ID: 927853915

View in Genome Browser
Species Human (GRCh38)
Location 2:26516273-26516295
Sequence TGGAGAGACATCCAAGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927853915_927853924 20 Left 927853915 2:26516273-26516295 CCCACCCCTTGGATGTCTCTCCA 0: 1
1: 0
2: 1
3: 8
4: 195
Right 927853924 2:26516316-26516338 GAGCCCAGCTAGGCCTAGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 173
927853915_927853923 10 Left 927853915 2:26516273-26516295 CCCACCCCTTGGATGTCTCTCCA 0: 1
1: 0
2: 1
3: 8
4: 195
Right 927853923 2:26516306-26516328 CCTGTACTCTGAGCCCAGCTAGG 0: 1
1: 0
2: 5
3: 26
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927853915 Original CRISPR TGGAGAGACATCCAAGGGGT GGG (reversed) Intronic
900528387 1:3140464-3140486 TGCAGAGACAGGCGAGGGGTGGG - Intronic
900630885 1:3634563-3634585 TGGAGAGACAGGGAAGGGGCTGG - Intronic
901014790 1:6222525-6222547 TGGAGAGGAATTCCAGGGGTAGG - Exonic
901211115 1:7526579-7526601 TGGACAGAAATCCAAGGGTGAGG + Intronic
903810489 1:26032496-26032518 AGGAGAGCCATGAAAGGGGTGGG + Intronic
904024315 1:27492487-27492509 GGCAGAGACAGCCAAGGGGGTGG + Intergenic
905186440 1:36200431-36200453 TGGAGAGAAATGCAAGACGTGGG + Intergenic
907554938 1:55335340-55335362 AGGTGAGCCTTCCAAGGGGTTGG + Intergenic
910454619 1:87384201-87384223 TGGAGAGAAGTCCAAGAGATTGG + Intergenic
912708631 1:111933599-111933621 TGGAGAGGCATCCAAGAAGCAGG + Intronic
915661554 1:157409617-157409639 TGGTGAGACAGCCAAGGTTTGGG - Intergenic
915768592 1:158393528-158393550 TGAAGAGACATCCAAGGATGAGG - Intergenic
917284103 1:173406817-173406839 TGGAGAGAATTCCCAGGTGTGGG + Intergenic
920198144 1:204243113-204243135 TGGCGAGACAGCCAGGGGGCAGG - Intronic
923564777 1:235068601-235068623 AGGAGTCACATCCAAGGGCTGGG - Intergenic
924876364 1:248109292-248109314 TGAAGAGACATCCCACAGGTTGG - Intergenic
924901874 1:248409702-248409724 TGGAGAAACATACAGGGGGATGG + Intergenic
1063464966 10:6237096-6237118 TGGGGAGACCTCCCAGGGGAGGG - Intergenic
1066717106 10:38298174-38298196 TGGGGGGACGTCAAAGGGGTTGG - Intergenic
1067520500 10:46998320-46998342 TGGAGATCCATCCAAGTTGTTGG - Intronic
1068295587 10:55068714-55068736 TGGAGAGACATCCAAGGTCTTGG - Intronic
1069234540 10:66054222-66054244 TGGATATACATCCAAAGGGAAGG - Intronic
1069615815 10:69805451-69805473 TGGAGGGACACCCTAGGGTTGGG + Intronic
1072471090 10:95713769-95713791 TGGAGTGAGAGACAAGGGGTGGG + Intronic
1073202717 10:101749307-101749329 TGGAAAGACAGACAAGGGCTTGG - Intergenic
1074135818 10:110625701-110625723 TGGAGAGTCATAGAACGGGTGGG - Intergenic
1074341597 10:112636092-112636114 GGGAGAGAGATCCGAGGGTTGGG + Intronic
1074427425 10:113364052-113364074 TGTAGAGACAGCCTAGGGGATGG + Intergenic
1074486377 10:113886925-113886947 TGAAGAGACAACCTATGGGTTGG + Intronic
1074693651 10:116028975-116028997 TGGAGAAGCATCCAAGAGGGAGG - Intergenic
1077195913 11:1279917-1279939 TGGAAAGACATCCAAAGAGCAGG + Intronic
1077944215 11:6877378-6877400 GAGAGAGACAACCAAGAGGTGGG - Exonic
1078020908 11:7655298-7655320 TGGAGGGACAGGCAAGGAGTGGG - Intronic
