ID: 927864330

View in Genome Browser
Species Human (GRCh38)
Location 2:26579070-26579092
Sequence CACAGATGTCAGACAGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927864330_927864334 16 Left 927864330 2:26579070-26579092 CCCAGGTCTGTCTGACATCTGTG 0: 1
1: 0
2: 3
3: 37
4: 269
Right 927864334 2:26579109-26579131 CTGTGCCATTATGTAAATACAGG 0: 1
1: 0
2: 0
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927864330 Original CRISPR CACAGATGTCAGACAGACCT GGG (reversed) Intronic
902235625 1:15055593-15055615 GACAAAAGTCAGACAGAACTGGG + Intronic
902633673 1:17720722-17720744 CCCTGGTGTCAGACAGACTTGGG + Intergenic
902776895 1:18680597-18680619 CAGTGAGGTCAGACGGACCTGGG - Intronic
903334744 1:22617355-22617377 CTCGGAGGTCAGACAGAACTCGG - Intergenic
903578197 1:24352140-24352162 CAGACATTTCAGACAGTCCTGGG - Intronic
903993636 1:27290851-27290873 CAGTGAAGTCAGACAGACCTGGG + Intronic
904283609 1:29438869-29438891 CAGAGGAGTCAGAAAGACCTGGG - Intergenic
904700912 1:32357605-32357627 CTCTGATGTCAGTCAAACCTTGG - Intronic
904899180 1:33842948-33842970 GAAAGATGCCAGACAGACCATGG - Intronic
904981910 1:34511018-34511040 CCCAGATCTCATACAGAGCTGGG + Intergenic
905407881 1:37748856-37748878 CTTTGAGGTCAGACAGACCTGGG + Intronic
906279651 1:44544314-44544336 CTCTGGAGTCAGACAGACCTGGG + Intronic
906929678 1:50156764-50156786 CCCAGCTGGCAGACAGACATGGG - Intronic
907170940 1:52463995-52464017 CTCTGGAGTCAGACAGACCTGGG + Intronic
907340445 1:53731542-53731564 CTCTGCTGTCAGACAGACCTGGG + Intronic
907575371 1:55521411-55521433 CACAGGCATCAGACAGGCCTGGG + Intergenic
907771823 1:57473140-57473162 GCCAGTAGTCAGACAGACCTAGG + Intronic
908656957 1:66398163-66398185 CACAGCTGTGATTCAGACCTGGG - Intergenic
909146018 1:71932662-71932684 CACTGATGTCAAACATACATTGG - Intronic
909494404 1:76262302-76262324 CACTGGTGTCAGGCAGAGCTGGG - Intronic
909846579 1:80401270-80401292 CCCTGAAGTCAGAAAGACCTGGG + Intergenic
910516922 1:88072393-88072415 CTCTGGAGTCAGACAGACCTGGG + Intergenic
910918568 1:92318410-92318432 CTTGGATATCAGACAGACCTGGG - Intronic
911052882 1:93686631-93686653 AGCAGGGGTCAGACAGACCTGGG - Intronic
913024179 1:114819318-114819340 CACAGATGTGATTCAAACCTAGG - Intergenic
914420278 1:147522559-147522581 CACAGATGTCTGAAGGAACTGGG - Intergenic
914437870 1:147676052-147676074 CCCAGATGCCAGACAAACATGGG - Intergenic
915076394 1:153311453-153311475 CTCTGGAGTCAGACAGACCTGGG - Intergenic
917222652 1:172748433-172748455 CGCAGAGGTCAGAGAGCCCTTGG + Intergenic
917802852 1:178585951-178585973 TAAAGAAATCAGACAGACCTGGG + Intergenic
922731055 1:227948894-227948916 CACACATTCCAGACAGACCTGGG + Intergenic
923453182 1:234139102-234139124 CACTGAGGTCAGACAGACTGAGG + Intronic
923470300 1:234284330-234284352 CATAGAAGTCAGACACATCTGGG - Intronic
