ID: 927868125

View in Genome Browser
Species Human (GRCh38)
Location 2:26606027-26606049
Sequence CCGCGCCTCCCCCCTGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 629
Summary {0: 1, 1: 0, 2: 1, 3: 59, 4: 568}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927868125_927868134 10 Left 927868125 2:26606027-26606049 CCAAGGGCAGGGGGGAGGCGCGG 0: 1
1: 0
2: 1
3: 59
4: 568
Right 927868134 2:26606060-26606082 ATGATGTGGCTTCTTCCTTTGGG 0: 1
1: 0
2: 1
3: 25
4: 265
927868125_927868132 -4 Left 927868125 2:26606027-26606049 CCAAGGGCAGGGGGGAGGCGCGG 0: 1
1: 0
2: 1
3: 59
4: 568
Right 927868132 2:26606046-26606068 GCGGGGGAGGGCGAATGATGTGG 0: 1
1: 0
2: 0
3: 35
4: 760
927868125_927868133 9 Left 927868125 2:26606027-26606049 CCAAGGGCAGGGGGGAGGCGCGG 0: 1
1: 0
2: 1
3: 59
4: 568
Right 927868133 2:26606059-26606081 AATGATGTGGCTTCTTCCTTTGG 0: 1
1: 0
2: 0
3: 20
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927868125 Original CRISPR CCGCGCCTCCCCCCTGCCCT TGG (reversed) Intronic
900142814 1:1145627-1145649 CTGCCCCTGCCCCCAGCCCTCGG - Intergenic
900150461 1:1176715-1176737 CCGGGCCTCCCCTCTCGCCTGGG + Intronic
900175800 1:1290848-1290870 CCACGGCTCCCCCATGCCCCCGG - Intronic
900242489 1:1623707-1623729 CTGCCCGTCCCGCCTGCCCTTGG - Intronic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900435689 1:2629529-2629551 TCTCCCCTCTCCCCTGCCCTGGG - Intronic
900521908 1:3110019-3110041 CTGCGGCTCCCCCATGTCCTGGG + Intronic
900521944 1:3110137-3110159 CTGCGGCTCCCCCATGTCCTGGG + Intronic
900521990 1:3110294-3110316 CTGCGGCTCCCCCATGTCCTGGG + Intronic
900522015 1:3110373-3110395 CTGCGGCTCCCCCATGTCCTGGG + Intronic
900552728 1:3264681-3264703 CCCTGCCTCCCTCCTGGCCTGGG - Intronic
900633947 1:3652650-3652672 CCGAACCGCCCCCCGGCCCTGGG - Intronic
900979243 1:6036941-6036963 CAGCTCCTCAGCCCTGCCCTTGG + Intronic
901023943 1:6269339-6269361 CCTCACCTCACCCCGGCCCTCGG + Intronic
901874917 1:12161910-12161932 CCGGTCCTCCTCCCTTCCCTGGG - Intergenic
902771668 1:18648753-18648775 CCATGGCTCCCCGCTGCCCTTGG - Intronic
903078093 1:20787309-20787331 CCGCCCCGCCCCCCTACCCGCGG + Intronic
903139778 1:21332586-21332608 CCCCTCCTCCCCCCTCCCCCTGG - Intronic
903996339 1:27307445-27307467 CCTCTCCTCCCCTCTGCCCCCGG + Exonic
904035620 1:27557126-27557148 CCCTGCCAGCCCCCTGCCCTGGG + Intronic
904312997 1:29641478-29641500 CAGCTACTCCACCCTGCCCTTGG - Intergenic
904341489 1:29837715-29837737 CCGCATCTCCCCCCAGCCCCAGG + Intergenic
904461861 1:30685400-30685422 CCGCCCCCTCCCCCGGCCCTGGG + Intergenic
905028946 1:34868789-34868811 CCGCCCCCACCCCCGGCCCTGGG - Exonic
905169028 1:36099005-36099027 CGGGGGCACCCCCCTGCCCTGGG + Exonic
905761112 1:40558970-40558992 CCGAGCCTCCCCCCCGCAGTGGG - Intergenic
905846900 1:41241626-41241648 TCGCGCCGCCGCCCGGCCCTCGG + Intronic
906103805 1:43279714-43279736 CTGAGCCTGCCCCCTGCCCCTGG - Intergenic
906272615 1:44492749-44492771 CCTCCCCTCACCCCAGCCCTAGG - Intronic
906298844 1:44666699-44666721 TCCCTCCTCCCCCCAGCCCTTGG - Intronic
906325596 1:44843417-44843439 CCGCGCCTCCCTCCCGCCCGCGG + Intergenic
906694738 1:47816332-47816354 CCATGGCTCCCCTCTGCCCTGGG + Intronic
906727179 1:48052500-48052522 CCTCCTCTGCCCCCTGCCCTTGG - Intergenic
906876177 1:49541604-49541626 CTGAGCCTCCCCCCTGCTGTGGG + Intronic
908790041 1:67772098-67772120 CCATGCCTACCCCCTTCCCTGGG - Intronic
910232099 1:84997452-84997474 CCGCGCCTCGGGCCTGTCCTGGG - Intergenic
912393223 1:109319333-109319355 CCCCTCCTCCGACCTGCCCTGGG + Intronic
912492620 1:110070472-110070494 CCGCGCCGCCCCGCGGCCCGCGG - Exonic
912680528 1:111726277-111726299 CCGCGTCTCCCCCATGCACAGGG - Exonic
913615769 1:120558347-120558369 CCACGCCCGCCCCCTGCCCGAGG - Intergenic
914574506 1:148952555-148952577 CCACGCCCGCCCCCTGCCCGAGG + Intronic
915575534 1:156774082-156774104 CCCCACCTCCCCCCAGCCCCTGG - Intronic
916099213 1:161379350-161379372 CCGCGCCACCACCATGCTCTCGG - Intergenic