1078340033 11:10492080-10492102 AGGACAGAGATGCAAGGGGTCGG + Intronic
1081320808 11:41689604-41689626 TGAGGAGACATACATGGGGTTGG - Intergenic
1082210216 11:49491566-49491588 TGAAGAGACAACCAATGGATTGG - Intergenic
1083913334 11:65723335-65723357 TGCAGAAACAGACAAGGGGTTGG + Intergenic
1085766864 11:79290995-79291017 TGAAGAGACATGCCAGGGGCTGG + Intronic
1085831876 11:79910216-79910238 TCGAGAGATAGCCAGGGGGTGGG + Intergenic
1086217491 11:84401388-84401410 TGAAGAGACAGTCCAGGGGTTGG - Intronic
1087723029 11:101688253-101688275 TGGTGAGGTATCCTAGGGGTTGG - Intronic
1089397188 11:118144140-118144162 AGGGGAGGCATCCAAGGAGTGGG - Intronic
1090003252 11:122979770-122979792 TGGAGAGACTTCCGTAGGGTCGG + Intronic
1091261437 11:134237805-134237827 TGGAGACAGAAGCAAGGGGTTGG + Intronic
1091308613 11:134557168-134557190 TAGAGAGCCATCCTAAGGGTTGG + Intergenic
1094058274 12:26287756-26287778 TGTAGCGACGTGCAAGGGGTAGG + Intronic
1096750325 12:53754731-53754753 TGGAGAGAGTGCAAAGGGGTTGG - Intergenic
1096877600 12:54642869-54642891 TGGAGAGACATGAAAAGGGGTGG + Intergenic
1096973723 12:55686481-55686503 TGGAGTGGCATCCAAGCTGTTGG - Intronic
1096979516 12:55720230-55720252 GAGAAAGACAGCCAAGGGGTGGG + Intronic
1100489284 12:95063497-95063519 TGGAGAGCCACCAAAGGGTTTGG + Intronic
1102260471 12:111440197-111440219 TCAAGAGACCTCCAAGGGGGAGG - Intronic
1102890264 12:116553108-116553130 GGGGGAGACATCAGAGGGGTAGG + Intergenic
1103480375 12:121246727-121246749 TGCAGAGAGATGCAAGGGCTGGG - Intronic
1104898026 12:132173741-132173763 TGGAGAGACCCACAAGGGCTGGG + Intergenic
1106736822 13:32596331-32596353 TTGAGATTCATCCATGGGGTTGG + Intronic
1107112894 13:36716834-36716856 TGGAGAGACAGGCAAGGAGTTGG - Intergenic
1112212886 13:97398589-97398611 GGTAGAGACATACAAGGGGAAGG - Intergenic
1112398241 13:99052924-99052946 TGGAGAGACAGCCAATGGAATGG - Intronic
1113171183 13:107505062-107505084 TGGAGAGAAATTCCAGGGGCAGG + Intronic
1115853822 14:37608783-37608805 TGGTGATACATCAAAGGTGTGGG + Intronic
1118070575 14:62242906-62242928 TGGAGAGAAAGCCAAGGGTATGG + Intergenic
1118333531 14:64832774-64832796 TGGAGAGATAGCAAAGGGGCTGG - Intronic
1118606158 14:67505407-67505429 TCTTGAGACATCCAAAGGGTGGG + Intronic
1121434794 14:93912043-93912065 TGGAGAAACATGCAAGGATTGGG - Intergenic
1121777417 14:96599664-96599686 TGGAAAGACACCCAAGTGGATGG - Intergenic
1122002996 14:98679355-98679377 TGAAGAGACAACCCATGGGTTGG + Intergenic
1122303265 14:100744152-100744174 TGGGGAGACAACCACAGGGTGGG - Intergenic
1125893030 15:43279969-43279991 AGGAGAGACATGCATGGGGAGGG + Intronic
1128021860 15:64398650-64398672 TGTTGAGAGATCCAAGGGCTAGG + Intronic
1130033138 15:80333792-80333814 TGTGGAGACATCCAAGAGGAGGG - Intergenic
1130077219 15:80699531-80699553 TGTAGAGACATACAAAGGATGGG - Intronic
1130838753 15:87677693-87677715 TGGAGAGACAGAGAAGGTGTAGG - Intergenic
1132100670 15:99020890-99020912 TGGAAAGACATTCTAGGGGATGG - Intergenic
1133483306 16:6193256-6193278 AGGAGAGACATGCATGGGGCTGG + Intronic
