ID: 927854279

View in Genome Browser
Species Human (GRCh38)
Location 2:26518088-26518110
Sequence GAAGCCAGGACTGCAGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 413}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927854279_927854284 8 Left 927854279 2:26518088-26518110 CCTGTGGCTGCAGTCCTGGCTTC 0: 1
1: 0
2: 1
3: 40
4: 413
Right 927854284 2:26518119-26518141 TTTCTCTTGGCCACTACATAGGG 0: 1
1: 0
2: 0
3: 15
4: 138
927854279_927854283 7 Left 927854279 2:26518088-26518110 CCTGTGGCTGCAGTCCTGGCTTC 0: 1
1: 0
2: 1
3: 40
4: 413
Right 927854283 2:26518118-26518140 GTTTCTCTTGGCCACTACATAGG 0: 1
1: 0
2: 0
3: 11
4: 116
927854279_927854282 -5 Left 927854279 2:26518088-26518110 CCTGTGGCTGCAGTCCTGGCTTC 0: 1
1: 0
2: 1
3: 40
4: 413
Right 927854282 2:26518106-26518128 GCTTCTGAGGCTGTTTCTCTTGG 0: 1
1: 0
2: 4
3: 42
4: 373
927854279_927854286 24 Left 927854279 2:26518088-26518110 CCTGTGGCTGCAGTCCTGGCTTC 0: 1
1: 0
2: 1
3: 40
4: 413
Right 927854286 2:26518135-26518157 CATAGGGCCATATATTACACAGG 0: 1
1: 0
2: 0
3: 3
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927854279 Original CRISPR GAAGCCAGGACTGCAGCCAC AGG (reversed) Intronic
900479319 1:2890404-2890426 GAAGCCAGGACCCCAGACCCGGG - Intergenic
900523114 1:3115711-3115733 GAAGGCAGGACTGCAGGCCAAGG - Intronic
901072782 1:6530892-6530914 GAGGCTAGGACTGAAGCCGCAGG - Intronic
901465283 1:9417340-9417362 GCAGCAGGGTCTGCAGCCACAGG - Intergenic
902418779 1:16260827-16260849 GCAGCTAGGACTACAGTCACAGG + Intronic
902549476 1:17210801-17210823 AAAGCCAGGGTTGCAGCCAGGGG + Intronic
904034473 1:27551445-27551467 GGAGCCACGGCTGCGGCCACGGG - Exonic
904335328 1:29793564-29793586 GAAGTCAGGACCCCAGCCTCGGG + Intergenic
905184788 1:36188418-36188440 GCAGCCAGGACATCAGCCATAGG - Intergenic
905590250 1:39157097-39157119 GTAGCCAGGACTACAGTCATGGG + Intronic
907307381 1:53520844-53520866 GCAGAAAGGACTGCAGCCCCAGG + Intronic
907729530 1:57052598-57052620 GAAGACAGGAATGGGGCCACTGG + Intronic
908463215 1:64366508-64366530 GTAGCTAGGACTACAGGCACAGG + Intergenic
909651025 1:77976621-77976643 GTAGCTAGGACTACAGGCACAGG + Intronic
910228307 1:84959933-84959955 GCAGCTGGGACTACAGCCACAGG - Intronic
910352761 1:86318604-86318626 GATGCCAGAACTGAAGCCTCAGG + Intergenic
910418351 1:87026722-87026744 GAAGCCTGTACTACAGCCTCTGG + Intronic
911172005 1:94780129-94780151 AGAGCCAGGCCTGCAGGCACTGG - Intergenic
914719694 1:150279738-150279760 GAAGGTAAGAGTGCAGCCACTGG + Exonic
914929305 1:151916186-151916208 GAAGAGAGGACAGCAGCCAGAGG + Intergenic
915394756 1:155574694-155574716 GCAGCCAGAACTACAGGCACAGG + Intergenic
915669928 1:157479495-157479517 TAAGGCAGGACTGAAGCCTCAGG + Intergenic
915739237 1:158105859-158105881 GAAGGCAGAGCTACAGCCACTGG - Intergenic
916297832 1:163239354-163239376 GCAGCTAGGACTACAGGCACAGG - Intronic
916656684 1:166882923-166882945 GAAGCCAGGATTCAAGCCTCAGG - Intergenic
916900067 1:169212736-169212758 GTAGCTAGGACTACAGGCACAGG + Intronic
917088980 1:171333351-171333373 GTAGCTAGGACTACAGGCACAGG + Intronic
917371836 1:174301420-174301442 TGAGCCAGGCCTGCAGCCACAGG - Intronic
917448604 1:175127780-175127802 GCACCCAGGACTGCAGCTTCAGG - Intronic
917796947 1:178539453-178539475 GTGGCCGGGACTGCTGCCACAGG + Intronic
917800396 1:178564287-178564309 GAGGCTTGGACTGCAGCCATAGG + Intergenic
920919627 1:210287797-210287819 GTAGCTAGGACTACAGGCACAGG - Intergenic
921175208 1:212587431-212587453 GAAGTCAGGATTGCTGCCATGGG + Intronic
921372434 1:214438197-214438219 GAAGCCAGGTTGGCTGCCACAGG - Intronic
921615870 1:217266910-217266932 GTAGCTAGGACTACAGGCACTGG - Intergenic
923000944 1:230005954-230005976 GGAGACAGGACACCAGCCACTGG - Intergenic
923899059 1:238305523-238305545 CAAGCCATGAGAGCAGCCACAGG + Intergenic
923978924 1:239297978-239298000 GTAGCTAGGACTACAGGCACAGG - Intergenic
1062814315 10:488553-488575 GAAGCCAGGGCTGCGGCCTCTGG - Intronic
1062877668 10:955296-955318 CCAGCCAGGACTGCAGCCCGTGG + Intergenic
1062979002 10:1706447-1706469 GAAGCCAGAAGGCCAGCCACAGG + Intronic
1062989978 10:1806143-1806165 GAAGCCACACCTGCAGCCACGGG - Intergenic
1063157709 10:3395623-3395645 CAAGGCAGGTCTGCAGCCTCTGG + Intergenic
