ID: 927851954

View in Genome Browser
Species Human (GRCh38)
Location 2:26504865-26504887
Sequence GTCCAGGTGGAGCCAGGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 256}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927851950_927851954 -9 Left 927851950 2:26504851-26504873 CCATCATCCTGTAGGTCCAGGTG 0: 1
1: 0
2: 1
3: 14
4: 190
Right 927851954 2:26504865-26504887 GTCCAGGTGGAGCCAGGTGTAGG 0: 1
1: 0
2: 1
3: 27
4: 256
927851939_927851954 19 Left 927851939 2:26504823-26504845 CCCGTTCTCCCTCCTCCTGGGTA 0: 1
1: 2
2: 0
3: 35
4: 416
Right 927851954 2:26504865-26504887 GTCCAGGTGGAGCCAGGTGTAGG 0: 1
1: 0
2: 1
3: 27
4: 256
927851940_927851954 18 Left 927851940 2:26504824-26504846 CCGTTCTCCCTCCTCCTGGGTAT 0: 1
1: 0
2: 3
3: 88
4: 557
Right 927851954 2:26504865-26504887 GTCCAGGTGGAGCCAGGTGTAGG 0: 1
1: 0
2: 1
3: 27
4: 256
927851936_927851954 25 Left 927851936 2:26504817-26504839 CCACTTCCCGTTCTCCCTCCTCC 0: 1
1: 1
2: 33
3: 444
4: 3171
Right 927851954 2:26504865-26504887 GTCCAGGTGGAGCCAGGTGTAGG 0: 1
1: 0
2: 1
3: 27
4: 256
927851943_927851954 10 Left 927851943 2:26504832-26504854 CCTCCTCCTGGGTATGGCCCCAT 0: 1
1: 0
2: 1
3: 15
4: 206
Right 927851954 2:26504865-26504887 GTCCAGGTGGAGCCAGGTGTAGG 0: 1
1: 0
2: 1
3: 27
4: 256
927851947_927851954 -7 Left 927851947 2:26504849-26504871 CCCCATCATCCTGTAGGTCCAGG 0: 1
1: 0
2: 1
3: 14
4: 190
Right 927851954 2:26504865-26504887 GTCCAGGTGGAGCCAGGTGTAGG 0: 1
1: 0
2: 1
3: 27
4: 256
927851945_927851954 4 Left 927851945 2:26504838-26504860 CCTGGGTATGGCCCCATCATCCT 0: 1
1: 0
2: 0
3: 15
4: 146
Right 927851954 2:26504865-26504887 GTCCAGGTGGAGCCAGGTGTAGG 0: 1
1: 0
2: 1
3: 27
4: 256
927851942_927851954 11 Left 927851942 2:26504831-26504853 CCCTCCTCCTGGGTATGGCCCCA 0: 1
1: 0
2: 2
3: 29
4: 281
Right 927851954 2:26504865-26504887 GTCCAGGTGGAGCCAGGTGTAGG 0: 1
1: 0
2: 1
3: 27
4: 256
927851949_927851954 -8 Left 927851949 2:26504850-26504872 CCCATCATCCTGTAGGTCCAGGT 0: 1
1: 0
2: 0
3: 5
4: 115
Right 927851954 2:26504865-26504887 GTCCAGGTGGAGCCAGGTGTAGG 0: 1
1: 0
2: 1
3: 27
4: 256
927851944_927851954 7 Left 927851944 2:26504835-26504857 CCTCCTGGGTATGGCCCCATCAT 0: 1
1: 0
2: 2
3: 16
4: 139
Right 927851954 2:26504865-26504887 GTCCAGGTGGAGCCAGGTGTAGG 0: 1
1: 0
2: 1
3: 27
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927851954 Original CRISPR GTCCAGGTGGAGCCAGGTGT AGG Intronic
900112767 1:1015512-1015534 GTCCTGGTGCAGCCAGATGGGGG - Intergenic
900157852 1:1210747-1210769 TTCCAGGTGCAGCAAGGGGTGGG + Intergenic
900326120 1:2109534-2109556 GAGCAGATGCAGCCAGGTGTGGG + Intronic
900426750 1:2583953-2583975 CTCCAGGTGGTGCCAGCTCTGGG - Intergenic
900611284 1:3545613-3545635 CTCCAGGATGAGCCAGGTGCAGG - Intronic
900931571 1:5741304-5741326 CTCCACCTGGAGCCAGGTGAGGG + Intergenic