916893544 1:169137558-169137580 CCCCTCCTCACCCCTGCCCAAGG - Intronic
917643461 1:177006775-177006797 CAGAGCCTCCCCCCTCCTCTGGG + Intronic
917920777 1:179747932-179747954 CCCCTCCTCCCCCTTTCCCTAGG - Intronic
918487494 1:185045320-185045342 CCGCGCCACCGCCCCGCCCTGGG - Intergenic
919892221 1:201983367-201983389 CCGCGTCTCCTCCCTGGCCCTGG + Intronic
922616234 1:226962795-226962817 CCGAGCCTCACCACTGTCCTGGG + Intronic
922717069 1:227883316-227883338 CCTCGCCTCACCCCTTCACTCGG - Intergenic
922748649 1:228060676-228060698 CAGCCCCTCCTCCCTGCCCTCGG + Exonic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
923810487 1:237309716-237309738 CCGAGCCTCCCCCCGGCCATGGG - Intronic
1062833850 10:623607-623629 CCCCTCCTCCCCTCAGCCCTCGG - Intronic
1062833884 10:623702-623724 CCCCTCCTCCCCTCAGCCCTCGG - Intronic
1062892470 10:1074530-1074552 CTCTGCCTTCCCCCTGCCCTGGG + Intronic
1062897602 10:1116226-1116248 CCCGTCATCCCCCCTGCCCTGGG + Intronic
1063383998 10:5604509-5604531 CCGGGCCTCCCCACTCGCCTTGG + Intergenic
1063418316 10:5890518-5890540 CCGCGCCCTCCACCTGCCCACGG - Intronic
1064209030 10:13347965-13347987 CTGCGCCTCCCCCCCGCGCCGGG + Intronic
1067037572 10:42931542-42931564 CTGCTCCTCCCACCTGCTCTAGG - Intergenic
1067217746 10:44316729-44316751 CTGCCCCTCCCACCAGCCCTGGG + Intergenic
1068702326 10:60033269-60033291 CCGCCCCCCTCCCCTGCCCCCGG - Intronic
1068762974 10:60733233-60733255 CCGCGCCGCCCCCCTACCTGCGG - Intronic
1069694925 10:70379685-70379707 CCAGGCCTACCCCCTACCCTGGG - Intronic
1069944162 10:71974542-71974564 CCCCGTCTCCACCCTGCCCCAGG - Intronic
1070963324 10:80514476-80514498 CAGAGCCTCGCCCCTGCCCCAGG - Intronic
1071522246 10:86338568-86338590 GCGAGACTCCCCCCTCCCCTGGG - Intronic
1071695272 10:87863473-87863495 GCTCGCCTCCCGCCTCCCCTCGG + Exonic
1072547308 10:96449612-96449634 CCATGGCTCCCCCCTGCCCTTGG + Intronic
1073097239 10:100987285-100987307 CCGCGCCTGCGCACTTCCCTTGG + Intronic
1073097302 10:100987618-100987640 CCGCGCCGGCCCCCAGCCCCAGG - Intronic
1073141992 10:101254225-101254247 CCACCCCTCCCCCATCCCCTAGG - Intergenic
1074088372 10:110225965-110225987 CCGCCCCTCCCCCGTGCTCGCGG + Intronic
1074169570 10:110919477-110919499 CCGCCCCACCCCTCTGCCGTGGG - Intergenic
1075067944 10:119302367-119302389 AGGAGCCTGCCCCCTGCCCTTGG - Intronic
1075519443 10:123135275-123135297 CCGCCCCTCCCCCCTCCCGCAGG + Intergenic
1075643715 10:124084175-124084197 CAGCGCGTGGCCCCTGCCCTTGG - Intronic
1076507302 10:130986677-130986699 CTGACCCTCCCCCCTGGCCTGGG + Intergenic
1076731518 10:132441343-132441365 CCGCTCCTGCCCCATGCCTTTGG + Intergenic
1076738466 10:132468958-132468980 CAGCCCCTGCCCCCTGCCCAGGG + Intergenic
1076798126 10:132808638-132808660 CTGGGCCTCTCCCCAGCCCTTGG - Exonic
1076981067 11:205055-205077 CAGCCCCTCCCCCCTCCCCCAGG - Exonic
1077233212 11:1467949-1467971 CCGCGACTCCCACGTGCCCTGGG + Intergenic
1077243884 11:1526518-1526540 CAGCGCCTGCTCCCTGCCCTGGG + Intergenic
1077375257 11:2202614-2202636 GCGCCCCTCCCCCATGCCCAGGG - Intergenic
1077505773 11:2929475-2929497 CCCCGCCCCGCCCCGGCCCTCGG + Intergenic
1079431031 11:20388167-20388189 CAGCGCCTGGCCTCTGCCCTAGG + Intronic
1080223551 11:29934432-29934454 CCGAGCCTACCCCCAGCCGTGGG + Intergenic
1080857104 11:36121844-36121866 CAGCACCTCCCACCTGCCATCGG + Intronic
1081531601 11:43964152-43964174 CCGCGCCTGGCCACAGCCCTAGG - Intergenic
1081545191 11:44066608-44066630 CCCCGCCGCCCCCCTACCCCAGG + Exonic
1081674974 11:44963384-44963406 CCGGGCCTCCCCCCTCCCGCTGG + Intergenic
1081875205 11:46403837-46403859 CTGCCCCTCCCCACTCCCCTTGG - Intronic
1082840060 11:57681940-57681962 CCCCGCCTCCCCCTTGCCAGGGG - Intronic
1083616124 11:64027563-64027585 CCCCGCCACCCTCCTGCCCATGG + Intronic
1083627495 11:64079062-64079084 CAGCGCCTCCCCACCGCCCCCGG - Intronic
1084070959 11:66734340-66734362 CAGTGGCTCCCCACTGCCCTTGG + Intergenic
1084154084 11:67304079-67304101 CCCCGCCCTCACCCTGCCCTGGG + Intronic