924561565 1:245160489-245160511 CACAGATATCAGAATGATCTAGG - Intronic
1062955523 10:1538088-1538110 CACAGATGACACAGAGGCCTGGG + Intronic
1063211070 10:3881888-3881910 GCCAGATGTGAGACAGACATGGG + Intergenic
1064356733 10:14625547-14625569 CACAGCTGCCAGGCAGAGCTGGG - Intronic
1064613460 10:17127811-17127833 CGTAGATGTCAGACTTACCTTGG + Exonic
1068443904 10:57095590-57095612 CACAGGACTCAGACAGACTTTGG + Intergenic
1068500300 10:57834998-57835020 CACAGATGTCCTACAGGGCTAGG + Intergenic
1070058139 10:72954762-72954784 CCCAGATGTCAGGCAGGACTGGG + Exonic
1071460231 10:85886946-85886968 CACAGATGTTTGATAGATCTAGG - Intronic
1072282617 10:93881734-93881756 CACAGATGTGGGACAGAGCAGGG - Intergenic
1072805899 10:98423967-98423989 CACCCAGGACAGACAGACCTGGG + Intronic
1073477876 10:103766218-103766240 CACAGTGATCAGTCAGACCTTGG - Intronic
1074848168 10:117417192-117417214 CAGAGATGTCAGCCACTCCTTGG - Intergenic
1075797069 10:125128277-125128299 CACAGATGTCAGAAAGAACCAGG + Intronic
1076251237 10:128985224-128985246 CAGAGGTGTCAGCCAGCCCTAGG + Intergenic
1078181254 11:9013372-9013394 CACAGTGGTCAGACCCACCTTGG + Intergenic
1078479134 11:11660820-11660842 CACACATGGCAGACAGAGCCTGG + Intergenic
1079890152 11:26042289-26042311 CACAGAGTTCAGACAGAAATGGG + Intergenic
1079983520 11:27176845-27176867 TCCTGATGTTAGACAGACCTGGG + Intergenic
1080028978 11:27641139-27641161 CCTGGCTGTCAGACAGACCTGGG - Intergenic
1082809806 11:57472855-57472877 CTCTGGAGTCAGACAGACCTGGG - Intronic
1083324976 11:61868713-61868735 CTCTGGGGTCAGACAGACCTAGG - Intergenic
1083325669 11:61871859-61871881 CACTCAAGTCAGACAGACTTGGG - Intergenic
1083506469 11:63162040-63162062 TACAGATGTCAAACAGTCATAGG - Intronic
1084863264 11:72036297-72036319 CATGGTTTTCAGACAGACCTGGG + Intronic
1085126907 11:74008190-74008212 TTCAGATGTCAGACAAACGTGGG - Intronic
1085792159 11:79505510-79505532 CACAAATCACAGAAAGACCTGGG - Intergenic
1087136789 11:94729194-94729216 CTTTGAAGTCAGACAGACCTGGG + Intronic
1087561617 11:99797041-99797063 CACAGATGTCAGGCAGAAGAGGG - Intronic
1087918059 11:103832477-103832499 CACACAGGTAAGAAAGACCTAGG + Intergenic
1088493580 11:110410512-110410534 CACAGTTGTCAGAAAAAGCTTGG + Intergenic
1089870048 11:121664538-121664560 CATAGATGTCAGAGAGAAGTTGG + Intergenic
1091111478 11:132972918-132972940 TCCAGGTGCCAGACAGACCTAGG - Intronic
1091688326 12:2579159-2579181 CATGGCTGTCAGACATACCTGGG + Intronic
1091953553 12:4615972-4615994 CAGAGAGGCCAGGCAGACCTTGG + Intronic
1094526739 12:31236061-31236083 CCCAGTTGTCAGACAGACATGGG - Intergenic
1096137274 12:49212878-49212900 CACAGAAGGCAGACAGACACAGG + Intronic
1098225042 12:68312594-68312616 CACAGCAGCCAGAAAGACCTTGG + Intronic
1098535443 12:71589231-71589253 CTCAACTGCCAGACAGACCTGGG + Intergenic