901039701 1:6356482-6356504 GTCCAGGGCTGGCCAGGTGTGGG - Intronic
901326177 1:8366567-8366589 CTTCAGATGGAGCCAGGTGGAGG - Intronic
901822724 1:11840488-11840510 GCTCTGGTGGAGCCAGGGGTGGG - Exonic
902764766 1:18606905-18606927 GTTCAGGAGGTGCCAGGTGCAGG - Intergenic
902989579 1:20177231-20177253 CTCCAGGTGGCACCAGGTGAGGG - Intronic
904009898 1:27383415-27383437 GTCGGGGCGGAGCCAGGTGAAGG + Intergenic
904328402 1:29742463-29742485 GTTAAGATGGAGCCAGGTGTGGG - Intergenic
904970672 1:34417332-34417354 GTCCACGTGCAGTCAGGTGCTGG + Intergenic
905253747 1:36666529-36666551 GGCCAGGGGGAGGCAGGAGTTGG - Intergenic
906942023 1:50263852-50263874 ATATAGGTGGAGCCAGGTGTGGG - Intergenic
907716278 1:56929313-56929335 CTCCAGGTGGAAACTGGTGTAGG + Exonic
909756280 1:79230060-79230082 CTGGAGGTGGAGCCAGGTGGAGG - Intergenic
918051654 1:180978465-180978487 CTCCAGGTGGACCCAGGCGAAGG + Intronic
919880893 1:201899828-201899850 GTCCAGGTTGAGGCTGGTGATGG + Exonic
922243665 1:223774161-223774183 GGCCAGGTGGACCCTGGAGTGGG - Intronic
923569104 1:235098578-235098600 CTCCACGTGGAGCCAGTGGTGGG - Intergenic
1063437445 10:6045962-6045984 GTCCAGTTGGTGTCAGGTGAGGG + Intronic
1066095868 10:32071720-32071742 TACCAGGTGGAGCCATGTGAAGG - Intergenic
1067289679 10:44931975-44931997 CTGCAGGTGGAGACAGGTGAGGG - Intronic
1067968031 10:50936179-50936201 GTCAAGGTGGGACCAGGTGGAGG - Intergenic
1068733838 10:60389740-60389762 GTTCAGGTAGAGGAAGGTGTAGG - Intronic
1072788381 10:98300342-98300364 GTCCAGATGGAGGGAGGAGTGGG + Intergenic
1074492943 10:113955303-113955325 GTCCAGGAGGCCCCAGCTGTGGG - Intergenic
1075476510 10:122739806-122739828 GTCCAGGAGGAACCAGATGATGG + Intergenic
1075542540 10:123327593-123327615 GTCCAGCTGCAGCCAGTTATAGG + Intergenic
1075900114 10:126036199-126036221 GTGCACGTGGAGCCCGGTGGAGG + Exonic
1076153937 10:128188383-128188405 GTCCAGGAGCATCCATGTGTTGG - Intergenic
1076311239 10:129509105-129509127 ACCCTGGTGGAGCCAGGTGATGG - Intronic
1076329442 10:129653926-129653948 GGCCAGGTGGAGCCACCTTTGGG + Intronic
1076408839 10:130231635-130231657 GTCCAAGTGGCCCCAGGTGCAGG - Intergenic
1076739548 10:132476565-132476587 GTCCAGCTGGAGACAGGGTTTGG - Intergenic
1076778654 10:132711722-132711744 GTCCAGGCTAAGACAGGTGTGGG - Intronic
1076983508 11:218686-218708 GTCCAGGTAGTGCCTGGTGCAGG + Intronic
1077500896 11:2909377-2909399 GTCCAGGTGGGGCCGGGTCGGGG + Intronic
1081516327 11:43833945-43833967 GTACAGCTGGAGCCAGGAGGTGG + Intronic
1082705624 11:56491200-56491222 GGGCATGTGGAGCCAGGCGTTGG + Exonic
1083204793 11:61141840-61141862 CTGCAGGTGCAGCCAGGTGGAGG + Intronic
1084608653 11:70186989-70187011 CTCCAGGTGAGGCCAGGTCTGGG - Intronic
1086575811 11:88337879-88337901 GTCCAGTTGCAGCCAAGTGAGGG - Intergenic
1088569731 11:111211947-111211969 GTGGAGGTGGAGCAAGGTGGCGG + Intergenic