1063684874 10:8227505-8227527 GACGCCAGGACTGATGTCACCGG - Intergenic
1064005504 10:11695977-11695999 CAAGCCAGAACTGCAGCCCAGGG - Intergenic
1064342295 10:14498402-14498424 GAAGCCAGGGCTCCTGCCATGGG - Intergenic
1064971557 10:21072177-21072199 GAGCCAAGGGCTGCAGCCACTGG - Intronic
1066064755 10:31753959-31753981 GTAGCTAGGACTACAGACACTGG - Intergenic
1067546728 10:47197182-47197204 GAAGCCAGGAGTGGAGCTGCGGG + Intergenic
1067846116 10:49722900-49722922 GTAGCTGGGACTGCAGGCACAGG - Intergenic
1069379338 10:67826262-67826284 AAAGCTAGGACTACAGACACAGG + Intronic
1069572968 10:69505670-69505692 GTAGCTGGGACTGCAGGCACTGG + Intronic
1069881101 10:71593967-71593989 GTAGCTAGGACTGCAGGCATGGG - Intronic
1070760765 10:79023027-79023049 GATGCCAGGACTGCAGCTTCAGG + Intergenic
1070790804 10:79188269-79188291 CAAGCAATGACTGCAGCCAGAGG - Intronic
1072251745 10:93587186-93587208 CAAAACAGGACTGGAGCCACAGG - Intronic
1072407403 10:95168416-95168438 GGAGCCAAAACAGCAGCCACTGG + Intergenic
1072735361 10:97875570-97875592 GAGGCCAGAACCCCAGCCACAGG - Intronic
1072887947 10:99296937-99296959 GAAGGCAGGACAGCAGTCAGTGG + Intergenic
1073212438 10:101816131-101816153 GTAGCTGGGACTGCAGACACGGG - Intronic
1073559212 10:104482385-104482407 GAAGACACCACTGCATCCACAGG - Intergenic
1074879622 10:117645570-117645592 GGAGCCAGGATTACAGGCACAGG - Intergenic
1076567376 10:131407997-131408019 CAAGCCAGCATTTCAGCCACAGG + Intergenic
1076647082 10:131961061-131961083 CAAGCCAGGAATCCAGCCACAGG + Intergenic
1077178866 11:1203423-1203445 CAAGCCACGTCTGCAGGCACTGG + Intergenic
1077246919 11:1544131-1544153 GAGCCCATGACTGCAGCCACGGG - Intergenic
1077372288 11:2188754-2188776 GTATCCAGGACAGCAGCCGCAGG + Intergenic
1077410011 11:2399569-2399591 GATGCCAGGACAGCAGGCCCTGG + Intergenic
1078291665 11:10016614-10016636 GTAGCTGGGACTGCAGACACGGG + Intronic
1079504873 11:21142330-21142352 GAAGGCATGCCTGCAGGCACTGG - Intronic
1079683954 11:23332491-23332513 GAAGCATGGACTGCTGCCCCAGG - Intergenic
1079689745 11:23405031-23405053 GGGGCCAGGTCTGCAGCCAGTGG - Intergenic
1080032629 11:27678020-27678042 GAATTCAGGACTTCAGCCCCCGG - Intronic
1080916281 11:36663670-36663692 CAAGCCAGGACTGGTGCCACAGG - Intergenic
1081128765 11:39350701-39350723 GAAGCTGGGACTACAGGCACCGG - Intergenic
1081569899 11:44283691-44283713 GTAGCCAGGACTACAGGCATGGG + Intronic
1081909773 11:46693533-46693555 GTAGCTAGGACTACAGGCACAGG + Intronic
1083488206 11:62996567-62996589 AAGGGCAGGGCTGCAGCCACAGG + Intronic
1083734314 11:64670923-64670945 GAAGCCAGGGCACCAGCCACTGG + Intronic
1084893495 11:72249227-72249249 GTAGCTAGGACTTCAGGCACAGG + Intergenic
1085341144 11:75732379-75732401 CATGCCTGGACTGCAGCCACAGG - Intronic
1085767222 11:79293793-79293815 GAGCCAATGACTGCAGCCACAGG + Intronic
1086402220 11:86470102-86470124 GAAACTAGGTCTGCAGCCCCTGG - Intronic
1089076910 11:115745624-115745646 GAAGGCAGGACTGCTGCCCCGGG - Intergenic
1089168861 11:116498858-116498880 ACAGCCAGGACTGCAGCCTGGGG + Intergenic
1089606682 11:119645426-119645448 GAACCCAGGACCCCATCCACAGG + Intronic
1089985345 11:122807678-122807700 GTAGCTGGGACTGCAGGCACAGG + Intronic
1090195674 11:124814708-124814730 GTAGCCAAGACTACAGGCACAGG + Intergenic
1090421911 11:126581065-126581087 GGAGGCAGGACAGCAGCCATGGG + Intronic
1090623854 11:128587695-128587717 GGCACCAGGACAGCAGCCACTGG + Intergenic
1091841318 12:3623411-3623433 CATCCCAGGACTGCAGACACTGG + Intronic
1092867934 12:12780716-12780738 GTAGCTGGGACTGCAGGCACAGG + Intronic
1094342414 12:29427738-29427760 GAAGCCAGGAGAGTAGCAACAGG + Intronic
1096234982 12:49920395-49920417 GGAGCCAGGATTCCACCCACGGG - Intergenic
1096245413 12:49982329-49982351 GAGGCCAGGACAGCAGTCAGGGG + Intronic
1096387650 12:51205365-51205387 GGTGGCAGGACTGGAGCCACAGG - Intronic
1098167745 12:67715460-67715482 CATCCCAGGATTGCAGCCACTGG - Intergenic
1098879713 12:75904727-75904749 GTAGCTAGGACTACAGGCACGGG + Intergenic
1100341385 12:93683079-93683101 GAAGCCAGGCAGGCAGGCACAGG - Intronic
1100701954 12:97158590-97158612 GTAGCTAGGACTACAGGCACAGG - Intergenic
1101591236 12:106127292-106127314 GTAGCCAGGACTACAGACGCAGG + Intronic