1098711026 12:73762046-73762068 TACAGATGACAAACAGACATAGG - Intergenic
1100278754 12:93097361-93097383 CATAGATGACAGACACACTTTGG - Intergenic
1100350393 12:93775631-93775653 GACAGGTGTCAGACAAGCCTGGG - Intronic
1100568541 12:95823193-95823215 CTCTGAAGTCAGACAGACCTGGG + Exonic
1100723609 12:97385526-97385548 CACAGATGTCTGAAAGAGATGGG + Intergenic
1101532179 12:105583414-105583436 CAGAGGAGTCAGGCAGACCTGGG - Intergenic
1101654706 12:106709683-106709705 CTTTGGTGTCAGACAGACCTGGG - Intronic
1102010833 12:109617407-109617429 CAAGGATGTCAGACACGCCTGGG + Intergenic
1102452064 12:113049346-113049368 CTCCGAGGTCAGCCAGACCTGGG + Intergenic
1102580521 12:113883694-113883716 CTCAGAAACCAGACAGACCTGGG - Intronic
1103508471 12:121457028-121457050 CCCACAGGTAAGACAGACCTCGG + Intronic
1104640620 12:130464726-130464748 CTCAGAGGCCAGAGAGACCTGGG - Intronic
1106834144 13:33615530-33615552 CACAGAGCTAAGACAGAACTGGG + Intergenic
1107638632 13:42418538-42418560 CTCTGAAGTCAGACAGACCTGGG + Intergenic
1107709505 13:43137901-43137923 GTTAGATGTCAAACAGACCTGGG - Intergenic
1108242495 13:48480393-48480415 CAAAGTAGTCAGACAGGCCTGGG - Exonic
1108269924 13:48749372-48749394 TACTGATGTCAGACAGGCCTGGG + Intergenic
1110549017 13:76791094-76791116 CACAGATGATACACAGGCCTTGG + Intergenic
1110614233 13:77523243-77523265 AACAGATGTAAAATAGACCTTGG + Intergenic
1114313225 14:21486546-21486568 GACTGCTGTCAGAGAGACCTGGG - Intronic
1117177680 14:53161795-53161817 TGCAGATGACAGACAGAGCTAGG + Intergenic
1118488805 14:66239137-66239159 CACAGATCCCAGGCAGTCCTGGG - Intergenic
1118617694 14:67586093-67586115 AACAGCTGTCAGACCTACCTTGG - Exonic
1118648719 14:67867389-67867411 CAGTGATGACAGAGAGACCTAGG + Intronic
1119605132 14:76009204-76009226 CTCAGGTATCAGACACACCTGGG + Intronic
1120301348 14:82711445-82711467 AACAGATGCCAGACAGCCCTGGG + Intergenic
1120591669 14:86381552-86381574 CCCAGGAGTAAGACAGACCTGGG - Intergenic
1123918075 15:25051925-25051947 CCCAGACCTCAGGCAGACCTTGG + Intergenic
1123918965 15:25057290-25057312 CCCAGACCTCAGACAGACCTTGG + Intergenic
1125028496 15:35053703-35053725 CACAGATCTCAGTTAGCCCTCGG - Intergenic
1125059713 15:35404494-35404516 CACAAGTGTCAAACAGACATAGG - Intronic
1125191379 15:36997913-36997935 CACAGGTTTCAGCCTGACCTCGG - Intronic
1125893663 15:43284461-43284483 CCCAGAAGTCAGACAGAGCCTGG - Intronic
1126141024 15:45438818-45438840 CATAGATTTCAAACAGAGCTGGG - Intronic
1127661754 15:61106029-61106051 CACTGGTGTCAGGCAGACCCTGG + Intronic
1128231517 15:66038816-66038838 CACAGATGCCAGTGAGACCCAGG - Intronic
1128526184 15:68414029-68414051 CCCAGATGTCAGAAAGACAGAGG + Intronic
1128981382 15:72189834-72189856 CTAAGCTTTCAGACAGACCTGGG - Intronic
1129868411 15:78925861-78925883 CTCAGAAGTCACACAGCCCTCGG - Intronic