1084591002 11:70090295-70090317 CCGCGCCTGGCCCCTCCCCAGGG + Intronic
1084653844 11:70503938-70503960 CCCGGCCTCACCCCTGCCCATGG + Intronic
1084662521 11:70554543-70554565 CCTCTCCTCCCCCCTCCCCCAGG + Intronic
1084861479 11:72021379-72021401 CCCCGGCTCCCTCATGCCCTAGG + Intronic
1084943200 11:72625309-72625331 CCGGGCCTCGCCCCAGCCCCAGG + Intronic
1085744527 11:79103243-79103265 CCAGGACTCCCCCCTCCCCTGGG + Intronic
1089303774 11:117514276-117514298 CTTCCCCTCCCCACTGCCCTGGG + Intronic
1089306518 11:117529808-117529830 CCGCCCCTCCCCATTGCACTTGG - Intronic
1089710001 11:120307705-120307727 CCGCACCTCACACCTGCTCTGGG + Intronic
1090078615 11:123595366-123595388 CCGCCCCTGCCCCCAGCCCCTGG + Intronic
1090080567 11:123609640-123609662 CCCACCCTCCCCCCGGCCCTCGG + Intronic
1090199400 11:124843419-124843441 CCCCTCCTCCCCCCCGCCCCTGG - Intergenic
1090391388 11:126390845-126390867 TTCCGCCTCCCCCCAGCCCTTGG + Intronic
1090486370 11:127116006-127116028 GCGCGACTCCCCGCTGCCCTCGG - Intergenic
1091702106 12:2670298-2670320 TCGAGCCTCCCACCTGCCCGGGG - Intronic
1091771807 12:3156887-3156909 CAGCCCTTGCCCCCTGCCCTGGG - Intronic
1092265747 12:6979084-6979106 CAGCACTTCCCCCCTTCCCTTGG + Intronic
1093443738 12:19230447-19230469 CCGAGCCTCCCCTCCGCCATGGG - Intronic
1096325111 12:50653444-50653466 CCGCCCCTACCCCCAGCCCTGGG + Intronic
1096406292 12:51346469-51346491 CAGAGCGTCCCACCTGCCCTGGG + Intronic
1096553427 12:52389106-52389128 CCTGGCCACCACCCTGCCCTTGG - Intergenic
1096578103 12:52567183-52567205 CTGCTCCTCTCCCCTGCTCTTGG - Intronic
1096773761 12:53951988-53952010 CCGAGCCTCCCGCCGGCCCCGGG + Intergenic
1096803690 12:54127574-54127596 CCGCCCTTCCCCCTTGTCCTGGG - Intergenic
1097970834 12:65631477-65631499 TCTCCCCTCACCCCTGCCCTTGG + Intergenic
1100444805 12:94650515-94650537 CCGCGCCGCCCCCTCGCCCGCGG - Exonic
1102009018 12:109606733-109606755 CTGGGCCTCTCCGCTGCCCTGGG - Intergenic
1103415434 12:120739465-120739487 CCGCGCCTTCCCGCAGTCCTGGG - Exonic
1103700394 12:122846173-122846195 CAGCCCCTGCCTCCTGCCCTGGG + Intronic
1103718806 12:122962368-122962390 CAGCGCCTCACCCCTCCTCTTGG - Intronic
1103719320 12:122965094-122965116 CCAGGCCTCCCCACTTCCCTGGG + Intronic
1103744615 12:123113852-123113874 CCTCCCCTCCTCCCTGCCCCTGG + Intronic
1103907639 12:124335632-124335654 CTGCACCCCCCGCCTGCCCTAGG - Exonic
1104528654 12:129548365-129548387 GTTCGCCTCCTCCCTGCCCTTGG + Intronic
1104591609 12:130088470-130088492 CCCCGCCTCCCACCGGCCTTTGG - Intergenic
1104838682 12:131809221-131809243 CGACGCGTCCCTCCTGCCCTGGG - Intergenic
1105512150 13:21060675-21060697 CCGCGCCGCCCCTCAGCCCCCGG - Intronic
1106303855 13:28494101-28494123 CCGCTCCTCCCCGCCGCTCTCGG - Intronic
1109854263 13:68107807-68107829 CCGAGCCTCCCCCATGCCATGGG - Intergenic
1110254457 13:73417417-73417439 CCCCGCCTCCCCCCTCGCCCAGG + Intergenic
1111997160 13:95176216-95176238 CCCCCCCCCCCCCCTGCCCTCGG - Intronic
1113484171 13:110642402-110642424 CCGGGCGTCCCCCGTGGCCTCGG + Exonic
1113841615 13:113364287-113364309 CCCCGCCCCTCCCCCGCCCTGGG - Intergenic
1113841667 13:113364393-113364415 CCCCGCCCCTCCCCCGCCCTGGG - Intergenic
1113928078 13:113952275-113952297 CCGCCGCTCCCGCCTGCCCAGGG + Intergenic
1113928101 13:113952342-113952364 CCGCCGCTCCCGCCTGCCCAGGG + Intergenic
1114453066 14:22838845-22838867 CCTCTCCTCCCCCCAGGCCTAGG - Intronic
1114679595 14:24473379-24473401 CCAAGCCTCCCCACTGCCCTGGG + Intergenic
1115754841 14:36520100-36520122 CCGCGCCTTCCCACTGCCTCCGG + Exonic
1115918227 14:38341969-38341991 CCACCCCTCCCCCCTTTCCTTGG + Intergenic
1116018164 14:39431682-39431704 CCGCGCCACCTCCGTCCCCTGGG + Exonic
1118453909 14:65928483-65928505 CGGCCCCCACCCCCTGCCCTGGG + Intergenic
1118621664 14:67619812-67619834 CCGCGCCTCCAACCAGCCCCCGG - Exonic
1118884141 14:69852635-69852657 CTGCAACTCCCTCCTGCCCTGGG + Intergenic
1118925823 14:70188925-70188947 CCGCGCGTCCCCTCTGCGCGCGG - Exonic