1103097381 12:118142972-118142994 GAAGCTGGGACTACAGGCACAGG + Intronic
1103386649 12:120537734-120537756 GAAGCCAGAAAAGCAGACACTGG - Intronic
1103558793 12:121781322-121781344 CAAGCCAGGAGTGCTGGCACAGG + Exonic
1103610698 12:122122491-122122513 GTAGCCAGGACCACAGGCACAGG + Intronic
1103731913 12:123033369-123033391 GCAGCCAGGACTGCAGCAAGTGG + Intronic
1103893067 12:124254338-124254360 GGAGCCTGAACTGCAGCCGCAGG + Intronic
1104026679 12:125032642-125032664 GTAGCTGGGACTGCAGGCACAGG - Intergenic
1104539626 12:129651691-129651713 GAAGCAAGGACAGCAGCAACTGG + Intronic
1104557157 12:129811392-129811414 GAAGCCAGGACTTCAAGCATTGG - Intronic
1106059093 13:26268578-26268600 GTAGCTAGGACTACAGGCACAGG + Intronic
1106162266 13:27212179-27212201 GGAGCCAGGGCTGCAGGCGCAGG + Intergenic
1106349676 13:28917365-28917387 GAAGTCAGCAGTGAAGCCACTGG + Intronic
1106475874 13:30097628-30097650 GAGGTCAGGAGTTCAGCCACAGG - Intergenic
1106509691 13:30402197-30402219 GTAGCAGGGACTGCAGGCACAGG - Intergenic
1106553333 13:30789854-30789876 GAGGCCAGGACTGCAGACAGTGG + Intergenic
1107795893 13:44051264-44051286 GTAGCCAGGATTACAGGCACTGG - Intergenic
1107826431 13:44332680-44332702 GGAGCCAGTTCTGCAGTCACAGG + Intergenic
1108033000 13:46256427-46256449 GAAGCCAGGAGGGCAGAAACTGG + Intronic
1108826287 13:54416247-54416269 CAAGCCAGCCCTGGAGCCACAGG - Intergenic
1109475921 13:62880110-62880132 GAATCCAGCACTGAAGCCATCGG - Intergenic
1109517590 13:63464467-63464489 GAAGGCAGGCCTGCAGATACTGG + Intergenic
1110414183 13:75234387-75234409 GTAGCCAGGACTACAGGCACCGG + Intergenic
1111217451 13:85163072-85163094 CAACCCATGACAGCAGCCACGGG - Intergenic
1112416234 13:99205623-99205645 GGAGGCAGGAGGGCAGCCACAGG + Intronic
1112605118 13:100897015-100897037 GTAGGCAGGACTAAAGCCACAGG - Intergenic
1113885097 13:113654682-113654704 GAAGCCAGCCCGGCAGCCCCAGG - Intronic
1113922163 13:113919284-113919306 GAAGCCTGGCCTGCAAGCACCGG + Intergenic
1115396053 14:32909666-32909688 GAGGCCAGGCCTGCACCCATGGG - Intergenic
1115607090 14:35014229-35014251 AAAGCAAGGACTGCAGCCCAGGG - Intronic
1115643828 14:35352904-35352926 GGCCCCAGGACTGCAGCCCCAGG + Intergenic
1116679893 14:47953749-47953771 GTAGCTAGGACTACAGGCACTGG - Intergenic
1117008635 14:51447719-51447741 GGAGACAGGACTGCAGCCAGTGG - Intergenic
1117690141 14:58298183-58298205 GAACCCAGAATTGCAGCCAGGGG - Intergenic
1118597402 14:67446550-67446572 GAAGCCAGGACTGCAGTGGCTGG - Intergenic
1118612953 14:67555598-67555620 GTAGAGAGGACAGCAGCCACGGG + Intronic
1118878953 14:69810029-69810051 GTAGCTGGGACTGCAGGCACTGG - Intergenic
1119148315 14:72335556-72335578 CAAGCAAAGACTGCAGCCCCTGG - Intronic
1119726526 14:76924863-76924885 GAAGGGAGGGCGGCAGCCACAGG - Intergenic
1121806899 14:96835543-96835565 GAGTCCAGGCCTGTAGCCACTGG + Intronic
1121845826 14:97171275-97171297 GAAGGCTGGACTGCAGCCCTGGG - Intergenic
1123700090 15:22907805-22907827 GGAGCCAGGGCCGGAGCCACAGG - Intronic
1125458781 15:39888413-39888435 GCAGCTAGGACTACAGGCACAGG + Intronic
1125894976 15:43294176-43294198 GAAGCTGGGACTTCAGCCATAGG + Intronic
1126636929 15:50788889-50788911 GAAGCTGGGACTACAGGCACCGG + Intergenic
1128009438 15:64278556-64278578 GTAGTCAGGACTACAGGCACAGG + Intronic
1128153716 15:65378495-65378517 GAAGCCAAGCTTGCAGCTACAGG - Intergenic
1128213015 15:65915492-65915514 GAAGCCAGGGCTGCAGTAACAGG + Exonic
1129247926 15:74291269-74291291 GAACCTACAACTGCAGCCACAGG + Intronic
1129340475 15:74882575-74882597 CAAGCCAGTACTGGAGCCATAGG - Intergenic
1129541081 15:76347268-76347290 GGACCCAGGACTCCAGCCGCTGG - Intergenic
1129665252 15:77576026-77576048 GAACCCAAGACTGCAGACCCTGG + Intergenic
1132177329 15:99726051-99726073 GAAGACTGGGCTGCAGCCCCAGG - Intronic
1132630234 16:913788-913810 GATGTCAGGTCTGCAGCCACCGG + Intronic
1132901778 16:2259757-2259779 GTAGCTGGGACTGCAGGCACCGG - Intronic
1132981299 16:2739828-2739850 CACTCAAGGACTGCAGCCACTGG - Intergenic
1133160784 16:3910249-3910271 GAAGCCTGGACTGCGGCCGAGGG - Intergenic
1134008032 16:10831380-10831402 GTAGCAGGGACTGCAGGCACAGG - Intergenic
1135469168 16:22713761-22713783 GTAGCTGGGACTACAGCCACAGG - Intergenic