1132542434 16:517014-517036 CACACCTGGCAGGCAGACCTTGG + Intronic
1132637946 16:962470-962492 CACACCTGGCAGGCAGACCTTGG + Intronic
1132752632 16:1465824-1465846 CCCAGCTGTCAGGCAGAGCTGGG + Intronic
1134378782 16:13704475-13704497 CGCAGGTGTCAGACAGGCCAAGG + Intergenic
1134434764 16:14246369-14246391 CAGAGTTGTCTGACAGACATAGG + Intronic
1135891514 16:26361572-26361594 CCCAGAAGTCAGACAGCCCCAGG + Intergenic
1135966155 16:27036913-27036935 CACTGAAGTCAGACAGATCTGGG + Intergenic
1135976994 16:27115088-27115110 CACAGGGCTCAGACACACCTGGG + Intergenic
1137347088 16:47673939-47673961 CACTGGAGTCAGGCAGACCTGGG - Intronic
1138032665 16:53572675-53572697 GGCAGAGGTCAGAGAGACCTGGG - Intergenic
1139767892 16:69247604-69247626 CTCTGCAGTCAGACAGACCTTGG + Intronic
1140126799 16:72124683-72124705 CCCAAATGCCAGACAGCCCTTGG - Intronic
1140399860 16:74662817-74662839 ACCAGAGGTCAGAGAGACCTAGG + Intronic
1141230423 16:82162253-82162275 CTCTGAAGTCAGGCAGACCTGGG - Intronic
1143743945 17:8975917-8975939 CACCACTGTAAGACAGACCTGGG + Intergenic
1144669822 17:17126633-17126655 CACAGATGTCGTACAGCCCCAGG - Intronic
1144674788 17:17154841-17154863 CACAGAAATCAAACAGACGTAGG - Intronic
1144889833 17:18488268-18488290 CACAGAGGTCACACAGACCCTGG - Intronic
1145142381 17:20456049-20456071 CACAGAGGTCACACAGACCCTGG + Intronic
1145305249 17:21670522-21670544 CTCTGAAGTCAGAAAGACCTGGG + Intergenic
1145793531 17:27642853-27642875 CACAGAGGTCAAACAGACCCTGG - Intronic
1145808340 17:27750399-27750421 CACAGAGGTCAAACAGACCCTGG - Intergenic
1147215303 17:38895859-38895881 CTCAGATGTCAGTCAGTCCTGGG + Intronic
1147627452 17:41909282-41909304 CAGAGGTGTCAGACAGACAGGGG + Intronic
1148597658 17:48869683-48869705 CAGAGATGGCAGACAGACACGGG + Intergenic
1150914684 17:69424562-69424584 TTCTGAGGTCAGACAGACCTTGG - Intronic
1151882692 17:76904585-76904607 CAAAGAAGGCAGACAGGCCTTGG - Intronic
1153347982 18:4049276-4049298 CACAGATGTCAGCCATAGCCTGG + Intronic
1153476924 18:5506989-5507011 CACTGATGTCAGACAGACATGGG + Intronic
1155068117 18:22286312-22286334 CACTTAAGTCAGACAGATCTTGG + Intergenic
1156599307 18:38585912-38585934 GACAGATTTCAGAGAGCCCTAGG + Intergenic
1160122636 18:76144589-76144611 CACTGGAGTCAGACAGAGCTCGG - Intergenic
1166093996 19:40528463-40528485 CACAGACGACAGACAGACCAGGG - Intronic
1166882768 19:45939565-45939587 TACAGATATCACACAGACCTGGG + Exonic
1166986413 19:46662267-46662289 CTCATCTCTCAGACAGACCTTGG + Intergenic
1167637292 19:50662342-50662364 CACGGATGTCAAAGAGGCCTGGG + Exonic
1167695124 19:51010581-51010603 CACAGAGATGAGTCAGACCTGGG - Intergenic
1167735670 19:51293291-51293313 CACAGCTGTCAGAAAGAGCAAGG + Intergenic
1167999054 19:53430508-53430530 CACACTTGTCAGAAAGACATGGG + Intergenic
925039148 2:716782-716804 CACAGAGGTCAGTGAGCCCTGGG + Intergenic