1089281399 11:117377185-117377207 TTCCAGATGGGGCCAGGGGTGGG + Intronic
1089701433 11:120246502-120246524 AGCCAGGTGGAGCCAGGTAAGGG + Exonic
1090855745 11:130608191-130608213 GCCCCTGTGGTGCCAGGTGTGGG - Intergenic
1091680229 12:2521747-2521769 GTCCAGGCGGAGAGAGGTGAGGG - Intronic
1092526180 12:9311603-9311625 TTCCAGGTGCATCCAGGTGCGGG + Intergenic
1094511945 12:31102296-31102318 TTCCAGGTGCATCCAGGTGCGGG + Exonic
1097071956 12:56361637-56361659 GTCCAGCTGCTGCCAGGAGTGGG - Exonic
1098423343 12:70328755-70328777 GTACCCCTGGAGCCAGGTGTGGG - Intronic
1098667246 12:73179883-73179905 ATACAGGTGGAGCCAGGTAGTGG - Intergenic
1100613181 12:96209025-96209047 TCCCAGGTGGGGTCAGGTGTGGG - Intronic
1101591843 12:106131813-106131835 GCCCAGGAGCAGCCAGATGTTGG - Intronic
1101808116 12:108082716-108082738 GTCCAGATGGTTCCAGTTGTGGG - Intergenic
1102255587 12:111412951-111412973 CTCCAGCTGGAGTCAGGAGTCGG - Intronic
1102569390 12:113818352-113818374 GTGCAGGAAGAGCCAGGTGCTGG + Intronic
1102856722 12:116300497-116300519 GACCAAGTGCAGCCAGGTGCCGG - Intergenic
1103369592 12:120408763-120408785 GTCCAGGAGGGGCCAGGGTTTGG - Intergenic
1103629516 12:122248314-122248336 GGCCAGGCTGAGACAGGTGTAGG + Intronic
1105278069 13:18947746-18947768 GTGCAGGTGGGTGCAGGTGTGGG - Intergenic
1106025227 13:25949684-25949706 GTCCAGCTGGAGCCACGGGAAGG - Intronic
1107078975 13:36353932-36353954 TTCCAGGTGTTGCCAGGAGTTGG - Intronic
1107411268 13:40160746-40160768 GTCCAGGTGGTGGTGGGTGTGGG + Intergenic
1107996787 13:45869067-45869089 GTCCAGGTGGGGGCAGGAGGGGG + Intergenic
1109793262 13:67277443-67277465 GTCAAGGGGGAGACAGGTGGAGG - Intergenic
1112086246 13:96034856-96034878 GCCAAGGGGGAGCCAGGTGCAGG - Intronic
1112337016 13:98524275-98524297 GGCCAGGTGGTTCAAGGTGTGGG - Intronic
1113813626 13:113157261-113157283 GTCCAGGTGGAGACAGGAGTGGG - Intergenic
1114674407 14:24430879-24430901 CTCCAGCTGCAGCCAGATGTGGG - Exonic
1114717406 14:24842135-24842157 GGCCAGTTGGATCCAGGTCTTGG + Intronic
1118591708 14:67406872-67406894 GTCCAGGTGGAGGGAGGCCTGGG - Intronic
1118601827 14:67475999-67476021 GTTCATGTGGAGGGAGGTGTGGG + Intronic
1119132841 14:72190569-72190591 GTCCAGGTGTAGCCTGTTGAGGG - Intronic
1119851003 14:77866783-77866805 GTCCTGGTGGGGCCGGGTGTGGG + Intronic
1120025298 14:79576993-79577015 GTCAAGATGGGGCCAGGTGGAGG + Intronic
1121019357 14:90569720-90569742 GTCCAGGTGCAGGCATGTCTAGG - Intronic
1122108621 14:99480378-99480400 CTCGAGGTGGTGCCAGGTGCAGG - Intronic
1122559857 14:102605144-102605166 TTCCATGTGGCCCCAGGTGTTGG + Intronic
1122745489 14:103894925-103894947 GGCCAGGTGGAGCCAGCCCTGGG - Intergenic
1123147202 14:106143331-106143353 GTCCATGTGGGGACAGGTGTGGG + Intergenic
1123579547 15:21703982-21704004 GTCCACGTGGGGACAGATGTGGG - Intergenic