1135790892 16:25394472-25394494 TAATCCAGCATTGCAGCCACTGG - Intergenic
1136276803 16:29183615-29183637 GATGCCAGGACAGCAGCTCCCGG + Intergenic
1136282218 16:29220593-29220615 GAAGCCTGCACTTCAGCCCCAGG + Intergenic
1137613282 16:49833202-49833224 GAGCCCAGGACTCCAGCCAGGGG + Intronic
1137654229 16:50146462-50146484 GTAGCTGGGACTGCAGGCACAGG + Intergenic
1137744684 16:50812158-50812180 GGAGGCAGGGCTGCACCCACGGG + Intergenic
1137848600 16:51715653-51715675 GAAGCAAGGGCTGCAGCTAAGGG - Intergenic
1138011625 16:53386219-53386241 GCAGCCAGGACTACAGGCACTGG + Intergenic
1138489783 16:57370078-57370100 GCAGCTGGGACTGCAGGCACAGG + Intergenic
1138514228 16:57527095-57527117 GAAGAGGGGACTTCAGCCACAGG + Intronic
1139171743 16:64638624-64638646 GAAACAATCACTGCAGCCACAGG + Intergenic
1139427892 16:66894500-66894522 GGGACCAGGACTGTAGCCACAGG - Intronic
1139897113 16:70296399-70296421 GTAGCTGGGACTGCAGACACAGG + Intronic
1140843760 16:78866871-78866893 GAAGCCAAGCCTGCAGCATCAGG + Intronic
1141148477 16:81548261-81548283 GTAGCTAGGACTACAGGCACAGG + Intronic
1141160922 16:81628616-81628638 GAACCTGGGACTTCAGCCACCGG + Intronic
1142081182 16:88149675-88149697 GATGCCAGGACAGCAGCTCCCGG + Intergenic
1142086590 16:88186511-88186533 GAAGCCTGCACTTCAGCCCCAGG + Intergenic
1142514376 17:417477-417499 CCAGCCATGACTGAAGCCACAGG - Intronic
1143032703 17:3976674-3976696 GAAACCAGGACTACAGGCAGTGG - Intergenic
1143459729 17:7094532-7094554 GAAGCCAGGACTGGAGTCCTGGG + Intergenic
1143658805 17:8312436-8312458 TGAGCCAGGACTCCAGCCATGGG - Exonic
1144706367 17:17371009-17371031 GAGGGCAGGCCTGCAGCCAGAGG - Intergenic
1144747247 17:17624057-17624079 CAAGCCAAGCCTGCACCCACTGG + Intergenic
1145029774 17:19495610-19495632 GAAGCCTGGAATGCAGTCAGAGG - Intronic
1145187008 17:20803492-20803514 GTAGCTGGGACTGCAGCCTCCGG - Intergenic
1147662531 17:42124523-42124545 AAGGCCAAGACTGTAGCCACTGG - Intronic
1147774708 17:42892449-42892471 GTAGCCAGGACTACAGGCACAGG - Intergenic
1148554536 17:48570457-48570479 GCAGCCAGGACCACAGCCTCCGG + Intronic
1149477977 17:56979251-56979273 GTAGCCCGGACTGCAGACACAGG + Intronic
1150789973 17:68195971-68195993 GAGGCCAGGAGTCCAGCCCCAGG - Intergenic
1151999178 17:77634581-77634603 GTAGCCAGGATTACAGGCACTGG - Intergenic
1152407553 17:80106371-80106393 GAAGCCAGCTGTGCAGACACGGG + Intergenic
1153033797 18:739471-739493 GTAGCTAGGACTGCAGGCACAGG - Intronic
1154316050 18:13304099-13304121 GAGTCCAGGACTGCAGCAGCAGG - Intronic
1156815013 18:41299156-41299178 GAAGCCTGGACTAGAGACACAGG - Intergenic
1160237781 18:77099587-77099609 AAAGCCAGGCCTGGAGCCCCAGG - Intronic
1160574304 18:79842048-79842070 GGTGCCAGGACTGCAGCTACAGG + Intergenic
1160775954 19:855833-855855 CCAGCCCGGACTGCAGCAACAGG + Intronic
1160796331 19:947419-947441 GAGTCCAGGACGGCAGCGACAGG - Intronic
1160842164 19:1151031-1151053 GAAGCCGGGCCACCAGCCACAGG + Intronic
1161017014 19:1988098-1988120 GAAGCCAGGGCTGCAGCCTGGGG - Intronic
1161218206 19:3105220-3105242 GAAGCCAGGGATCCAGCCAGGGG - Intronic
1161275182 19:3412210-3412232 GTAGCTGGGACTGCAGGCACAGG + Intronic
1161514103 19:4687119-4687141 GAAGCCAGGGCTCCAGCTCCTGG + Intronic
1161572694 19:5039066-5039088 GAAGTGAGAACTGCACCCACTGG - Intronic
1162499167 19:11041600-11041622 GATGCCAGGCCTGCTCCCACGGG - Intronic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1164807071 19:31125256-31125278 GAAGCCAAGGCTGCATGCACTGG - Intergenic
1164918720 19:32072607-32072629 GTAGCCAGGACTACAAGCACAGG + Intergenic
1165143927 19:33719588-33719610 GGAGACTGGACTGCAGCCCCAGG + Intronic
1165185699 19:34019157-34019179 GTAGCTGGGACTACAGCCACTGG - Intergenic
1166577615 19:43857344-43857366 GTAGCTGGGACTGCAGGCACAGG + Intergenic
1166752381 19:45170471-45170493 ACAGCCAGGACGGCAGCCCCCGG + Intronic
1166834252 19:45657631-45657653 GTAGCTAGGACTACAGGCACAGG - Intergenic
1167320450 19:48794606-48794628 TCAGCCAGGACTGTAGTCACGGG - Intergenic
1167673510 19:50870320-50870342 GAAGCAAGGACTGGAACCATTGG + Intronic
925064899 2:922214-922236 GAGCACAGGCCTGCAGCCACGGG + Intergenic
925754346 2:7119479-7119501 GAGGCCAGGACAGCAGCCCTGGG - Intergenic