925504384 2:4544457-4544479 TACAGATGGAAGACAGACCCTGG + Intergenic
926574708 2:14567189-14567211 GACAGATGAAAGAGAGACCTGGG - Intergenic
927864330 2:26579070-26579092 CACAGATGTCAGACAGACCTGGG - Intronic
928283012 2:29965268-29965290 CACTGGAGTCAGACGGACCTGGG - Intergenic
928903701 2:36348946-36348968 CACAGATGCCACACAGATTTGGG + Intergenic
932194717 2:69773505-69773527 CACAGATCTTAGCCAGTCCTTGG - Intronic
933800325 2:85955265-85955287 CACACATGTCAGCGAGACATTGG - Intergenic
934053832 2:88235007-88235029 CACAGATGACAGGCAGAGCACGG + Intergenic
934729527 2:96647880-96647902 CACAGATGTGAGTCAGGCCCAGG + Intergenic
934971855 2:98770374-98770396 CAGAGATGTCAAGAAGACCTCGG - Intergenic
935469198 2:103436566-103436588 CACAGATCTCAAATAGAGCTGGG - Intergenic
936734083 2:115419274-115419296 CACAGATGTCAGTGAAGCCTTGG + Intronic
937915787 2:127098083-127098105 CACAGATGACAGAATGACTTAGG + Intronic
938392863 2:130918571-130918593 GGCAGATGTCAGCCACACCTGGG + Intronic
939372364 2:141317661-141317683 CTTAGATGTCAGACAGAACAGGG + Intronic
941050677 2:160729985-160730007 CTCAGATGTGAGACAGGCTTGGG - Intergenic
941125805 2:161581540-161581562 CACAGATGTCATACAGGACTAGG - Intronic
942308459 2:174631869-174631891 CACAGATGTCTGAGTGACCCTGG - Intronic
943010260 2:182439455-182439477 CAAAGATGTCAGAGAGAATTGGG + Intronic
943382347 2:187167103-187167125 CTTTGAAGTCAGACAGACCTTGG - Intergenic
946960436 2:224979461-224979483 CACAGCTATCAGGAAGACCTAGG - Intronic
947817239 2:233046234-233046256 CACAGAGGTCAGAGGGCCCTGGG + Intergenic
947850912 2:233287183-233287205 CACAGATGTTACAGAGACCCAGG + Intronic
947953012 2:234164242-234164264 CTCAGCTGTGAGCCAGACCTGGG + Intergenic
1171522765 20:25787995-25788017 CTCTGAAGTCAGAAAGACCTGGG + Intronic
1171530508 20:25849964-25849986 CTCTGAAGTCAGAAAGACCTGGG + Intronic
1171554062 20:26067888-26067910 CTCTGAAGTCAGAAAGACCTGGG - Intergenic
1172245999 20:33445264-33445286 CACTGGTGTCAAACAGGCCTGGG - Intergenic
1172835365 20:37869823-37869845 CACAGTTGTGAGTCAGAGCTAGG + Intronic
1173679560 20:44868304-44868326 CTCTGAAGTCAGACAGAACTGGG - Intergenic
1174218345 20:48934220-48934242 TACAGGTGTGAGACAGAGCTGGG - Intronic
1174449016 20:50608666-50608688 GTCAGATGACAGCCAGACCTGGG - Exonic
1174495807 20:50941667-50941689 GATTGATTTCAGACAGACCTGGG - Intronic
1174567731 20:51478841-51478863 CCCTGAGGTCAGAAAGACCTTGG - Intronic
1175774814 20:61646448-61646470 CATGGGTGTCAGACACACCTGGG + Intronic
1176910938 21:14564525-14564547 CAGTGGTGTCAGACAGGCCTGGG - Intronic
1177534378 21:22405184-22405206 AACAGATGTTAGAAAGAACTGGG + Intergenic
1179240123 21:39582474-39582496 CTCAGAAATCAGACAGGCCTGGG + Intronic
1181773930 22:25146269-25146291 GTCTGAGGTCAGACAGACCTGGG - Intronic
1181860645 22:25815385-25815407 CAGAGTTGTCAGGGAGACCTTGG - Intronic