1119106010 14:71924549-71924571 CCATGCCCCCCACCTGCCCTTGG + Intergenic
1119478597 14:74946245-74946267 CCTCCTCTTCCCCCTGCCCTTGG + Exonic
1119824002 14:77642009-77642031 CCGCGCATCCTCCCCGCCCTTGG - Intergenic
1120710207 14:87785692-87785714 CCACCCCACCCCCCAGCCCTAGG + Intergenic
1121377771 14:93430310-93430332 CCTCGCCTCCCCTCTGCGATGGG - Intronic
1121483020 14:94292870-94292892 CCCTGCCTCCCCTCAGCCCTGGG + Intronic
1122098146 14:99386513-99386535 CTGGGCCTCCCGCCTCCCCTGGG + Intergenic
1122278922 14:100609979-100610001 CCGTGCCCTCCCCCAGCCCTGGG - Intergenic
1122353841 14:101112067-101112089 CCTCTCCTTCCCCCTGCCCGGGG + Intergenic
1122378691 14:101286334-101286356 CCCCGCCACTCCCCTGCCCTCGG - Intergenic
1122577817 14:102752811-102752833 CCCTGCCCCCGCCCTGCCCTGGG + Intergenic
1122744420 14:103889516-103889538 CCTTGCTTCCACCCTGCCCTTGG - Intergenic
1122771939 14:104101465-104101487 CCACGCATCCCCCCACCCCTTGG - Intronic
1122833858 14:104421485-104421507 CCCTGCCTCCCCCAGGCCCTTGG - Intergenic
1122843797 14:104479702-104479724 CCCCACCTGCCCCCTGCCCTGGG + Intronic
1122894787 14:104751588-104751610 CTGAGTCTCCCCCCTGCCGTGGG - Intergenic
1123052169 14:105549795-105549817 CCCCGCCGCCCCCCAGGCCTGGG + Intergenic
1124291730 15:28457535-28457557 CCGCCCTTCCCCCCGGCCCCCGG + Intergenic
1124379274 15:29151185-29151207 CCGGGCCTCCTCGCTGCCCCTGG + Intronic
1124426722 15:29569842-29569864 CCTTGCCTGCCCCCTGCCCCAGG + Intronic
1125003681 15:34795701-34795723 CTGATCCTCTCCCCTGCCCTTGG - Exonic
1125416358 15:39457718-39457740 CCGCTCCTCCCTGCTGCCCATGG + Intergenic
1125536006 15:40441468-40441490 TCGCGCCACCTCCCTCCCCTGGG + Intronic
1126773086 15:52077011-52077033 CCACCCCTCCCCTCTACCCTTGG + Intergenic
1127984811 15:64061154-64061176 CTGAGCCTCCCCCCTTCCCTCGG + Intronic
1128045285 15:64612680-64612702 CCCTGCCTCTCCCCTGCCTTTGG - Intronic
1128264170 15:66253260-66253282 CCGCGCCGCGCCACTGCTCTCGG + Intronic
1129168384 15:73792651-73792673 GTGCGCCTACCCCATGCCCTTGG - Intergenic
1129228657 15:74184444-74184466 CTGCCCCTTCCACCTGCCCTGGG + Intronic
1129297616 15:74608613-74608635 CCCCACCTCCCACCTGCCCCTGG + Intronic
1129598199 15:76981300-76981322 CCTCCCCAACCCCCTGCCCTGGG + Intergenic
1129700314 15:77763889-77763911 CCGCTCATCCCCCCTTCCCCTGG + Intronic
1130086158 15:80779690-80779712 CCGCGCCTCCACCCGGCACAGGG + Intronic
1130305960 15:82712188-82712210 CTCCTCCTCCCCCCTGCGCTAGG + Intergenic
1130916250 15:88307347-88307369 CTGAGCCTACCCCCAGCCCTGGG - Intergenic
1130938663 15:88490334-88490356 CCACCCCCACCCCCTGCCCTTGG + Intergenic
1131115405 15:89792261-89792283 CCACTCCTCCTCCCCGCCCTGGG + Exonic
1131228705 15:90645556-90645578 CCGCTCCACACCCCTGCCCACGG + Intergenic
1131464477 15:92644546-92644568 CCTCGCCTCACCCCTGTCCTAGG + Intronic
1131830527 15:96352111-96352133 CCGCGCCTGGCCCCTGCCCTGGG + Intergenic
1132583025 16:694065-694087 ACCCGCCGCCCCCCTGCCCGGGG + Exonic
1132719851 16:1310090-1310112 CCGCGCCTTCCTCCTGCGCGGGG + Intronic
1132812819 16:1809725-1809747 CCGCGCCCACCACCTGCCCTGGG + Intronic
1132840794 16:1977681-1977703 CCCCGACTCTTCCCTGCCCTTGG - Intronic
1132942322 16:2514337-2514359 CGGCGGCTCCCCGCAGCCCTCGG - Intronic
1133032489 16:3017936-3017958 ACGCCCCTCCCCCCTCCCCAGGG - Intronic
1133170760 16:3981229-3981251 GCGCACCTCACCCCAGCCCTCGG + Intronic
1133192199 16:4142393-4142415 CCACCCATCCCCTCTGCCCTTGG + Intergenic
1134419353 16:14071423-14071445 CCGCTCCCCCACCCAGCCCTCGG - Intronic
1135323411 16:21511742-21511764 GCCCGCCCCTCCCCTGCCCTAGG - Intergenic
1136021911 16:27445867-27445889 AGGCGCCTCCCTCCTTCCCTGGG - Intronic
1136160232 16:28415121-28415143 CCGCTGCTCCCCCTAGCCCTGGG + Intergenic
1136202856 16:28700169-28700191 CCGCTGCTCCCCCTAGCCCTGGG - Intronic
1136477389 16:30521994-30522016 CTGGCCCTCACCCCTGCCCTGGG + Exonic
1136478308 16:30526590-30526612 CCGGGCCCCTCCCCTGCCCGCGG + Intronic