926062577 2:9813548-9813570 GATCCCAGGACAGCACCCACAGG + Intergenic
926405801 2:12551506-12551528 GAACCCTGGGCTGCAACCACAGG + Intergenic
927523936 2:23720619-23720641 GGAGACAGGGCTGCAGACACTGG - Intergenic
927528783 2:23774323-23774345 GTAGCTAGGACTACAGCTACAGG - Intronic
927672679 2:25082254-25082276 GCAGCCAGGATTGCGGCCACAGG + Intronic
927854279 2:26518088-26518110 GAAGCCAGGACTGCAGCCACAGG - Intronic
927961482 2:27242995-27243017 GAAGCCAGGGCTGCTGCCGTAGG + Intronic
928670939 2:33602868-33602890 GTAGCTGGGACTGCAGCCGCTGG + Intergenic
929149902 2:38738150-38738172 GCAGCCACGACTGCAACCTCAGG - Intronic
930192362 2:48472819-48472841 GTAGCTAGGACTACAGGCACAGG - Intronic
930711590 2:54555659-54555681 TAAGCCTGGTCTGGAGCCACTGG - Intronic
930791614 2:55337708-55337730 GTAGCTAGGACTACAGGCACAGG - Intronic
931290192 2:60865878-60865900 GTAGCTAGGACTACAGGCACAGG + Intergenic
931505574 2:62922776-62922798 GGAGACAGGACTGCAGAGACTGG - Intronic
932214694 2:69959110-69959132 GAAGGCAGGAGTGAAGCCCCTGG - Intergenic
932729941 2:74212394-74212416 GTAGCCAGGACTACAGGCATGGG + Intronic
933765150 2:85702811-85702833 GTAGCTAGGACTACAGGCACAGG + Intergenic
935366989 2:102305053-102305075 AAAGCACGGACTGCAGCCAAGGG + Intergenic
935732286 2:106074054-106074076 GAAGCCAGGCCTGCAGCCGGAGG - Intronic
936479001 2:112867949-112867971 GCAGCCAGGCCTGAGGCCACTGG + Intergenic
936575359 2:113648862-113648884 GAAGCCGGGAATGAAGCCACGGG + Intergenic
938001011 2:127737647-127737669 GAAGCCATGACTGAAGCCCCTGG + Intronic
938572084 2:132570164-132570186 GAAACAAGGACTGTAGACACTGG - Intronic
941911339 2:170768144-170768166 GTAGCTAGGACTACAGGCACAGG - Intergenic
942661694 2:178272081-178272103 GAACACAGGACTGCAGACAGTGG + Intronic
945879588 2:215312128-215312150 GGAGCCATGGCTGCAGGCACTGG - Exonic
946190104 2:218003434-218003456 GAGGCCAGGAAGGCAGGCACGGG - Intergenic
947665892 2:231905084-231905106 GAAGCCAGGCCCTCAGGCACTGG - Intergenic
947991762 2:234494023-234494045 GAAGCCAGAACTTCTGCCTCTGG + Exonic
948001188 2:234568879-234568901 GTAGCTAGGACTACAGGCACGGG + Intergenic
948634052 2:239322794-239322816 GAAGCCAGGAGTGGGGCCCCGGG - Intronic
948850485 2:240703066-240703088 AAAGCCTGGACTTCAGCCCCTGG - Intergenic
948876829 2:240833919-240833941 GGAGACAGGACATCAGCCACTGG + Intergenic
948909983 2:240998204-240998226 GACGCCAGGCTTCCAGCCACAGG - Intergenic
1168889225 20:1283278-1283300 GGGGCCAGGACTGCAACCCCAGG - Intronic
1169343235 20:4811743-4811765 GAAGCCAGAACCCCAGCCCCAGG + Intronic
1170969559 20:21104551-21104573 GCAACCAGGTCTGCAGCCGCTGG + Intergenic
1171139380 20:22728040-22728062 AAGGCCAAGACTGTAGCCACTGG + Intergenic
1171266237 20:23774277-23774299 GAAGGCAGGAATGAAGCCCCAGG - Intergenic
1171275990 20:23856924-23856946 GAAGGCAGGAATGAAGCCCCAGG - Intergenic
1171487586 20:25495517-25495539 AGGGCCAGGACTGCAGCCTCGGG + Intronic
1171562557 20:26138044-26138066 GTAGCTGGGACTGCAGGCACAGG + Intergenic
1171795493 20:29562688-29562710 GAATCCAGGACTGAGGCCACAGG - Intergenic
1172038733 20:32028982-32029004 GGAGCCATTACTGCAGGCACGGG - Exonic
1172125457 20:32622797-32622819 AGAGCCAGGACTGCAGCGACGGG - Intergenic
1172404682 20:34679093-34679115 GTAGCTGGGACTGCAGGCACAGG - Intergenic
1172524389 20:35589781-35589803 GAAGCTGGGACTGCAGGCACTGG + Intergenic
1172973181 20:38888286-38888308 GAAGCCAGGCGTGCAGGCCCAGG - Intronic
1173207707 20:41007558-41007580 CAAGCCAGGGCTGCAGACCCAGG - Intergenic
1173424437 20:42930610-42930632 GTAGCTAGGACTACAGGCACAGG + Intronic
1173993701 20:47321988-47322010 GTAGCTAGGACTACAGGCACAGG + Intronic
1174011969 20:47456987-47457009 GTAGCTGGGACTGCAGGCACCGG + Intergenic
1174209507 20:48866357-48866379 GCAGCCAGGCCTTGAGCCACAGG - Intergenic
1174403123 20:50286691-50286713 GAAGCCAGGTCCCCAGCCAGGGG + Intergenic
1174782152 20:53399716-53399738 GCAGCCAGGTCAGCAGCGACTGG - Intronic
1175607061 20:60319651-60319673 GGAGCCACCACTGCAGGCACAGG - Intergenic
1175928024 20:62480439-62480461 GTACCCAGGACTCCACCCACAGG - Intergenic
1176133614 20:63508531-63508553 GAAGCCAGGTCGGCAGCTTCTGG - Intergenic
1178410855 21:32362706-32362728 GAAGCCTGGTCTTCAGCCATAGG + Intronic