1123616174 15:22146493-22146515 GTCCACGTGGGGACAGATGTGGG - Intergenic
1123924158 15:25091876-25091898 CTCCAGTTGGAGCCACGTGCTGG - Intergenic
1128512413 15:68321507-68321529 GGCCAGGGAGAGCCAGGTGTGGG + Intronic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1129595114 15:76957842-76957864 GGGCGGGTGGAGCCAGGTGGGGG - Intergenic
1131095627 15:89652797-89652819 CTGCAGGTGGAGCCAGGGCTTGG - Exonic
1202988417 15_KI270727v1_random:438227-438249 GTCCACGTGGGGACAGATGTGGG - Intergenic
1134066079 16:11229257-11229279 GGCTAGGAGGTGCCAGGTGTGGG - Intergenic
1134482262 16:14630054-14630076 GGCCAGGGGCAGCCGGGTGTGGG + Intronic
1135182879 16:20290733-20290755 GTCCAAGGAGGGCCAGGTGTGGG - Intergenic
1135290506 16:21233682-21233704 CTCCAGGCAGAGCAAGGTGTTGG - Exonic
1136016380 16:27403623-27403645 ATCCTGGTGGAGCTAGTTGTGGG + Intronic
1136691734 16:32037741-32037763 GTCCACGTGGGGACAGGTGTGGG - Intergenic
1136792321 16:32981304-32981326 GTCCACGTGGGGACAGGTGTGGG - Intergenic
1136877495 16:33872604-33872626 GTCCACGTGGGGACAGGTGTGGG + Intergenic
1137343979 16:47637365-47637387 GCCGAGGGTGAGCCAGGTGTTGG - Intronic
1140048959 16:71462431-71462453 CTGCAGGTGCAGCCACGTGTGGG + Intronic
1141612221 16:85188084-85188106 ATCCAAGGGGAGGCAGGTGTGGG + Intergenic
1141926654 16:87174343-87174365 TTCCAGGTGGAGGCAGGGGATGG - Intronic
1203094528 16_KI270728v1_random:1242768-1242790 GTCCACGTGGGGACAGGTGTGGG - Intergenic
1143727162 17:8857003-8857025 GTCGAGGGGGAGCCAGCTGTGGG - Intronic
1144739127 17:17571472-17571494 GGCCAGGTGGAGGGAGGGGTGGG + Intronic
1146593858 17:34153027-34153049 GTCCCAGGGAAGCCAGGTGTGGG - Intronic
1147661508 17:42119449-42119471 GTCGAGGGGGAGACAGGTGAGGG + Intronic
1148758056 17:49984898-49984920 GTCCAGGTGTAGCCTCGTGTAGG + Intergenic
1151460197 17:74249793-74249815 GTGCAGCTGCAGCCAGGTGGGGG + Intronic
1152085235 17:78214066-78214088 GTCGAGGGGGCGCTAGGTGTGGG + Intergenic
1152713737 17:81888214-81888236 GTCCCGGGGGAGCCAGCTGGGGG - Intronic
1153522016 18:5962466-5962488 GGCCACGTGGTTCCAGGTGTGGG + Intronic
1156545806 18:37962621-37962643 GTCCGGGTGGAGCACCGTGTAGG - Intergenic
1158501651 18:58007825-58007847 GTCAAGGTGGAAGCAGGTCTGGG + Intergenic
1158664359 18:59419321-59419343 GGGCAGGTGGAGAGAGGTGTGGG - Intergenic
1160159606 18:76461238-76461260 GTCCAGGAGGAGCTTGGTTTAGG - Intronic
1160208695 18:76858800-76858822 GCTCAGGTGGAGGCAGGTGCAGG + Intronic
1160208765 18:76859020-76859042 GCTCAGGTGGAGGCAGGTGCAGG + Intronic
1160922193 19:1526245-1526267 CTCAAGGTGGTGCCAGGTGCGGG + Intronic
1160922509 19:1527645-1527667 GTTCAGGGTGAGCCAGGTGCAGG + Intronic
1160974963 19:1788710-1788732 GTCCAGGTGAAGGGAGGTGACGG - Intronic
1161065214 19:2234133-2234155 GGCCAGGTGGGGCCAGGCGGTGG - Exonic