1134366593 16:13584764-13584786 TGTCTAGACATCAAAGGGGTAGG + Intergenic
1135497233 16:22963186-22963208 AGGAGAGAAATTCAAGGGTTTGG - Intergenic
1136406749 16:30052828-30052850 CGGAGATACATCCAAGTGGTGGG + Intronic
1136933356 16:34437318-34437340 AGGAGAGACACCCAAGCTGTCGG + Intergenic
1136971216 16:34974496-34974518 AGGAGAGACACCCAAGCTGTCGG - Intergenic
1137801843 16:51268582-51268604 TGGAGAGACATTCCAGGGCAGGG + Intergenic
1138130800 16:54478226-54478248 TTGAGAGACAACCAATGGGTAGG - Intergenic
1138599609 16:58046800-58046822 CGGAGAGCCAGCTAAGGGGTGGG + Exonic
1141782677 16:86174325-86174347 TGGACAGCCATCGAAGGGATTGG + Intergenic
1143258694 17:5582870-5582892 TGGAGACACATCAGAGGGGCAGG + Intronic
1145009016 17:19356591-19356613 TTCAGAGCCTTCCAAGGGGTTGG - Intronic
1145750677 17:27353473-27353495 TGGAGGAACCGCCAAGGGGTCGG + Intergenic
1151063129 17:71119923-71119945 TGGAGAGAAAGCCAAGAGGCTGG - Intergenic
1151677393 17:75605709-75605731 TGGGGATCCATCCAAGTGGTGGG + Intergenic
1152579004 17:81157778-81157800 TGGAGAAGCCTCCAAGGGGCAGG + Intronic
1153358348 18:4163958-4163980 CTGAGAGACATCCAGGGGCTTGG + Intronic
1154982904 18:21518757-21518779 TAGAAAGAAGTCCAAGGGGTGGG - Intronic
1157486461 18:48090763-48090785 TGGTAAGACAGGCAAGGGGTGGG - Intronic
1157908142 18:51588071-51588093 TGCAGAGACATCTCAGAGGTTGG - Intergenic
1163626695 19:18394232-18394254 TGGAGGGAATTTCAAGGGGTGGG - Intronic
1163747936 19:19059147-19059169 GGGAGAGGCCTCCAAGGTGTGGG - Intronic
1167777126 19:51565593-51565615 GAGAAAGAAATCCAAGGGGTAGG - Intergenic
1168291270 19:55358869-55358891 TGGCGTGAGATCCAAGGAGTTGG - Exonic
926321100 2:11748865-11748887 TTGAGAGACATCCAGGTGTTAGG + Intronic
927498370 2:23565469-23565491 TGGAGTCCCAGCCAAGGGGTAGG - Intronic
927853915 2:26516273-26516295 TGGAGAGACATCCAAGGGGTGGG - Intronic
928289069 2:30021467-30021489 TGGAGAGATAGCTAAGGGCTAGG - Intergenic
929578727 2:43068583-43068605 AGGAGAGACACCAAAGGGGCAGG + Intergenic
929953995 2:46441370-46441392 AGGTGAGACATCCAGGAGGTGGG + Intronic
936005287 2:108881711-108881733 TGAAGAGAGATCCAAGGAGAGGG + Intronic
940098313 2:150004103-150004125 TGGAGAGCCATGCAATGGATTGG - Intergenic
940354087 2:152719034-152719056 TGGACAGACTTTCAAGGCGTCGG - Intronic
941839148 2:170060775-170060797 TGGAAAGAATTCCCAGGGGTGGG + Intronic
941868031 2:170354932-170354954 TGGATTGACATCCTGGGGGTGGG + Intronic
942304105 2:174589171-174589193 TGGAAAGACAGCCAAGAAGTGGG - Intronic
943198322 2:184784978-184785000 TGGGGAGACAGCCAAGGCGAAGG - Intronic
943726534 2:191257047-191257069 AGGAGAGACTTTCAAGGGGAAGG - Intronic
944667905 2:201972151-201972173 TGGAAACTGATCCAAGGGGTGGG - Intergenic
945978034 2:216285749-216285771 TGGAGAGACATGCTGGGGGAGGG + Intronic
948456401 2:238106505-238106527 TGGAGAGGCAGCCCCGGGGTGGG - Intronic
949043300 2:241859114-241859136 TGGGGAGACCCCCACGGGGTAGG - Intergenic
1172429169 20:34876170-34876192 TGGAGTGACAGATAAGGGGTTGG - Intronic
1174819385 20:53713717-53713739 TGGAGAAAACTCCCAGGGGTCGG + Intergenic
1174958189 20:55124469-55124491 TGGAGGGCCATCCAAGGAGCCGG + Intergenic
