ID: 927865368

View in Genome Browser
Species Human (GRCh38)
Location 2:26584425-26584447
Sequence CAGAGCTACCACATCGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 78}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927865368_927865376 15 Left 927865368 2:26584425-26584447 CCTGTCCCGATGTGGTAGCTCTG 0: 1
1: 0
2: 1
3: 3
4: 78
Right 927865376 2:26584463-26584485 CCCTCACCTCTGCAGTGAAGGGG 0: 1
1: 0
2: 3
3: 31
4: 241
927865368_927865373 13 Left 927865368 2:26584425-26584447 CCTGTCCCGATGTGGTAGCTCTG 0: 1
1: 0
2: 1
3: 3
4: 78
Right 927865373 2:26584461-26584483 TGCCCTCACCTCTGCAGTGAAGG 0: 1
1: 1
2: 1
3: 19
4: 291
927865368_927865374 14 Left 927865368 2:26584425-26584447 CCTGTCCCGATGTGGTAGCTCTG 0: 1
1: 0
2: 1
3: 3
4: 78
Right 927865374 2:26584462-26584484 GCCCTCACCTCTGCAGTGAAGGG 0: 1
1: 0
2: 0
3: 12
4: 178
927865368_927865378 16 Left 927865368 2:26584425-26584447 CCTGTCCCGATGTGGTAGCTCTG 0: 1
1: 0
2: 1
3: 3
4: 78
Right 927865378 2:26584464-26584486 CCTCACCTCTGCAGTGAAGGGGG 0: 1
1: 1
2: 3
3: 31
4: 325
927865368_927865380 23 Left 927865368 2:26584425-26584447 CCTGTCCCGATGTGGTAGCTCTG 0: 1
1: 0
2: 1
3: 3
4: 78
Right 927865380 2:26584471-26584493 TCTGCAGTGAAGGGGGACAATGG 0: 1
1: 0
2: 1
3: 14
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927865368 Original CRISPR CAGAGCTACCACATCGGGAC AGG (reversed) Intronic
900869552 1:5292311-5292333 CTGAGTGACCACATGGGGACGGG + Intergenic
905938994 1:41848108-41848130 CAGAGCTACCACAGCTGAAATGG + Intronic
913492358 1:119392771-119392793 GACAGCTACCACATCAGGAAAGG - Intronic
915953310 1:160204664-160204686 GAGAGCTGCCACATTGGGCCTGG + Intergenic
923348545 1:233081050-233081072 AAAAGCTACCACATCTGGGCCGG + Intronic
1067935210 10:50605328-50605350 CAGAGCTGCCACAGTGAGACAGG + Intronic
1071976864 10:90964305-90964327 CAGAGGGACCACATCTGGAGAGG - Intergenic
1075861952 10:125684593-125684615 CAGAGCCACCATATCGAGCCTGG - Intergenic
1076056519 10:127378340-127378362 CAGAGGAACCCCATTGGGACCGG - Intronic
1077082075 11:728680-728702 CTGAGCCACCACCTCAGGACGGG + Intergenic
1077113414 11:872022-872044 CAGAGCTACCCGATGGGGTCTGG - Intronic
1079384043 11:19963116-19963138 CAGTGCCACCACAGCAGGACTGG - Intronic
1084158784 11:67332711-67332733 GAGAGCTACCACACCTGGCCTGG + Intronic
1089743181 11:120599108-120599130 CTGAGCTTCCACATCTGGACGGG + Intronic
1090638390 11:128708177-128708199 CAGAGCTACCAAAAAGGGAGAGG + Intronic
1091230929 11:133987526-133987548 CAGAGCAGCCTCATCGGGAGAGG + Intergenic
1091778319 12:3198970-3198992 CAGAGCTACCACAACAGGCATGG - Intronic
1096074897 12:48797205-48797227 AACAGCTACCACATTGTGACAGG - Intergenic
1098199126 12:68036247-68036269 CAGAAATACCACATTGGGAATGG + Intergenic
1100756282 12:97754389-97754411 CAGAGCAAGCACTTCAGGACAGG + Intergenic
1102885257 12:116517052-116517074 CAGAACTACCAAATTGGGAGGGG - Intergenic
1108457558 13:50631798-50631820 CTGAGCCACCACATCTGGCCTGG - Intronic
1109523169 13:63539342-63539364 CAGAGCTACTACATAGGGACAGG + Intergenic
1110828676 13:80004503-80004525 CTGAGCTACCACGCCTGGACAGG - Intergenic
1133304185 16:4799702-4799724 CAGAGCTACCAGTTCAAGACGGG - Exonic
1134865605 16:17604144-17604166 CAGGGCTACCACCTCGGGGGAGG + Intergenic
1137462031 16:48673131-48673153 CAAAGTTACCATATCAGGACTGG + Intergenic
1137521111 16:49196120-49196142 CACAGCTACCTCATCAGGGCTGG - Intergenic
1137839210 16:51624519-51624541 CAGAGCGAGGACATCTGGACGGG + Intergenic
1139510548 16:67425986-67426008 CAGAGCTATCCCATCTGGGCTGG - Intergenic
1147668917 17:42165587-42165609 CAGAGCTTTCACATCAGCACTGG + Exonic