1161269442 19:3381764-3381786 CTGCAGGTTGAACCAGGTGTAGG - Exonic
1161592109 19:5133569-5133591 GTCCAGGGAGAACCAGGTGTTGG + Intronic
1161667759 19:5587343-5587365 GGCCACGTGGTGCCAGGTGGCGG - Exonic
1161907640 19:7169053-7169075 GTCCAGGGAGAGTCAGGTTTTGG - Intronic
1162784377 19:13025073-13025095 CTGCAGGTTGAACCAGGTGTAGG - Exonic
1163523704 19:17807676-17807698 GTACAGGTGCAACCAGATGTTGG + Intronic
1163529866 19:17842854-17842876 GTCCAGCTGGAGCCTGGGGGTGG + Intronic
1165248654 19:34513079-34513101 CTGCAGGTGGAGCCAGCTGGGGG + Intergenic
1165256204 19:34578449-34578471 CTGCAGGTGGAGCCAGCTGGAGG + Intergenic
1165266361 19:34665876-34665898 CTACAGGTGGAGCCAGCTGGGGG - Intronic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1166700044 19:44877225-44877247 GTAGAGGTGGGGTCAGGTGTGGG + Intronic
1166755392 19:45187519-45187541 GACCAGATGGGGCCAGGTGAAGG - Intronic
1167179490 19:47891720-47891742 GCCCACGTGGAGCCATGTTTAGG - Intergenic
1167421590 19:49407159-49407181 GAACAGGTGGGGCCAGGTGGAGG + Intronic
1167485593 19:49761276-49761298 GCCCAGGGGAAGCCAGGTGGGGG + Intronic
1167576705 19:50321111-50321133 GTGGTGGTGGTGCCAGGTGTGGG + Intronic
1167692616 19:50996092-50996114 GTCCAGGTAGCGGCAGATGTTGG + Exonic
1168319564 19:55500859-55500881 GTCAGGGTGGGGCCAGGTGACGG + Intronic
925360451 2:3277191-3277213 GTGTGGGTGGAGACAGGTGTGGG - Intronic
926304488 2:11628131-11628153 CTCCAAGTGGAGCCCAGTGTGGG + Intronic
926856512 2:17262265-17262287 GTTCAGGTGGACACAGATGTGGG - Intergenic
927226191 2:20767734-20767756 GTCCATGGGCAGCCAGGGGTAGG - Intronic
927851954 2:26504865-26504887 GTCCAGGTGGAGCCAGGTGTAGG + Intronic
928367172 2:30711802-30711824 GTCCAGGAGGAGCCAGAAGGAGG - Intergenic
930014335 2:46960095-46960117 GACCAGGTCCAGCCAGGAGTAGG + Intronic
932094562 2:68836218-68836240 GTCCAGGTGGAGGGTGGTGCTGG + Intergenic
938480204 2:131657028-131657050 GTCCAGGGAGAGGCAGGGGTGGG + Intergenic
941905786 2:170715670-170715692 GTGCAGCTGGAGCCAGGCCTAGG + Intronic
942114351 2:172713262-172713284 GTCCATGAGCAGCCATGTGTGGG + Intergenic
942297955 2:174535394-174535416 GTCCAGGAGGAGGCAGAGGTTGG + Intergenic
944901813 2:204223453-204223475 GTCCATGGGCAGCCAGGGGTGGG + Intergenic
945131172 2:206574250-206574272 GTACAGGTTGAGCCAGGTTGAGG - Intronic
946839287 2:223804179-223804201 GTCTTGCTGGAGCCAGGGGTAGG - Intronic
948098378 2:235354540-235354562 GTCCAAGTGAAGCCAGGGGTGGG - Intergenic
948175706 2:235940943-235940965 GTCCAAGTGGTGGCAGGGGTGGG + Intronic
948268970 2:236659191-236659213 GTGGAGGCGGAGTCAGGTGTTGG + Intergenic
1168836425 20:880804-880826 GTCCAGTTGAAGGCAGGAGTTGG - Intronic
1169207657 20:3749270-3749292 TTCCTGGTGGAGTCAGGCGTAGG + Exonic
1171175332 20:23047988-23048010 GTCAAGGTGGAGCCGGGCGTCGG + Exonic
1172090949 20:32432228-32432250 GTCCAGGGGAAACCATGTGTTGG + Intronic
