ID: 927852975 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:26511299-26511321 |
| Sequence | GGGGGCAGTTCTAGGGGTGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 228 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 28, 4: 198} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 927852966_927852975 | 4 | Left | 927852966 | 2:26511272-26511294 | CCTGCTATGGAGTGCACACGGGT | 0: 1 1: 0 2: 0 3: 3 4: 53 |
||
| Right | 927852975 | 2:26511299-26511321 | GGGGGCAGTTCTAGGGGTGTAGG | 0: 1 1: 0 2: 1 3: 28 4: 198 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 927852975 | Original CRISPR | GGGGGCAGTTCTAGGGGTGT AGG | Intronic | ||