1178568346 21:33710206-33710228 GTAGCTGGGACTGCAGGCACCGG + Intronic
1178620290 21:34168182-34168204 GTAGCTAGGACTACAGACACCGG + Intergenic
1179644740 21:42768586-42768608 GAAGCAAGGACTGCAGAAGCAGG + Intronic
1180588854 22:16918527-16918549 GCAGCCAGGAATCCAGTCACAGG - Intergenic
1180980015 22:19873966-19873988 GAGGCCAGCACTGCTGCCCCAGG - Intergenic
1181472036 22:23146334-23146356 GTAGCTGGGACTGCAGGCACAGG + Intronic
1181597018 22:23922392-23922414 GAGGGCAGGCCTGCTGCCACAGG - Intergenic
1181645217 22:24227374-24227396 GTAGCTAGGACTTCAGGCACAGG + Intronic
1181795951 22:25310726-25310748 GTAGCTAGGACTACAGGCACAGG + Intergenic
1181836484 22:25614255-25614277 GTAGCTAGGACTACAGGCACAGG + Intronic
1182208101 22:28648777-28648799 CTAGCCAGGACTACAGGCACAGG - Intronic
1184253597 22:43274789-43274811 GCAGCCGGGACTCCAGCCCCAGG - Intronic
1185317286 22:50184666-50184688 GGGGCCAGGACTCCAGTCACCGG - Intergenic
1185424823 22:50762032-50762054 GAAGCCGGGAATGAAGCCACAGG - Intergenic
949907778 3:8873033-8873055 GTAGCTAGGACTGCAGGCAGGGG - Intronic
950109851 3:10412062-10412084 AAAGCCAAGGCTGCAGACACAGG - Intronic
950888324 3:16380403-16380425 GAGGCGAGGACTCCAGACACAGG + Intronic
951560736 3:23963990-23964012 GAAACAAGGACTGCAGATACAGG - Intronic
953366843 3:42352452-42352474 GATGCCAGGGCGGCAGCCATGGG + Intergenic
954045879 3:47929998-47930020 GTAGCTGGGACTGCAGGCACAGG - Intronic
960058841 3:113298067-113298089 GAGGCCAGGCAGGCAGCCACAGG - Intronic
960701742 3:120446358-120446380 GAAACCAGGACTCCATCCCCAGG - Intronic
961117894 3:124347465-124347487 GAAGGCAGCCCAGCAGCCACAGG - Intronic
961374827 3:126457187-126457209 GCTGCCAGGACTGCGGCCACAGG + Intronic
961627042 3:128271291-128271313 AAAGCCAGCTCTGCAGCCTCGGG - Intronic
961756449 3:129130007-129130029 GGACCCAGGGCTGCAGACACAGG - Exonic
962239999 3:133744215-133744237 GAGGCCAGTCCTCCAGCCACAGG - Intergenic
963383227 3:144557912-144557934 TTAGCTAGGACTACAGCCACTGG - Intergenic
963764451 3:149319803-149319825 GAAGCCAAGAATGAAGCAACCGG - Exonic
964585997 3:158302789-158302811 GTAGCTGGGACTGCAGGCACCGG + Intronic
966809445 3:183830378-183830400 GAAGCCTGTGCTGCAGGCACTGG + Intronic
969343223 4:6555563-6555585 GCAGCCAGGCCTGCAGCCGCAGG + Intronic
969504909 4:7579541-7579563 GAATCCAGGAGAGCAGCCAAAGG - Intronic
969870191 4:10099694-10099716 GAAGCCCGGTCTGCAGGCCCAGG - Intronic
971009517 4:22418223-22418245 GAAGCCAGGTATGAAGTCACTGG + Intronic
971037682 4:22712772-22712794 GAAACCAGGACTGCAGTCGTCGG + Intergenic
971750347 4:30638998-30639020 CAAGATAGGACTCCAGCCACTGG + Intergenic
972280985 4:37602085-37602107 GTAGCTGGGACTGCAGGCACAGG - Intronic
972281263 4:37603946-37603968 GTAGCTGGGACTGCAGGCACGGG + Intronic
972343894 4:38176736-38176758 GTAGCTGGGACTGCAGGCACCGG - Intergenic
972581053 4:40395997-40396019 GATGGCAGGACTCCAGGCACAGG - Intergenic
973542303 4:51946691-51946713 GAACCCATGAAAGCAGCCACTGG + Intergenic
974035677 4:56815971-56815993 GAAGCTAGGACTACACACACAGG - Intronic
975460757 4:74650954-74650976 GAAGCTGGGACTACAGGCACGGG - Intergenic
976122794 4:81801284-81801306 GATGCCAGAAATGCAACCACAGG + Intronic
976617888 4:87096675-87096697 GTAGCTAGGACTACAGGCACAGG + Intronic
977641444 4:99362030-99362052 GAGGGTAGAACTGCAGCCACAGG + Intergenic
978112059 4:104975785-104975807 AAGGCCGGGACTGCAGTCACTGG - Intergenic
980503122 4:133682484-133682506 GAAGCAAGGGCTGCTGCCCCTGG - Intergenic
981080593 4:140635806-140635828 GCAGCCAGGAATGCAGTCCCAGG - Intronic
981823617 4:148914520-148914542 GCAGCCAGGACTGCAGCAACAGG + Intergenic
982115403 4:152094788-152094810 GAAGCCAGGGCTGAGGACACAGG - Intergenic
982251760 4:153414124-153414146 GAGGCCAGGACTGTTGCCTCAGG - Intronic
982259020 4:153477331-153477353 GAGGCCAGGGCTGCAGACCCAGG + Intronic
983227361 4:165097742-165097764 GTAGCTAGGACTACAGGCACAGG + Intronic
984041782 4:174744155-174744177 CAACCCAGCATTGCAGCCACTGG + Intronic
984059541 4:174975438-174975460 GAAGTCAGGGCTGGAGTCACAGG - Exonic
985347369 4:189020233-189020255 AAAGACAGAACTGCAGCCTCAGG + Intergenic
985529056 5:423136-423158 GAGGCCAGGACTGCAGCTCGTGG - Intronic