1172770182 20:37377643-37377665 GGCCATGTGGACCCAGGTGATGG + Intronic
1173335264 20:42107376-42107398 CTGCAGGTGGAGCCAGATGCCGG - Intronic
1173593640 20:44244876-44244898 GTCCAGCTGGCAGCAGGTGTGGG + Intergenic
1173827300 20:46056202-46056224 GTTCAGGCGGAGCCGCGTGTTGG - Exonic
1174035837 20:47667800-47667822 GACCAGCTGGAGGCAGGTGGTGG + Intronic
1174384607 20:50179680-50179702 GTCCAGCTGGAGCCTGGAGGAGG + Intergenic
1174387013 20:50193293-50193315 GGCCAGGTGGAGAGAGGTGGGGG + Intergenic
1175284715 20:57830340-57830362 GTACAGGTGGGGCCAGGGGAGGG + Intergenic
1175299084 20:57930183-57930205 TTCAAGGTGGCTCCAGGTGTTGG + Intergenic
1175401918 20:58705705-58705727 TTGCAGGTGGAGCCAGGACTGGG - Intronic
1179280818 21:39932432-39932454 GCCCATGTGGAGACAGGTGCAGG + Intergenic
1179729723 21:43360921-43360943 CTCCAGGCACAGCCAGGTGTGGG + Intergenic
1180178928 21:46109369-46109391 GTCCATGTGCAGCCATGTGCAGG + Intronic
1180782880 22:18530469-18530491 GTCCACCTGGAGCCAGGCGCGGG - Intronic
1181126443 22:20704500-20704522 GTCCACCTGGAGCCAGGCGCGGG - Intergenic
1181239778 22:21469831-21469853 GTCCACCTGGAGCCAGGCGCGGG - Intergenic
1183205624 22:36417012-36417034 GTCCAGGTGGAGCTGGGTGCAGG - Intergenic
1184050095 22:41997949-41997971 GTCCAGGTGGAGACAGGAAGAGG - Exonic
1184074850 22:42169733-42169755 GCACAGGTGGGGACAGGTGTGGG + Intronic
1185099039 22:48827901-48827923 CTTCAGGTGGAGGCGGGTGTGGG + Intronic
1185275126 22:49947446-49947468 GTCCACTGGGAGCCAAGTGTGGG + Intergenic
1185311407 22:50157504-50157526 TTCCAGGTGGTGTCAGGTGAGGG + Intronic
950273391 3:11638298-11638320 CTCCAGAAGGAGCCAAGTGTAGG + Intronic
950502245 3:13371971-13371993 TGCCAGGTGGAGGCACGTGTGGG - Exonic
953276724 3:41508314-41508336 TACCAGGTGGAGGCAGGTATAGG - Intronic
953491872 3:43359704-43359726 GTCCAGGCAGAGCCAGGGGCAGG - Intronic
954595310 3:51819301-51819323 GTGCTGGTGGAGGCAGGTGCTGG + Intronic
954601474 3:51874032-51874054 GTGCTGGTGGAGGCAGGTGCTGG - Exonic
957959462 3:87230625-87230647 GTCCAGGGAGAGTCAGGAGTGGG - Intronic
960570706 3:119182700-119182722 GTCAAGAGGGAGCCAAGTGTAGG - Intronic
961492552 3:127265516-127265538 GTCAAGGTGTAGTCAGGAGTAGG - Intergenic
961798001 3:129423764-129423786 GACCAGGTGGGGCCAGGTTAAGG - Intronic
962346511 3:134623158-134623180 GCCCAGGTGGGGCCAGGAGGTGG - Intronic
963025609 3:140916162-140916184 GTCTAGGTGCAGCCAGGGGATGG - Intergenic
963763478 3:149308889-149308911 GTGCAGATGGACCCAGCTGTAGG - Intergenic
964518934 3:157543073-157543095 CTCCAGGCGGAGGCAGCTGTTGG + Intergenic
965142817 3:164861709-164861731 GTCTAGGTGGAGCCATCGGTTGG - Intergenic
966234617 3:177686796-177686818 GTCCAGGAGCAGCCAGGGGAAGG - Intergenic
968703112 4:2066012-2066034 GGCCAGGTGGAGTCAGGTCTTGG + Exonic
969850565 4:9953385-9953407 GGCCAGGTGGGCCCAGATGTGGG + Intronic
