ID: 927863295

View in Genome Browser
Species Human (GRCh38)
Location 2:26573740-26573762
Sequence GCGGCGCCTCTGTGGCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927863292_927863295 -3 Left 927863292 2:26573720-26573742 CCAGGGTCACGGTGTCAAGGGCG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 927863295 2:26573740-26573762 GCGGCGCCTCTGTGGCATCCAGG 0: 1
1: 0
2: 0
3: 6
4: 101
927863289_927863295 0 Left 927863289 2:26573717-26573739 CCGCCAGGGTCACGGTGTCAAGG 0: 1
1: 0
2: 0
3: 11
4: 105
Right 927863295 2:26573740-26573762 GCGGCGCCTCTGTGGCATCCAGG 0: 1
1: 0
2: 0
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927863295 Original CRISPR GCGGCGCCTCTGTGGCATCC AGG Intronic