1181901809 22:26162179-26162201 GCCAGAGGTCAGACAGCCCTGGG + Intergenic
1182407620 22:30150531-30150553 CTCAGATGACTGGCAGACCTTGG + Intronic
1182473909 22:30565460-30565482 CACAGATTTTAGATAAACCTTGG - Intronic
1182871588 22:33652279-33652301 CCCAGATATCAGAGAGACCTGGG - Intronic
1184496965 22:44847748-44847770 CTCTAATCTCAGACAGACCTAGG - Intronic
1184619622 22:45666381-45666403 CTCTGGAGTCAGACAGACCTGGG - Intergenic
950206757 3:11086870-11086892 CTTTGGTGTCAGACAGACCTGGG - Intergenic
950638113 3:14330366-14330388 CATTCATGTCAGACAGATCTGGG - Intergenic
951522984 3:23626552-23626574 CACAGATCTGAGGCAGCCCTAGG + Intergenic
952499334 3:33945314-33945336 CTTTGAAGTCAGACAGACCTGGG - Intergenic
953348625 3:42197628-42197650 AAAAGATGTCAGACTCACCTAGG + Intronic
955097192 3:55811025-55811047 CAGAGCTGTCAGAAAGAACTTGG + Intronic
956551640 3:70467464-70467486 TTCAGATGTCAGAAAGACGTGGG - Intergenic
959590541 3:108075153-108075175 CACAGTTGTCAGCCATAGCTTGG - Intronic
959904084 3:111691718-111691740 CACTGAGGTCTGACAGACCTGGG + Intronic
960962609 3:123082900-123082922 CTCAGGAGTCAGACAGACCTGGG - Intronic
962153335 3:132916720-132916742 CTCAGATGTGACACAGACTTTGG - Intergenic
962372294 3:134830830-134830852 CAAAGATGTCAGACTGTCCAGGG - Intronic
963126602 3:141822386-141822408 CACATATGACAGAGAGGCCTAGG - Intergenic
964809378 3:160646947-160646969 CTCTGGAGTCAGACAGACCTGGG - Intergenic
967625428 3:191678240-191678262 CACAAATGTAAGACAGAGTTTGG - Intergenic
968528142 4:1075057-1075079 CACAGCTGTCAGACAGCACCAGG - Intronic
970179490 4:13375116-13375138 CATTGGTGTCAGAGAGACCTGGG + Intronic
970686289 4:18571367-18571389 CACTATTGTCAGACAGACCTTGG + Intergenic
972174951 4:36392271-36392293 GTCAGATGTCAGACAAGCCTGGG - Intergenic
973239649 4:47944027-47944049 TTCTGAAGTCAGACAGACCTAGG + Intronic
975660881 4:76688167-76688189 CACAGCTGTCACACAGTCATGGG - Intronic
976644989 4:87378019-87378041 CTCTGACGTCAGACAGATCTGGG - Intronic
979518233 4:121635885-121635907 CATAGGTGTAAGACAGACCTTGG + Intergenic
979582353 4:122375819-122375841 CACAGAGGACAGACAGAGCTAGG - Intergenic
979911591 4:126373833-126373855 CAATGATGTCAGCCAGACTTTGG - Intergenic
981684160 4:147434626-147434648 CAAAGCTGTCAGACAGGGCTGGG - Intergenic
981931126 4:150190322-150190344 GATAGATGTCAGAAAGGCCTGGG + Intronic
982909903 4:161126963-161126985 TACAGATAACGGACAGACCTTGG - Intergenic
985556391 5:560433-560455 CACAGATGGCAGGCAGCTCTGGG - Intergenic
986738199 5:10682904-10682926 CACAGCTGTGAGCCAGGCCTGGG + Intronic
986830511 5:11572169-11572191 AGCAGATGTCACAAAGACCTGGG - Intronic
987277978 5:16382637-16382659 TACAGATTTCAGACTGGCCTTGG + Intergenic
988406659 5:30832695-30832717 CCCTGAAGTCAGACAGACCTTGG + Intergenic
988492317 5:31715306-31715328 CACACATGGCTGACATACCTGGG + Intronic
