ID: 927852975

View in Genome Browser
Species Human (GRCh38)
Location 2:26511299-26511321
Sequence GGGGGCAGTTCTAGGGGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927852966_927852975 4 Left 927852966 2:26511272-26511294 CCTGCTATGGAGTGCACACGGGT 0: 1
1: 0
2: 0
3: 3
4: 53
Right 927852975 2:26511299-26511321 GGGGGCAGTTCTAGGGGTGTAGG 0: 1
1: 0
2: 1
3: 28
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927852975 Original CRISPR GGGGGCAGTTCTAGGGGTGT AGG Intronic