972788188 4:42346546-42346568 GTCCATGGGCAGCCATGTGTGGG - Intergenic
974488825 4:62537776-62537798 CTCCAGGTGGACCCAGTTTTGGG + Intergenic
975279596 4:72545579-72545601 GTCCTGGTGTAGCCTGGTGTAGG + Intronic
977313038 4:95410897-95410919 GTCCAGAGGGAACCAGGTGGTGG - Intronic
978360644 4:107927976-107927998 GTCAAGGTGGTGCCAGGATTAGG - Intergenic
979763433 4:124435919-124435941 GTCCAGGTGGGCCCAGGCCTTGG + Intergenic
985627897 5:999524-999546 GTCCACCTGGGGCCATGTGTGGG + Intergenic
985709425 5:1419968-1419990 GGGCCGGTGGAGCCAGGTCTGGG - Intronic
985795822 5:1961603-1961625 CTCCAGGTGGAGCCACGTCCTGG + Intergenic
985871921 5:2564037-2564059 CTCCAGGTGGAGACAGGTGGGGG - Intergenic
986907492 5:12512873-12512895 GTCAAGGGGGAACCAGGTGTAGG - Intergenic
988857292 5:35240607-35240629 TCTGAGGTGGAGCCAGGTGTTGG - Intergenic
989212929 5:38874729-38874751 GTACAGGGGGACACAGGTGTTGG + Intronic
990896639 5:60706870-60706892 GTACATGAAGAGCCAGGTGTAGG - Intergenic
992364456 5:76077792-76077814 GTCCATGTGGATCTGGGTGTAGG + Intergenic
992774379 5:80076978-80077000 GTCCAGGGGGCACCAGGTCTGGG - Exonic
993095480 5:83474000-83474022 GCCAGGGTGGAGCCAGGTTTCGG + Intronic
994583589 5:101678306-101678328 ATCCAGGTGTAGCCAGGACTGGG + Intergenic
1000878423 5:166668710-166668732 GTGCAGTTGGAGCCAGGTCTGGG - Intergenic
1002352680 5:178594164-178594186 GTGCAGGTAGAGCCAGCTGAAGG + Intergenic
1003024993 6:2546764-2546786 GTCCAGGTGGTAGCATGTGTGGG + Intergenic
1004456583 6:15797180-15797202 GTCCAGGTGGAGTAAGGAGTTGG + Intergenic
1006742707 6:36320806-36320828 GGCCAGGAGTGGCCAGGTGTGGG + Intronic
1006772029 6:36561661-36561683 GTACAGCTGGAGCAAGTTGTGGG - Intergenic
1008507842 6:52247846-52247868 GTCCAGTTGGACACAGATGTGGG - Intergenic
1014490383 6:122054978-122055000 CTCCAGGCAGAACCAGGTGTGGG + Intergenic
1017005832 6:150027569-150027591 GTCCAGGAGGGGCCATGTGGAGG + Intergenic
1018792993 6:167163805-167163827 ATCCAGGTGGAGCCAGGCGGAGG - Intronic
1019341606 7:511266-511288 GTCCAGGTGGGGCCAGTGGCTGG + Intronic
1019341658 7:511403-511425 GTCCAGGTGGGGCCAGTGGCTGG + Intronic
1019576866 7:1741799-1741821 GGCTGGGTGGAGGCAGGTGTGGG - Intronic
1019604613 7:1902165-1902187 TTCCAGGAGGAGGCAGGTGTGGG - Intronic
1019633239 7:2061408-2061430 GTCCAGGTGCCCCCAGGAGTCGG + Intronic
1019912463 7:4108981-4109003 GTCCATGTGGTAGCAGGTGTGGG + Intronic
1020281733 7:6653407-6653429 GTCCGGGTGCAGCCAGGACTTGG - Exonic
1021537963 7:21726340-21726362 TTGCAGGTGGGGCCTGGTGTGGG - Intronic
1023931550 7:44709303-44709325 TTCAAGGTGGAGCCAGGGGAAGG - Intergenic
1024534798 7:50421259-50421281 GCCCAGGTGCAGCCAGGGCTGGG + Intergenic
1026265315 7:68791254-68791276 GGCAAGGTGAAGTCAGGTGTTGG - Intergenic
1026458224 7:70591325-70591347 GTCAAGGAGTAGCCTGGTGTGGG - Intronic
