTGGGGCTCCTTAGGAGCAAGG + Intergenic
1046902524 8:119538608-119538630 TCTAGAGCACCTCAGGCTCATGG - Intergenic
1047170744 8:122490206-122490228 TCTGTGGCCCCTCAGCAGCTGGG + Intergenic
1047301352 8:123616160-123616182 CCAGGGGCCCCACAGGATAAGGG + Intergenic
1047751767 8:127886768-127886790 ACTGGGTCATCTCAGGATCATGG + Intergenic
1049604510 8:143523038-143523060 TCCAGGGCCCCTCAGGGTCAGGG + Intronic
1049606051 8:143529702-143529724 GCTGGGGTCCCTCAGGCACACGG - Intronic
1051688892 9:19687831-19687853 GCTGTGACCCCTCAGGATCCAGG + Intronic
1055069857 9:72155173-72155195 ACTGGGGAGCCTCAGAATCATGG + Intronic
1055820139 9:80252623-80252645 TCTGTGGCCTCTCAGACTCAAGG - Intergenic
1057266003 9:93618283-93618305 ACTGGGGCCCCCCAGGGGCAAGG + Intronic
1057272907 9:93660656-93660678 TCAGGGGCCCCTGGGGAACAAGG - Intronic
1057860958 9:98640514-98640536 TCTGTGGTCCCTCAGCATCACGG - Intronic
1057887241 9:98839114-98839136 TCTGGGAACCCTCAGGAAAAGGG - Intronic
1057900727 9:98945897-98945919 TCTGGGATCCCTCAGTGTCAGGG + Intronic
1058879938 9:109277506-109277528 TCTGGGGCTACTGAGGCTCAGGG + Intronic
1059476285 9:114550568-114550590 TCTGGGCCCACTCAAGGTCAAGG - Intergenic
1060791583 9:126489080-126489102 CCTGGGGCTCCTCAGGATGCTGG - Intronic
1061296928 9:129681883-129681905 TCTGGGCTCCCTGGGGATCACGG + Intronic
1061628476 9:131856417-131856439 TCTGGGGCTCCTCAGCAGCAAGG - Intergenic
1062494028 9:136823185-136823207 CCTGGTGACCCTCAGGGTCAGGG - Intronic
1185511990 X:670688-670710 TCTGGTGCTCCTCAGGCCCAGGG + Intergenic
1186311629 X:8326158-8326180 CCTGGGGTCCCTCAAGAACAGGG - Intergenic
1188263624 X:28043546-28043568 GCTGGTGCCCCTAAGGATCTGGG + Intergenic
1190214416 X:48470212-48470234 TCTGGGGGCCCCCAAGATCTAGG - Intronic
1190290560 X:48989470-48989492 TCTGGGGCCCCCCAGGAGCTAGG - Intronic
1193217445 X:78880863-78880885 ACTGGGACCTCTCAGGATCAAGG + Intergenic
1195365170 X:104117539-104117561 TCTGGGGCACCTCTGGCTCCTGG + Intronic
1199616605 X:149660760-149660782 TCTGGAGCACCCGAGGATCAGGG - Intergenic
1199626036 X:149742488-149742510 TCTGGAGCACCCGAGGATCAGGG + Intergenic
1201245298 Y:11997413-11997435 TCTGGAGCCCCCCAGGAGCTGGG + Intergenic