1153304672 18:3620838-3620860 CAGAGCCACCACGTCCGGCCTGG + Intronic
1156007818 18:32464367-32464389 CTGAGCCACCACATCTGGCCAGG - Intronic
1161196896 19:2991886-2991908 AAGGGCTACAACATCTGGACTGG + Exonic
1161597169 19:5156445-5156467 CAGAGCTGCCTCATGGGGCCAGG - Intergenic
1163900814 19:20098571-20098593 AAGAGCTAGCAAATCAGGACAGG + Intronic
1163926495 19:20349522-20349544 AAGAGCTAGCAAATCAGGACGGG - Intergenic
1163936153 19:20446107-20446129 AAGAGCTAGCAAATCAGGACAGG + Intergenic
1163956955 19:20651793-20651815 AAGAGCTAGCAAATCAGGACAGG - Intronic
1164044525 19:21524583-21524605 AAGAGCTAGCAAATCAGGACGGG + Intronic
1164982726 19:32626454-32626476 GTGAGCTACCACATCTGGCCAGG + Intronic
1165287462 19:34853706-34853728 CTGAGCTACCACATGGGAAGGGG - Intergenic
927511370 2:23646192-23646214 CCGAGCTAACACATGGGGAGAGG + Intronic
927865368 2:26584425-26584447 CAGAGCTACCACATCGGGACAGG - Intronic
933104445 2:78305610-78305632 CACAGCTACCAAATGAGGACTGG - Intergenic
935131633 2:100265200-100265222 CAGAGCCCCCACCTCAGGACTGG + Intergenic
941034486 2:160553358-160553380 AAGAGCTACCACTCCGGGGCTGG + Intergenic
942882886 2:180883701-180883723 CAGATGTACCACATCAGGCCAGG + Intergenic
1171767043 20:29296277-29296299 CAGAGCTTCGACATTGGGGCAGG - Intergenic
1173933392 20:46840302-46840324 CAGAGCTACCGCATCTGAAGGGG + Intergenic
1174492584 20:50911666-50911688 CAGAGCTACCACATCAAGGATGG + Intronic
1175191831 20:57216701-57216723 CAGAGCTCCCACATAGGGGAAGG + Intronic
1176082539 20:63281253-63281275 AAGAGCAGCCACATCAGGACTGG - Intronic
1184212607 22:43044834-43044856 CAGAGCTACACCATGGGGCCTGG - Intronic
949988226 3:9555955-9555977 CAGAGCAACCACAGAGGAACTGG - Intergenic
952181001 3:30916578-30916600 CACACCTACCACATCCTGACAGG + Intergenic
956774391 3:72552872-72552894 CTGAGCTACCACACCCAGACTGG - Intergenic
957923168 3:86772832-86772854 GACAGCTACCACAGCGGGACAGG - Intergenic
964693794 3:159484103-159484125 CAGAGACACCACATGGGAACAGG + Intronic
968212680 3:196862044-196862066 CAAAGCTTCCACATCGTGGCAGG + Intergenic
968588508 4:1446090-1446112 CAGAGCTCCCACCTCTGCACAGG - Intergenic
983085177 4:163434404-163434426 ATGAGCCACCACATCCGGACTGG - Intergenic
985588907 5:754857-754879 AAGCGCCACCACATCAGGACAGG + Intronic
985603588 5:847373-847395 AAGCGCCACCACATCAGGACAGG + Intronic
986293806 5:6421154-6421176 CAGAGGTGCCACATCGTGCCCGG + Intergenic
988472966 5:31557771-31557793 CAGAGCTCACACATGGGGAAGGG - Intergenic
1001235140 5:170022900-170022922 CAGGGGAACCACATCGGCACAGG + Intronic
1001305973 5:170573067-170573089 CAGAGCTCCCACCTCGGCTCTGG + Intronic
1002799286 6:505657-505679 CAGAGCTGCCCCAGTGGGACCGG - Intronic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1012939626 6:105403031-105403053 CAGAGCTAGCACAAACGGACTGG + Exonic
1015295270 6:131584246-131584268 CAAAGCTACCACATGTGGAAAGG + Exonic
1019639232 7:2094300-2094322 CACAGCTCTCACATCGGGAACGG + Intronic
1025774619 7:64549183-64549205 AAGAGCTAGCTCATCAGGACAGG - Intronic
1032018670 7:128394781-128394803 CAGAACCACCATATGGGGACTGG + Intronic
1036120933 8:6017011-6017033 CAAAGGTACCACTTTGGGACAGG + Intergenic
1045069966 8:98492808-98492830 TAGAGAAACCACATCTGGACAGG - Intronic
1045637308 8:104207264-104207286 CAGAGCTAGCAAATAGAGACTGG + Intronic
1049345914 8:142138551-142138573 CAGGGCTACCACATAGGCCCTGG - Intergenic
1056625548 9:88250142-88250164 CACAGCTACCACATCCAGACGGG + Intergenic
1061645755 9:131999792-131999814 CACAGCTATCACATCTGTACAGG + Intronic
1187140922 X:16592925-16592947 CAGAGCTATCTCATGGGGAAGGG - Intronic
1187168139 X:16824085-16824107 CTGAGCTACCATATCTGGCCAGG - Intronic