1029259513 7:99292340-99292362 GTCCAGGTCGTGCTTGGTGTTGG - Intergenic
1032534426 7:132650063-132650085 GAGCAGCTGGACCCAGGTGTTGG - Intronic
1032854665 7:135824441-135824463 GTCAAGGTGGTGCCAGGCGCAGG + Intergenic
1034429573 7:151034423-151034445 GTCCAGGTACAGCCGGGAGTGGG + Exonic
1034491099 7:151393515-151393537 GGCCAGGTGGAGGCTGGTGCTGG - Intronic
1037804450 8:22051185-22051207 GACCAGGTGGAGGGAGGTGGCGG + Intronic
1037935543 8:22912918-22912940 TAACAGGCGGAGCCAGGTGTGGG - Intronic
1038087140 8:24211226-24211248 GTCAAGGTGGGGCCAGGTGGAGG + Intergenic
1040466946 8:47704415-47704437 ACCCTGGTGGAGCCTGGTGTGGG + Intronic
1041903040 8:63002818-63002840 GTCTATATGGAGCCAAGTGTCGG + Intergenic
1042989132 8:74619711-74619733 GTCAAGGTGGGACCAGGTGGAGG - Intronic
1044026619 8:87180703-87180725 GTCCAGGTGGAATAAGGGGTAGG - Intronic
1047833181 8:128658303-128658325 GTCCAGCTGGGCCCAGGTGAAGG - Intergenic
1048990407 8:139757193-139757215 GTGCAGGAGGAGCCAGGGTTGGG + Intronic
1049551149 8:143260578-143260600 GTCCAGGCGGAGCCCGGGGCTGG - Intronic
1049622193 8:143603553-143603575 TCCCAGGGGGAGACAGGTGTTGG + Intergenic
1049670501 8:143867428-143867450 GTCCAGGAGGAACCCGGTGGCGG + Exonic
1049838507 8:144755297-144755319 GTCCAGGAGGAGCCTGTTCTGGG - Intronic
1053142622 9:35690780-35690802 GGCCAGGCGGAGCCAGGGGCGGG - Exonic
1053474050 9:38369370-38369392 GGCCAGATGCAGCCAGGTTTGGG - Intergenic
1057274905 9:93671019-93671041 GTTCAGGTGGGTGCAGGTGTGGG + Intronic
1057725642 9:97566116-97566138 GTGTAGGTGGTGCCAGGTGATGG - Intronic
1058462212 9:105193407-105193429 GTCCATGTGAAGCCAGCTGGTGG - Intergenic
1058868513 9:109183051-109183073 CTCCAGGGGGAGGCAAGTGTGGG - Intronic
1059634763 9:116159963-116159985 TTCCAGGTGCAGCCAGGAATGGG - Intronic
1060482699 9:124026514-124026536 GGGCATGTGGAGCAAGGTGTGGG + Intronic
1061194830 9:129102125-129102147 GGCCAGGAGGAGGCAGGTGTGGG - Intronic
1061670164 9:132184132-132184154 GTCCAGGTGTCCCCAGGTGTGGG + Intronic
1062010496 9:134264327-134264349 GTGATGGTGGAGCCGGGTGTGGG - Intergenic
1062031942 9:134365740-134365762 GTCTCGGTGGGGCCAGCTGTCGG + Intronic
1062370076 9:136234130-136234152 CCCCAGGTGGAGCCACGTGAAGG - Intronic
1062589245 9:137266064-137266086 GGCCAGGTGGAGGCAGCTGTTGG + Intronic
1186521280 X:10208937-10208959 GGCCAGGTGATGCCAGGTGGTGG + Intronic
1187006707 X:15239751-15239773 GTCCAGGTGGGGCCAGGAAGTGG - Intronic
1191747498 X:64505694-64505716 GATCAGATGGAGGCAGGTGTAGG - Intergenic
1191884084 X:65872025-65872047 CACCAGGTGGAGCCAGGGATAGG + Intergenic
1192225693 X:69226492-69226514 GTTCAGATGCAGCCAGGTTTGGG + Intergenic
1192609660 X:72554755-72554777 CACCAGGTGGAGGCAGGGGTAGG - Intronic
1193417464 X:81241464-81241486 GTCCATGGGGAGCCATGGGTGGG - Intronic
1198599747 X:138269853-138269875 AGCCAGGTTGAGCCAGGAGTAGG + Intergenic