990350391 5:54909927-54909949 CAGAGATGTCGAACAGGCCTTGG + Intergenic
990833018 5:59981978-59982000 CACAGATGCCAGTTAGACATTGG - Intronic
990902820 5:60771538-60771560 CTCTGATGTCAGACAGACCTGGG + Intronic
992784926 5:80160391-80160413 CAAAGTTGGCAGTCAGACCTAGG - Intronic
995590461 5:113694169-113694191 GACAGTTGTCAGCCAGACCAAGG - Intergenic
997882216 5:137601381-137601403 CTCAGAAGTCAGACAGACCTGGG - Intergenic
998035428 5:138911248-138911270 CACAGAAGTCAGAGAGATCTTGG - Intronic
998038004 5:138932857-138932879 AACAGATGATGGACAGACCTTGG - Intronic
999190386 5:149742780-149742802 CTCTGAAGTCAGACAAACCTAGG - Intronic
999499508 5:152132570-152132592 CACAGACCTCAGTCAGTCCTGGG + Intergenic
1002434818 5:179224803-179224825 CTGAGGTGGCAGACAGACCTGGG - Intronic
1004237544 6:13887775-13887797 CACTGAGGTCAAGCAGACCTGGG - Intergenic
1004902879 6:20210279-20210301 CTTAGATGTCAGACTGACCTGGG - Intronic
1007422903 6:41730247-41730269 CACACATTTCAGAGAGACCGGGG - Intronic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1007975808 6:46100093-46100115 CAAAGATGCCAGGCAGAACTAGG + Intergenic
1008904039 6:56656657-56656679 CTCTGTAGTCAGACAGACCTGGG - Intronic
1013884357 6:114944976-114944998 CCCACATGTGAGAAAGACCTGGG - Intergenic
1014784054 6:125597812-125597834 CACAGCTGTCTGGCATACCTAGG - Intergenic
1015607159 6:134970073-134970095 CCCTGAAGTCAGACAGACCTGGG + Intronic
1016318215 6:142813350-142813372 CACAGATAACAGAGAGACATAGG - Intronic
1016426337 6:143939591-143939613 CCCAGCTGCCAGACAGACCTGGG - Intergenic
1017771547 6:157648681-157648703 CACAGGGGTCAGACATGCCTGGG + Intronic
1020358928 7:7306263-7306285 CAGAGATGGCATACAGTCCTGGG - Intergenic
1020394343 7:7697007-7697029 GACAGAAGTTATACAGACCTTGG - Intronic
1020749922 7:12127884-12127906 CAAAGAAATCAGAGAGACCTGGG - Intergenic
1021076992 7:16317150-16317172 CACAGAAGTCAAATAGACTTGGG + Intronic
1021800463 7:24300382-24300404 CTAAGATGTCAGAAAGACCTGGG + Intergenic
1021981656 7:26061348-26061370 GACAGATGTCAGAAATACATTGG - Intergenic
1022391308 7:29946900-29946922 AAGAGATGCCAGAGAGACCTGGG + Intronic
1022483768 7:30761663-30761685 CACAGAAGTGAGACAGGCCCAGG + Intronic
1022546616 7:31195079-31195101 CACTGATGTAAGAAAGACTTTGG - Intergenic
1022819200 7:33942444-33942466 CAGAGATGGGAGACAGACCCAGG + Intronic
1023263849 7:38384695-38384717 GACTGATGCCAGACAAACCTTGG - Exonic
1023813144 7:43927690-43927712 CTTGGGTGTCAGACAGACCTGGG + Intronic
1024207385 7:47175566-47175588 CACAGTTGGCACACAGAGCTGGG - Intergenic
1024311094 7:47969793-47969815 GACAGATCTCAGAAAGTCCTGGG + Intronic
1024465306 7:49705959-49705981 CACAGATGCCAGATAGAGCAAGG + Intergenic
1024597683 7:50953864-50953886 CACAGATGTGGGAAAGAGCTTGG + Intergenic
1025008689 7:55377407-55377429 AACAGATGGCAGACAGACACTGG - Intronic