1136707053 16:32200135-32200157 CCGCCCCTCCCCCCGGCCCCTGG - Intergenic
1136760857 16:32729282-32729304 CCGCCCCTCCCCCCGGCCCCTGG + Intergenic
1136778725 16:32884743-32884765 CCGCTCCTCCCCTCTGGCCCGGG - Intergenic
1136807246 16:33141104-33141126 CCGCCCCTCCCCCCGGCCCCTGG - Intergenic
1136891893 16:33976771-33976793 CCGCTCCTCCCCTCTGGCCCGGG + Intergenic
1137267114 16:46878181-46878203 TTCCGCCTCCCCCCAGCCCTTGG + Intergenic
1137531410 16:49281100-49281122 CCGCGCCTCCGCAGAGCCCTTGG + Intronic
1137588407 16:49678654-49678676 CCTCTCCTCACCCCTGCACTGGG + Intronic
1138443161 16:57047121-57047143 CCGTGGCTCCCCATTGCCCTGGG - Intronic
1139280185 16:65763937-65763959 CTGCGCCTCCCACCAGCTCTAGG - Intergenic
1139472083 16:67183820-67183842 GCGCGCCTCCTCCCGGCCTTTGG + Exonic
1139659354 16:68410277-68410299 CCTCACCTCCTCCCTCCCCTGGG - Intronic
1139954403 16:70686277-70686299 CAGCGCCGCCCCCCGACCCTCGG - Intergenic
1140219488 16:73033400-73033422 CCCCGCCGCCCCCCAGCACTGGG + Intronic
1140481786 16:75266095-75266117 CCGCGCCTCCCCGCCGCGTTGGG - Intronic
1141615040 16:85205659-85205681 CTGCCCATCTCCCCTGCCCTGGG + Intergenic
1141724541 16:85778502-85778524 CCCCTTCTCTCCCCTGCCCTTGG - Intronic
1141764988 16:86052257-86052279 CCGCGGCTCTGCCCTGCCTTTGG + Intergenic
1141837974 16:86555156-86555178 CCAGGCCCCCCACCTGCCCTCGG + Exonic
1141871394 16:86788980-86789002 CCTCGCCTCCCGCCTGCCCCCGG - Intergenic
1141989423 16:87602067-87602089 CCGCGCCTCGCCCCTCCCGCCGG - Intronic
1142035615 16:87860826-87860848 GCCCGCCCCTCCCCTGCCCTAGG - Intronic
1142066667 16:88066866-88066888 CACTGCCTCCCCTCTGCCCTGGG - Intronic
1142073272 16:88103137-88103159 TGGCCCCTCCCCCCTCCCCTGGG + Intronic
1142108173 16:88317412-88317434 CCGAGGCTCCACCCTGCCCCTGG - Intergenic
1142272340 16:89096720-89096742 CCAGGACTCCCCCCTTCCCTCGG + Intronic
1142312706 16:89323402-89323424 CGGCTCAGCCCCCCTGCCCTGGG - Intronic
1142312715 16:89323422-89323444 CGGCTCAGCCCCCCTGCCCTCGG - Intronic
1142312723 16:89323442-89323464 CGGCTCTGCCCCCCTGCCCTCGG - Intronic
1142312748 16:89323502-89323524 CGGCTCAGCCCCCCTGCCCTGGG - Intronic
1142312757 16:89323522-89323544 CGGCTCAGCCCCCCTGCCCTCGG - Intronic
1142362314 16:89633237-89633259 ACGGGCCTCTCCCCAGCCCTCGG - Intronic
1203063009 16_KI270728v1_random:989596-989618 CCGCCCCTCCCCCCGGCCCCTGG + Intergenic
1203081142 16_KI270728v1_random:1146837-1146859 CCGCTCCTCCCCTCTGGCCCGGG - Intergenic
1142474053 17:179657-179679 CCCCCCCTCCCCTCTGCCCCTGG - Intronic
1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG + Intronic
1143411750 17:6713456-6713478 GGGCGCCTCCCCGCGGCCCTGGG + Exonic
1143608080 17:8002619-8002641 CCACGCCCCCGCCCTGGCCTGGG + Exonic
1143609246 17:8008084-8008106 GTGCGCCTCCCCTCTGCCCAGGG - Intronic
1144127638 17:12217788-12217810 CCGCTCCCCCCCCCCACCCTTGG - Intergenic
1144167323 17:12625286-12625308 CCACGCCTCCTTGCTGCCCTTGG + Intergenic
1144451812 17:15387020-15387042 CCGCGACCCAGCCCTGCCCTTGG - Intergenic
1145005410 17:19334615-19334637 CCTCCCCACCCCCCAGCCCTAGG + Exonic
1145970006 17:28951008-28951030 CCTCACCTCCCCCCTCCCCCCGG - Exonic
1146100694 17:29978943-29978965 CCCCCCATCCCCCCTGCCCCAGG - Intronic
1146127159 17:30238596-30238618 CCGTGCCTCCCCCCGCCTCTGGG + Intergenic
1147045065 17:37745565-37745587 CCTCACCTCCCCCGTGGCCTCGG - Intergenic
1147159675 17:38562789-38562811 CCCAGCCTCCCCAATGCCCTGGG + Intronic
1147592015 17:41689557-41689579 CCGGGCCTCCCGCCCTCCCTGGG - Intronic
1147638153 17:41976531-41976553 CCGCCTCCCTCCCCTGCCCTCGG + Exonic
1147690645 17:42312654-42312676 CCCCGCCTTCCCCCTGCTCTGGG - Intergenic
1147897154 17:43758278-43758300 CCCAGCGTCCTCCCTGCCCTGGG + Intronic
1148051516 17:44772167-44772189 CCTCGCCTCCACCCCACCCTGGG - Intronic
1148129832 17:45256149-45256171 CCCTGCCCCACCCCTGCCCTGGG + Intronic
1148231901 17:45941455-45941477 CCCCTCCTTCCCCCTGCCCCTGG + Intronic
1150223002 17:63507796-63507818 CCCTGCCTCCCTCCTGCCCCAGG - Intronic