985661488 5:1159228-1159250 GAAGACAGGACTGGAGACACAGG + Intergenic
985670388 5:1203764-1203786 GAAGCCCACACTGCAGCCAGAGG + Intronic
986330194 5:6712317-6712339 GAAGACAGGGCGGCAGCCGCGGG + Intergenic
986690194 5:10307752-10307774 GAGGCTACGACTGGAGCCACTGG - Exonic
986946558 5:13028956-13028978 GTAGCTAGGACTACAGGCACCGG - Intergenic
987263712 5:16229447-16229469 CAACCCAGGACGGCAGCCAAGGG + Intergenic
990775331 5:59299980-59300002 GTAGCCGGGACTACAGGCACGGG - Intronic
991297741 5:65099694-65099716 GTAGTGAGTACTGCAGCCACAGG - Intergenic
992438300 5:76776078-76776100 GTAGCTGGGACTGCAGGCACCGG + Intergenic
992624700 5:78626544-78626566 GAAGGCAAGACTCCAGCCAGGGG - Intronic
993523000 5:88928083-88928105 GTAGCCAGGATTACAGGCACGGG + Intergenic
995542397 5:113197807-113197829 GAAGCCAGGACTTGAGCCCAAGG + Intronic
998271511 5:140710674-140710696 GTAGCTAGGACTACAGGCACAGG - Intergenic
998382144 5:141733370-141733392 AAACCAAGGATTGCAGCCACCGG + Intergenic
999177146 5:149639636-149639658 GAAGCCAGGGCTGCAGGGAGGGG + Intergenic
999304322 5:150509856-150509878 CAAGGCAGGACTTCAGCCAGAGG - Intronic
1000061475 5:157660290-157660312 GTAGCTAGGACTACAGGCACAGG - Intronic
1001019802 5:168173288-168173310 GAAACCAGGACTCCAGTCTCAGG - Intronic
1001089603 5:168727593-168727615 GAGGCCATGACTGCAGACAAGGG + Intronic
1001514098 5:172342907-172342929 GAACCCAGGACTGCAGGCCCAGG - Intronic
1001562274 5:172677507-172677529 GAAGGCTGGACTGCAGACACAGG - Intronic
1003539973 6:7010050-7010072 GTAGCTGGGACCGCAGCCACAGG - Intergenic
1003569885 6:7248778-7248800 CCACCAAGGACTGCAGCCACAGG + Exonic
1003585614 6:7386556-7386578 CTAGCCAGGAGTGCAGCCAGGGG - Intronic
1003944837 6:11065462-11065484 GAAGTCAAGACTGCAGCAACTGG - Intergenic
1005185926 6:23163055-23163077 GAAGCCACCACTGGGGCCACAGG + Intergenic
1005535402 6:26750097-26750119 GAAGCCAGGAGTGAAGCTTCTGG + Intergenic
1005637130 6:27762895-27762917 GAGGACAGGGCTCCAGCCACCGG + Intergenic
1006602071 6:35232922-35232944 AAAGCCAGGACGGCATTCACAGG - Exonic
1006619529 6:35353631-35353653 GAAGCAAGGAGTGGAGCCAGAGG + Intronic
1007953292 6:45892525-45892547 AAAGCCCGCACTGCACCCACAGG - Intergenic
1009006436 6:57793730-57793752 GAAGCCAGGAGTGAAGCTTCTGG + Intergenic
1010012135 6:71060395-71060417 GTAGCTGGGACTGCAGGCACAGG + Intergenic
1010187816 6:73163266-73163288 GTAGCTAGGACTACAGGCACAGG - Intronic
1013490739 6:110644160-110644182 GTAGCTAGGACTACAGGCACGGG - Intronic
1015952341 6:138565811-138565833 GTAGCTAGGACTACAGGCACAGG - Intronic
1016167512 6:140965526-140965548 GTAGCTAGGACTACAGACACCGG + Intergenic
1017030626 6:150218271-150218293 GTAGCTAGGACTACAGGCACCGG - Intronic
1017626204 6:156351685-156351707 GGAGCCTGGACTTCAGGCACTGG + Intergenic
1018277012 6:162143818-162143840 GAAGACAGGAGTGAAGCGACGGG + Intronic
1018476948 6:164151694-164151716 GAAGCCACCACGGCAGACACTGG + Intergenic
1018643452 6:165926615-165926637 CAAGCCAGGCTTCCAGCCACTGG + Intronic
1019136651 6:169912636-169912658 GAAGCCAGGACTCCAGAAAGTGG - Intergenic
1019316345 7:388713-388735 AGCGCCAGGCCTGCAGCCACAGG + Intergenic
1019618869 7:1979833-1979855 GGAGCCGGGTCTGCAGCCGCAGG - Intronic
1019980781 7:4620333-4620355 GTAGCCGGGACTACAGGCACCGG - Intergenic
1020375915 7:7486760-7486782 TAAGCCAGGCTTGCATCCACAGG + Intronic
1021316027 7:19147994-19148016 GTACCTAGGACTGCAGGCACTGG + Intergenic
1022799523 7:33762300-33762322 GAAGCCAGGATTTCAGCCCAAGG + Intergenic
1024524944 7:50340062-50340084 GAAGCCACCCCTGCAGGCACAGG - Intronic
1024668148 7:51566018-51566040 TCAGCCAGGACTGCAGGCAGGGG - Intergenic
1026292271 7:69018424-69018446 CAACCCACGACAGCAGCCACAGG - Intergenic
1026521112 7:71118909-71118931 GAGGGCAGGACAGCAGGCACTGG - Intergenic
1026682678 7:72479679-72479701 GTAGCTAGGACTACAGGCACAGG + Intergenic
1026914162 7:74109895-74109917 GAGGCCAGGACTGGATCCCCAGG - Intronic
1027131855 7:75596857-75596879 GAGGCCAGGCCTGCAGCGGCAGG - Intronic
1028851861 7:95546771-95546793 GAAGGCAGGGCTGCCGGCACAGG + Intergenic
1029270172 7:99372895-99372917 GAAGCCAGGGAAGCAGCAACAGG + Intronic
1029472858 7:100765460-100765482 GAAGCCCGGATTGCATTCACAGG - Exonic
1029597134 7:101543926-101543948 GGGGCCAGGCCTGGAGCCACTGG + Intronic