1027219247 7:76203313-76203335 CTCTGATGTCAGAAAGACATGGG + Intronic
1027764313 7:82321054-82321076 GACATAAGTCAGACATACCTGGG + Intronic
1032756847 7:134899159-134899181 CACACATCTCACACAGACATTGG + Intronic
1033428261 7:141265088-141265110 CACTAAAGTCAGAAAGACCTGGG - Intronic
1036025190 8:4899855-4899877 CTCTGGTGTCAGACATACCTGGG + Intronic
1036213671 8:6862721-6862743 CTCTCAAGTCAGACAGACCTGGG - Intergenic
1036805912 8:11833317-11833339 TTCTGATGTCAGACAGACCTGGG - Intronic
1039914937 8:41852763-41852785 CCTTGAGGTCAGACAGACCTGGG - Intronic
1041447939 8:57974018-57974040 CACAGATGTGGGAAACACCTAGG - Intergenic
1043920001 8:85971252-85971274 AAAAGATGTCATCCAGACCTTGG + Intergenic
1044210426 8:89543856-89543878 CAGAGATCTGAGACAGACCTAGG + Intergenic
1044333324 8:90946621-90946643 CACATCTGAAAGACAGACCTGGG - Intronic
1044850460 8:96422212-96422234 CACAGATGTCAGACCCGCCTTGG - Intergenic
1046741230 8:117831163-117831185 CACAGAAGTCAGAAAGATCAAGG + Intronic
1047771840 8:128036212-128036234 ATCAGATGACAGACAAACCTGGG - Intergenic
1047858525 8:128938599-128938621 CACAGGAGTCAGAAAGATCTGGG + Intergenic
1047859845 8:128953640-128953662 CACAAATGTCAGACATTCATTGG + Intergenic
1048167700 8:132077918-132077940 GACAGCTGACAGACAGACGTGGG - Exonic
1050520838 9:6498327-6498349 CCTAGATGTCAGACTGCCCTGGG + Intronic
1050602791 9:7269499-7269521 CTCAGATGTAAGACAGACGTTGG - Intergenic
1055058915 9:72048885-72048907 CACAGATGGCCTACAGACATGGG - Intergenic
1057702610 9:97374730-97374752 CTCTGAAGTCAGACAGACCTGGG + Intronic
1059691625 9:116690375-116690397 CATAGGTGTAAGACAGAACTGGG - Intronic
1060096779 9:120797899-120797921 CAGAGATGTAAGATAGACCTAGG - Intergenic
1060429725 9:123540363-123540385 AACAGGAGTCAGCCAGACCTGGG - Intronic
1062084213 9:134640701-134640723 CAGAGATGCCAGACAGGGCTGGG - Intergenic
1186018002 X:5220601-5220623 CACAGATGTCTGAGATGCCTGGG + Intergenic
1188843719 X:35047441-35047463 AAAAGATGGTAGACAGACCTAGG + Intergenic
1189068016 X:37831832-37831854 CACAGTCGTCATACAAACCTGGG + Intronic
1189375189 X:40461062-40461084 CACAGAAGCCAGAAAGCCCTCGG + Intergenic
1190731367 X:53228286-53228308 TACGGCAGTCAGACAGACCTGGG - Intergenic
1192184238 X:68935826-68935848 CTCAGAAGTCAGACTGGCCTGGG + Intergenic
1193610923 X:83630924-83630946 CAGAGAAGGCATACAGACCTGGG - Intergenic
1195655944 X:107331773-107331795 CACAGATGTAAGACAGCACAGGG + Intergenic
1195717835 X:107834824-107834846 CCCTGGAGTCAGACAGACCTGGG + Intronic
1196020089 X:110982287-110982309 CACTGAAGACAGACAGATCTAGG + Intronic
1196972145 X:121121495-121121517 CATTGACGTCAGATAGACCTCGG - Intergenic
1197309669 X:124888949-124888971 CCACGATGTAAGACAGACCTAGG - Intronic
1199655963 X:149995762-149995784 CCCAGATATCAGACTGACCAAGG - Intergenic