1150294101 17:63998691-63998713 CCGCGCACACCCCCAGCCCTGGG + Exonic
1150621822 17:66813411-66813433 CTGAGCTTCCCCCCTGCCCCTGG + Intergenic
1150643514 17:66964790-66964812 CGGCGCCGCCCCCCGGCCCTCGG + Intergenic
1150840230 17:68600501-68600523 CCGCGCCTCCTCCCTGGCGCGGG - Exonic
1151344774 17:73494826-73494848 CCGTGCCCCCACCCTGGCCTGGG - Intronic
1151505159 17:74522606-74522628 CTGGGCCTCCGCCCTGGCCTTGG - Exonic
1151541536 17:74767347-74767369 CCCCTCCTCCCCCCTTCCCTGGG + Intronic
1151567428 17:74907131-74907153 CTGAGCCTCCCCTCTGCCGTGGG - Intergenic
1151747858 17:76021439-76021461 CCGCCCCTGCCGCCTGCCCGAGG + Intronic
1152071909 17:78138264-78138286 CTGCTCCTGCCCCCTTCCCTGGG + Intronic
1152175165 17:78782362-78782384 CTGCGCCCGCCCCCTGCCCCCGG + Intergenic
1152189560 17:78880112-78880134 CCGCCCCTCCGGCCAGCCCTTGG - Intronic
1152569930 17:81117161-81117183 CCTCTCCTCCCCACTGTCCTCGG - Exonic
1152639211 17:81442686-81442708 CCGCCGCTCGCCCTTGCCCTCGG - Exonic
1152814283 17:82398183-82398205 CCGCGCCTCCTACCAGCTCTCGG + Exonic
1152858213 17:82678702-82678724 CTGCCCCTCCCCTCTGCCCCGGG - Intronic
1152876604 17:82790053-82790075 CTGCGCCGCCACCCTGTCCTGGG + Intronic
1152879280 17:82806239-82806261 CCTCGCCTCCTTCCTGACCTGGG + Intronic
1153262527 18:3238369-3238391 CCCTGCCTCCCCCCTCCCCCAGG - Intergenic
1153284739 18:3447856-3447878 CCGCCCCTCCCCCCTTCTCCTGG + Intronic
1153480738 18:5543820-5543842 GCGCGCCTCGCCCCAGGCCTCGG + Intronic
1153892943 18:9534988-9535010 CCACGCATGCACCCTGCCCTTGG - Intronic
1153900544 18:9614337-9614359 GCCCGCCTCCCCCCCGCCCCGGG + Intronic
1154294082 18:13134772-13134794 TCGAGCCTCCCCCCTGCCGTGGG - Intergenic
1154411779 18:14145647-14145669 CCTCTCCTTACCCCTGCCCTGGG - Intergenic
1155213030 18:23619268-23619290 CGGGGCCTCCCGCCTGTCCTGGG - Intronic
1155570413 18:27185615-27185637 CCTCTCCTCTCCCCTGCGCTGGG + Intergenic
1156314426 18:35953907-35953929 CCTCTCCTCCCCCCAGCCTTTGG - Intergenic
1159516543 18:69466170-69466192 CCGCCCCTCCCTCCAGCCCTTGG + Intronic
1160013241 18:75122565-75122587 CAGCTTCTCCCTCCTGCCCTCGG - Intergenic
1160147997 18:76379646-76379668 ACGGGCCCCCCGCCTGCCCTCGG - Exonic
1160681936 19:415830-415852 CAGGCCCTACCCCCTGCCCTGGG - Intergenic
1160687734 19:444514-444536 CCCCACCTCCCCCGTGCACTAGG - Intronic
1160719112 19:589866-589888 CCCCGCCTCCCCCCTCCCTCGGG + Intergenic
1160719191 19:590067-590089 CCGCGCCCCCCCCGGGCCCCGGG + Exonic
1160777275 19:862051-862073 ACGCGCCCCGCCCCTTCCCTGGG - Intronic
1160808265 19:1001787-1001809 CCGCCTCTCCCACCAGCCCTAGG - Intronic
1160817969 19:1044922-1044944 CCGCTCCTCCCCCTGGACCTCGG - Intronic
1160835440 19:1122624-1122646 CCGCTCCCGCCCCCTGCCCCAGG + Intronic
1160878948 19:1310912-1310934 CCGCCCCTCTCCCCTGGGCTTGG - Intergenic
1160921036 19:1520691-1520713 CCCATCCTACCCCCTGCCCTGGG - Intergenic
1160930766 19:1568481-1568503 CCCCGCCTCCGCCCGGCGCTCGG + Intergenic
1160941419 19:1622025-1622047 CACCCCCTGCCCCCTGCCCTGGG + Intronic
1161048850 19:2151455-2151477 CCCCGCCGCCGCCCTGGCCTGGG - Exonic
1161160904 19:2761429-2761451 CCGCCCCTCCTCCCTGTCCATGG - Intronic
1161221524 19:3120250-3120272 CCCCGCCACTCCCCTGCCCAGGG - Intronic
1161250737 19:3278974-3278996 CTGTGGCTCCCCACTGCCCTAGG - Intronic
1161404683 19:4084710-4084732 CCCCGCCTCCAACCTGCACTGGG + Intergenic
1161455136 19:4366165-4366187 CCGCCCCTCCCCAGTGCCCCTGG - Intronic
1161621010 19:5297094-5297116 CCCCGCCTACTCCGTGCCCTTGG + Intronic
1161770643 19:6228961-6228983 CCGCGCCTCCTCCCCGCCCCTGG + Intronic
1161898272 19:7099056-7099078 CGGCTCCTCCCGCCTGGCCTCGG - Intergenic
1162019565 19:7862545-7862567 CCGCGGCCCCGCCCTGCCCGTGG + Intronic
1162091053 19:8280447-8280469 CTGAGGCTTCCCCCTGCCCTGGG - Intronic
1162093287 19:8295285-8295307 CTGAGGCTTCCCCCTGCCCTGGG - Intronic
1162302054 19:9849793-9849815 CCGAGGCTTCCCCTTGCCCTGGG + Intergenic