1029624171 7:101709387-101709409 GAGGCCAGGACTGGAGGCAGAGG + Intergenic
1030187431 7:106777645-106777667 GAGGCCAGGACAGCAGCCTGGGG + Intergenic
1031977744 7:128104503-128104525 GAGGCCCAGACTGCAGCCTCCGG + Intergenic
1032458777 7:132093991-132094013 GAAGCCATGTCTCCAGCCCCAGG - Intergenic
1034167173 7:149034394-149034416 GTAGCTAGGACTACAGGCACAGG + Intergenic
1034367298 7:150562200-150562222 ACAGCCACGACAGCAGCCACAGG - Intergenic
1034424557 7:151007675-151007697 GAGGCCAGCACAGAAGCCACAGG + Intronic
1035905928 8:3510257-3510279 GAAGCCTGGGCTGCAGGCAAGGG - Intronic
1037959761 8:23087635-23087657 GTAGCTAGGACTACAGGCACAGG - Intronic
1038337228 8:26655364-26655386 GAAGCTGGGACCACAGCCACAGG - Intronic
1038408871 8:27342793-27342815 GGAGCCAGGACTCCATCCTCAGG - Intronic
1038697622 8:29819892-29819914 TGTGCCAGGACTGCAGCCTCAGG + Intergenic
1039400350 8:37263737-37263759 GGACCCGGGACTGCAGCAACAGG - Intergenic
1039581991 8:38674630-38674652 CAAGCAAGGCCAGCAGCCACTGG - Intergenic
1039848019 8:41339951-41339973 GAAGCCAGGACTGAGGCCCCAGG + Intergenic
1040593540 8:48817559-48817581 GAAGCTGGGACTACAGGCACCGG - Intergenic
1041170005 8:55131837-55131859 ATAGCCAGGACTGCAGGCATTGG + Intronic
1041484543 8:58359683-58359705 CAATCCAGGACTGAAGCCAATGG + Intergenic
1041731606 8:61068696-61068718 CAAGCCAGGCCTCCAGCCAGGGG + Intronic
1041765251 8:61412040-61412062 GAGGCCAGGCCTCCATCCACTGG - Intronic
1042392430 8:68251409-68251431 CAAGGAAGGTCTGCAGCCACTGG + Intergenic
1043571613 8:81609973-81609995 GAAGCAAGGACTGTAACCATGGG - Intergenic
1044541735 8:93416127-93416149 GAGGCCAGGACTGGAGACATAGG + Intergenic
1045657073 8:104398398-104398420 GCAGCCAGGACTGATGCCCCAGG - Intronic
1046624125 8:116559117-116559139 GTAGCCAGGACTACAGGCATGGG + Intergenic
1047268299 8:123329631-123329653 GTAGCTGGGACTGCAGGCACCGG - Intronic
1049175185 8:141188094-141188116 GTAGCCGGGACTACAGCCATGGG - Intronic
1049761692 8:144334559-144334581 AAAGCCAGGACTGCCGGCCCAGG + Intronic
1049808146 8:144550655-144550677 GAAGTCAGGGCAGCAGCCAGGGG + Intronic
1051344558 9:16140343-16140365 GATGCCAGGACACGAGCCACCGG - Intergenic
1053121072 9:35547868-35547890 GAAGCCAGAAGTCCAGCCAGAGG + Exonic
1056548984 9:87635909-87635931 GAAGCCAGGGCTGGAGACCCAGG + Intronic
1056664196 9:88568147-88568169 TAGCCCAGCACTGCAGCCACAGG + Intronic
1056683122 9:88737343-88737365 GAAGCCAAGACAGAAGCCACAGG + Intergenic
1056716775 9:89037938-89037960 TAAGGCAGGTCTGCACCCACTGG + Intronic
1056782278 9:89559746-89559768 GATGCCAGGACTGGAGCAATGGG + Intergenic
1057179316 9:93021358-93021380 GGAGTCAGGGCTGCAGCCCCAGG + Intronic
1057494950 9:95553471-95553493 GCAGCCAGCACTGCAGACTCCGG + Intergenic
1059895150 9:118856009-118856031 GCAGCCAGCACTGCAGCTGCAGG + Intergenic
1060075988 9:120591073-120591095 GTGGCCAGGACGGCATCCACAGG - Intergenic
1060408355 9:123383729-123383751 GGAGGCCGCACTGCAGCCACTGG - Exonic
1060751354 9:126171555-126171577 GTAGCTAGGACTACAGGCACAGG + Intergenic
1061619860 9:131804922-131804944 GAAGCTAGGGCTGCAGGCAGGGG - Intergenic
1062035920 9:134382488-134382510 AAAGCCAAGACAGCAGCCAGGGG - Intronic
1062238583 9:135524208-135524230 GGAGCCACGGCTGCAGGCACAGG + Intronic
1062275901 9:135730526-135730548 GAAGCAAGGACTGGAGCGATGGG + Intronic
1062494844 9:136826859-136826881 GAAGCCAGAGCTGGAGGCACAGG - Intronic
1062710366 9:137972025-137972047 GAAGCCAGGACTCCCCCCTCAGG - Intronic
1186361399 X:8845638-8845660 TAATCCATGACTCCAGCCACTGG + Intergenic
1187806345 X:23125727-23125749 GTAGCCAGGACTACAGGTACAGG + Intergenic
1196020071 X:110982139-110982161 GAGGTCAGGGCTGCAGCCAGAGG + Intronic
1196245348 X:113392535-113392557 GTTGCCAGAGCTGCAGCCACTGG + Intergenic
1196871052 X:120113966-120113988 GTAGCTGGGACTGCAGGCACAGG - Intronic
1198872868 X:141194165-141194187 CCAGCCATGACAGCAGCCACCGG + Intergenic
1199275628 X:145938944-145938966 GAAGCCAAGAATGCAGCCTTTGG - Intergenic
1199397708 X:147359084-147359106 GTAGCCAGGACTACAGGCATGGG - Intergenic
1200075091 X:153546857-153546879 CAACCCAGGGCTGCAGCCATCGG - Intronic
1200240328 X:154490038-154490060 GGCACCAGGACTGAAGCCACCGG + Intronic