1175185624 20:57178160-57178182 TGGGGAGGCATCCAAGGGCGAGG + Intronic
1176023320 20:62973526-62973548 TGGAGGGACATGCGGGGGGTGGG - Intergenic
1177780628 21:25619215-25619237 TGGAGACACAGCAAAGGAGTTGG + Intergenic
1179010808 21:37554613-37554635 TGGACATACACCCAAGGGGCTGG + Intergenic
1179785494 21:43727671-43727693 GGGAGCGAGTTCCAAGGGGTGGG + Intronic
1180134593 21:45854079-45854101 GGGAGAGAGATGGAAGGGGTGGG + Intronic
1182953121 22:34396383-34396405 GGGAGAGACAGGCAAGGGGAGGG - Intergenic
1184426052 22:44409949-44409971 TGGGGAGAAATCCAAGGAGACGG - Intergenic
1185049009 22:48543999-48544021 AGGACAGACATCCATGGTGTGGG - Intronic
951267151 3:20581547-20581569 TGGAGAGACATCCTATGGAATGG + Intergenic
953955439 3:47228217-47228239 TGGATAGACATCCTAGGGTGGGG - Exonic
959684810 3:109133280-109133302 TGGAGAGCCAGCCAACGTGTTGG - Intergenic
960244607 3:115386477-115386499 TGAATAGACATCCAGGAGGTTGG - Intergenic
960641335 3:119826562-119826584 TTGAGGGAGATCCAGGGGGTGGG - Intronic
964170343 3:153762899-153762921 TGGTGAGATATTCATGGGGTGGG - Intergenic
965864340 3:173186291-173186313 TGGAGAGACATCCAAGCTTTTGG + Intergenic
966973128 3:185063410-185063432 TGGAGAGACAGCCTATGGGATGG + Intergenic
968614886 4:1573297-1573319 TGGAGAGACATTTTAGAGGTGGG - Intergenic
968826824 4:2904434-2904456 AGGAGAGTCATCCACGTGGTTGG + Intronic
968919447 4:3515137-3515159 TGCAGAGACAGGGAAGGGGTCGG - Intronic
968964860 4:3764737-3764759 TGGATAGGCATCCCGGGGGTAGG + Intergenic
970816862 4:20167048-20167070 TGAAGAAAGATCCAAGGGGAAGG + Intergenic
973265383 4:48205082-48205104 TTCAGAGAAATCCAAGGGTTAGG - Intronic
976931349 4:90570318-90570340 TGGAGGGAGATCCATTGGGTTGG + Intronic
983278825 4:165654295-165654317 TAGAGAGACATCCCTTGGGTTGG + Intergenic
984060576 4:174984722-174984744 AGGAGAGACTTCCAAAGGATGGG + Intergenic
986422513 5:7599064-7599086 TGTAGGGACAGCCAAGGGGCAGG + Intronic
990189876 5:53248118-53248140 TGCAGAGGAATCCAAGGTGTAGG - Intergenic
991377237 5:65978626-65978648 TGGAGAGACATTGAAGGGATAGG + Intronic
991477964 5:67043888-67043910 GAGACAGACATCCAAGTGGTTGG - Intronic
993665935 5:90696149-90696171 TGGAGAGACAATGAAGGAGTGGG - Intronic
994736043 5:103557739-103557761 AGGAGAGCCATCAAAGGAGTTGG - Intronic
996334988 5:122373841-122373863 TGGATTTACACCCAAGGGGTGGG - Intronic
997917828 5:137946525-137946547 TGTAAAGCCATCAAAGGGGTTGG - Intronic
998131817 5:139655256-139655278 TGGAGAGACAGGCCAGAGGTGGG + Intronic
999094738 5:148967840-148967862 TGTAGATACCTCCTAGGGGTTGG + Intronic
999227943 5:150042708-150042730 TGGAGAGCCACTGAAGGGGTTGG + Intronic
1001242556 5:170081484-170081506 GGGAGAGAAATCCAGGGTGTTGG + Intronic
1002821498 6:729537-729559 TGGAGTGAGATCCAAGGTTTTGG + Intergenic
1003016727 6:2473974-2473996 TTGAGAGCAATCCAAGGGGCAGG - Intergenic
1008442090 6:51543419-51543441 TGGAAAAACACCCCAGGGGTTGG - Intergenic
1013630495 6:111981659-111981681 TGGAGAGACATCCAAAGCAGAGG + Intergenic
1014231582 6:118909298-118909320 TGTAGTGACATCAAAGGGTTAGG + Intronic