1162397275 19:10424410-10424432 CCTCGCCTCCCCCTTGTCCCTGG + Intronic
1162452726 19:10764574-10764596 CCACCCCTCCCCACCGCCCTTGG + Intronic
1162494540 19:11016134-11016156 CCTCGCCTCCTCCCTCCCCATGG - Intronic
1162537962 19:11275311-11275333 CAGCCCCTCCCCCGAGCCCTAGG - Intergenic
1162790758 19:13061494-13061516 CCGCGCCCCGCCGCAGCCCTCGG + Intronic
1162909227 19:13840470-13840492 CCTGGCCTCCCGCCTGGCCTAGG - Intergenic
1162917858 19:13883770-13883792 CCCCGCTTCTCCCCTCCCCTCGG + Intronic
1163118315 19:15200925-15200947 CCCCTCCTCCCTCCTTCCCTGGG + Exonic
1163235755 19:16029536-16029558 CCTCTCCTCCCGCCTGCCCCAGG - Intergenic
1163466471 19:17470847-17470869 CCCCGCCCCCGCCCAGCCCTCGG - Intronic
1164615774 19:29665946-29665968 CCCCGCCGCGCCCCTGCCCAGGG - Intronic
1165080315 19:33302820-33302842 CCCCTCCTCCTGCCTGCCCTAGG + Intergenic
1165345680 19:35247982-35248004 CCGCGCCGCGCCCCCGCCCTCGG + Intergenic
1165363352 19:35350201-35350223 CCGCTCCTTCCTCCAGCCCTGGG + Intergenic
1165940765 19:39413689-39413711 CCCAGCCTCCGCCCTCCCCTGGG + Intronic
1166054016 19:40277942-40277964 CACCCCCTCCCCACTGCCCTAGG - Intronic
1166094499 19:40530603-40530625 GCGCGCCAACCCCCTCCCCTGGG - Intronic
1166219096 19:41353822-41353844 CGGGGCGTCCCCCCTGCCCCCGG + Exonic
1166499714 19:43331536-43331558 CCGCCCCTGCCCCTGGCCCTAGG - Intergenic
1166731963 19:45064279-45064301 CCGCGGCCCCCCTCTGCCCCGGG - Intronic
1166792427 19:45405908-45405930 CGGCGACTCCTCCCTGCCCCAGG - Intronic
1166796425 19:45428854-45428876 CCGAGCCGCCCCCCTCCACTCGG - Intronic
1166823835 19:45597430-45597452 CCCCGACTCTCCCCTGCCCCAGG + Intronic
1166827078 19:45616415-45616437 CCGCGCCGCCACCCCGCCCAGGG - Intronic
1166961021 19:46495783-46495805 CGGCGCCGCCCCCCTGCACCTGG - Exonic
1167615416 19:50530256-50530278 CCGGGGCTCCCCAGTGCCCTCGG + Intronic
1167960774 19:53102963-53102985 CCGCGCCTCCGCCTGGTCCTGGG - Intronic
1168333003 19:55580529-55580551 CCCCGCCTCCCCCTTGTCCTGGG - Intronic
1168335101 19:55592990-55593012 AGGCGCCTCCCCACCGCCCTCGG + Exonic
925893415 2:8454105-8454127 GCACGCCTCCGCCCAGCCCTTGG + Intergenic
926055677 2:9772655-9772677 TGGAGCCTCCCCCCTGCCTTAGG + Intergenic
926171948 2:10558159-10558181 CCTCGCCTCACCCCTACCCTTGG + Intergenic
926289426 2:11516899-11516921 CCTCGCCACCCCACTGCCCACGG - Intergenic
927146577 2:20170067-20170089 CTGTGCCTGCCCCCTGCCATCGG - Intergenic
927713951 2:25341205-25341227 CCGCCCCTCCCCCCGGCGCCCGG - Intronic
927868125 2:26606027-26606049 CCGCGCCTCCCCCCTGCCCTTGG - Intronic
927942162 2:27111600-27111622 CTGAGCCTCCCCACTGCCGTGGG - Intronic
929581160 2:43082508-43082530 GCATGCCTCTCCCCTGCCCTGGG + Intergenic
931107007 2:59067199-59067221 CCGAGCCTCCTCCCCGCCGTGGG + Intergenic
931253323 2:60551567-60551589 CCTCCCCTCCCCTCCGCCCTGGG - Intronic
931355856 2:61537516-61537538 CCGCGCCGCCGCCCGACCCTCGG + Intronic
931457988 2:62426990-62427012 CAGTGCCTCTCCACTGCCCTTGG - Intergenic
932414778 2:71566892-71566914 CTGAGCCTCCTACCTGCCCTGGG + Intronic
932495320 2:72143262-72143284 CCGCCCCTCCCGGCTGCGCTAGG - Intronic
933651324 2:84852489-84852511 CCACCCCTCCCCCCAGCCCATGG - Intronic
935196401 2:100819465-100819487 CCCCGCCTCCCACCTGCCCCCGG + Intergenic
935378280 2:102422493-102422515 CCTCCCCACCCCTCTGCCCTGGG + Intronic
935645368 2:105329783-105329805 CCGCGCCGCCCGCCGGCCCGCGG + Exonic
935734738 2:106097549-106097571 ACGCCCCTCCCCCCAGCCTTAGG + Intronic
935878328 2:107536180-107536202 CCGAGCCTCCACCCTGCTGTGGG - Intergenic
936350760 2:111710833-111710855 CCTCCCCTCCCCTCTCCCCTGGG - Intergenic
936416746 2:112322338-112322360 CCGCCCCCCACCCCTGCCCCTGG + Intronic
937046290 2:118853783-118853805 CCGCGCCTCCCTGTTGCCCAAGG + Intergenic
937223009 2:120352973-120352995 CCCTGCCTCCCCGCTGCCCTGGG + Intergenic
937956772 2:127426218-127426240 CCTCGCCTCCCACCTGCCAGGGG - Exonic
938078501 2:128355157-128355179 CCGGGCCTCCCCCCAACACTGGG - Intergenic
940711436 2:157167141-157167163 CCTCCCATCCCTCCTGCCCTTGG + Intergenic