1018137239 6:160789774-160789796 TGGTGAGAAATCCTGGGGGTGGG + Intergenic
1021840431 7:24717777-24717799 TGGAGTGATATGCACGGGGTAGG - Intronic
1024678026 7:51655389-51655411 AGGAGAGAAATCCACGGGATGGG + Intergenic
1025622629 7:63188007-63188029 TGGAGAGAGAGCGAGGGGGTTGG - Intergenic
1026126530 7:67584444-67584466 TGGAGAGACATTCAAGGTTCAGG + Intergenic
1032719224 7:134537156-134537178 TGGTGAGGCTTCCAAGTGGTGGG + Exonic
1032724193 7:134575926-134575948 TGGTGAGGCTTCCAAGTGGTGGG + Exonic
1033216775 7:139499268-139499290 GGGAGAGACTTCCAAGGGGAAGG - Intergenic
1034224432 7:149471751-149471773 TGGAGACCCATCCAGGGGGCAGG + Intergenic
1035619852 8:1028655-1028677 TGGAGAGCCATCCAGGAGCTAGG + Intergenic
1037748937 8:21667499-21667521 TGGAGAGAGATCCCAGTGCTGGG + Intergenic
1038904889 8:31889663-31889685 TGCAGTGACATGCAAGGGGTTGG - Intronic
1039102838 8:33958756-33958778 TGGAGAGAAATAGAAGAGGTGGG - Intergenic
1048377157 8:133832799-133832821 TAGTGAGACATCCAAGGAGAAGG - Intergenic
1049017024 8:139927800-139927822 TGGAGATTCATCCACGTGGTTGG - Intronic
1050625804 9:7502512-7502534 AGGTCAGACATCCAAGGGGGAGG + Intergenic
1053184729 9:36005894-36005916 TGAAGAGACAAGCAAGGGATGGG + Intergenic
1053268689 9:36735029-36735051 TGCAGAGCCATCCCTGGGGTTGG - Intergenic
1055114244 9:72590029-72590051 AGGAGAGGCAGCCAAGGGCTGGG - Intronic
1057184031 9:93046400-93046422 TGCAGAGACAGGCTAGGGGTGGG + Intergenic
1058906090 9:109483761-109483783 TGGAGACACCTCAAAGGGGCAGG - Intronic
1059352376 9:113674713-113674735 CGTAGAGGCCTCCAAGGGGTCGG - Intergenic
1059442790 9:114319223-114319245 TGGAAAGATTTCAAAGGGGTTGG - Intergenic
1060548742 9:124475512-124475534 GGGAGAGGGGTCCAAGGGGTAGG + Intronic
1061724788 9:132576195-132576217 GGGAGACAGATCCAAGGAGTGGG - Intergenic
1186481390 X:9898485-9898507 TGGAGACACATCCCAGGGCGGGG + Intronic
1189322948 X:40097324-40097346 TGGAGAGAGATATGAGGGGTGGG + Exonic
1190267125 X:48833622-48833644 GGGAGTGACATCCCAGGAGTGGG - Intronic
1190384682 X:49873409-49873431 TTGAGAGACACCCAAGAGGTTGG - Intergenic
1190424433 X:50319267-50319289 TGGAGAGACATACCATAGGTTGG - Intronic
1190735964 X:53256218-53256240 TGGGGAGACGTCCAAGAGCTAGG - Intronic
1192356263 X:70407058-70407080 AGGAAGAACATCCAAGGGGTAGG + Exonic
1192578403 X:72260860-72260882 TAGAGAGACAGCCATGGGGACGG - Intronic
1193345520 X:80399048-80399070 TGAAGAGACATCCTAGAGATTGG - Intronic
1195074895 X:101317318-101317340 TGAAGAGACAACCCAAGGGTGGG - Intergenic
1195574740 X:106437270-106437292 TGGAGATAAGTTCAAGGGGTGGG - Intergenic
1196599974 X:117590225-117590247 GGGAGAGACATCCCAGAGGAAGG + Intergenic
1197258010 X:124284992-124285014 TGGAGAGACATACAAGTGCCTGG - Intronic
1197990238 X:132309784-132309806 TGGAGAGATATTTAGGGGGTTGG - Intergenic
1198005047 X:132484663-132484685 TGGACAGAAATGCAGGGGGTTGG - Intronic
1198520965 X:137451911-137451933 TGGAGAGAAAACCAAGGGTATGG - Intergenic
1198641922 X:138765727-138765749 TGGGGAGACCTCAAAGGGCTCGG - Intronic
1201112312 Y:10808550-10808572 TGGAGAGGAATGCAATGGGTTGG - Intergenic