941542514 2:166804273-166804295 CCCCGCCTCACTCCTGCCCCTGG - Intergenic
942278644 2:174340696-174340718 CCCGGCCTCCCCCAAGCCCTAGG + Intergenic
942620051 2:177835944-177835966 CTGAGCCTCCCCACTGCCGTGGG + Intronic
946431181 2:219628022-219628044 GGGCGCCTCCCCCCTACCCCAGG + Exonic
948421023 2:237859899-237859921 CTCCGCCTCCCCTGTGCCCTGGG - Intronic
948566742 2:238892095-238892117 CAGCCACTCCCACCTGCCCTCGG + Intronic
948629551 2:239293334-239293356 CAGGGCCTGTCCCCTGCCCTCGG + Intronic
948854212 2:240722518-240722540 CAGCGCCTCCTCCCCGCTCTCGG - Exonic
948918782 2:241051870-241051892 CCTGCCCTCCCCCCTGCCCCTGG - Intronic
948988682 2:241541179-241541201 CCGCGCCCCGCCCCTGGCCGCGG - Intergenic
1169065708 20:2693230-2693252 CCGCGCCCCCGCCTTGCCCGAGG + Intronic
1169074412 20:2752273-2752295 CCGCGCCTCCCCGCCGTCCTCGG + Intronic
1169367292 20:5001588-5001610 CCGCCCCCGACCCCTGCCCTCGG + Intronic
1169468118 20:5859270-5859292 CTGCCCCTCACCCCTCCCCTGGG - Intronic
1170101809 20:12709579-12709601 CCTCCCCTTCCTCCTGCCCTTGG + Intergenic
1172167790 20:32909482-32909504 CCCTGCCTCCCCCTTGCCCCAGG - Intronic
1172181111 20:33004190-33004212 CTGCCCCTCCACCCTGTCCTTGG - Intronic
1172189733 20:33054682-33054704 CAGTGGCTCCCCGCTGCCCTGGG - Intergenic
1172753269 20:37266098-37266120 CCACTCTTGCCCCCTGCCCTAGG + Intergenic
1172781335 20:37438517-37438539 CCGCTCCTCCTCCCTGCTCTGGG - Intergenic
1173166223 20:40688917-40688939 CCGCTCTTCCCCCCCGCGCTTGG - Exonic
1173939007 20:46894545-46894567 CCGCACCTCCTCCCTCCCCGGGG - Intergenic
1174327420 20:49790443-49790465 CAGCGCCCCCCACCTGCCTTAGG + Intergenic
1174396222 20:50248321-50248343 CCCCGCCTCCACCCTGTCCGTGG - Intergenic
1175064950 20:56276783-56276805 CCGTGCCTCCCCACTGCAGTTGG - Intergenic
1175308029 20:57991452-57991474 CCCCGCCTTCCACCAGCCCTAGG - Intergenic
1175322010 20:58094773-58094795 CCTCTGCTCCCCACTGCCCTTGG - Intergenic
1176264899 20:64204009-64204031 CTGCCCCTCCCACCTGCCTTAGG + Intronic
1176295156 21:5068024-5068046 CCTCTCCTCCCCTCTGACCTTGG + Intergenic
1176410757 21:6448306-6448328 CCGGGCCTCCCACATGCCCTGGG - Intergenic
1176663693 21:9664158-9664180 CTGAGCTTCCCCCCTGCCATGGG - Intergenic
1176678752 21:9805911-9805933 GCCCACCTCTCCCCTGCCCTCGG + Intergenic
1179644382 21:42766754-42766776 CGGCGCCTCCCTCCTTCCCTTGG - Intronic
1179686251 21:43056628-43056650 CTGGGCCTCCCACATGCCCTGGG - Intronic
1179861893 21:44194104-44194126 CCTCTCCTCCCCTCTGACCTTGG - Intergenic
1179992766 21:44957225-44957247 CCCCGCCTCAGCCCTGCCCTTGG - Intronic
1179994599 21:44968092-44968114 CCCCTCCACCCCCCTGCCCTGGG + Intronic
1180137343 21:45870460-45870482 CCCGGCCTCCCTGCTGCCCTAGG - Intronic
1180875213 22:19171931-19171953 CAGCGCCTCTCCCGTGACCTGGG + Intergenic
1180954807 22:19736889-19736911 CCGTGCCCCTCCCCGGCCCTCGG + Intergenic
1180972916 22:19824924-19824946 CTGGGCCCCCGCCCTGCCCTCGG + Intronic
1180988058 22:19917230-19917252 CCCTCCCTCCTCCCTGCCCTGGG - Intronic
1181017678 22:20080483-20080505 CCGCGCCCCCGCCCCGCCCGCGG - Intronic
1181452745 22:23034791-23034813 CCACCCCTCCCCCTTGCCATTGG - Intergenic
1182107217 22:27698155-27698177 AGGCGCCTGCCTCCTGCCCTCGG + Intergenic
1182123573 22:27801286-27801308 CCGCGCCTTTCCCCGACCCTCGG - Exonic
1182353870 22:29713453-29713475 CCGCCCCTCTTCCCTGCCCCTGG + Intergenic
1182360510 22:29743863-29743885 CCTTGCCTCTCCCCTCCCCTGGG - Intronic
1183083788 22:35474216-35474238 CAGAGCCTCCGTCCTGCCCTTGG + Intergenic
1183471466 22:38009230-38009252 CCTCGCAGCCCCACTGCCCTTGG - Intronic
1183619087 22:38962254-38962276 CCCCTCCTCCCCACTCCCCTGGG + Intronic
1184058484 22:42067737-42067759 CCGCACCCCAGCCCTGCCCTTGG - Intronic
1184673282 22:46027031-46027053 CCTCGCCTCCTCTCTCCCCTTGG - Intergenic
1184914313 22:47558789-47558811 CAGTGCCTCCCCACTTCCCTGGG - Intergenic
1185320983 22:50200245-50200267 ACGCGCCTCCCTCCTGCCTGTGG - Intergenic
1185351668 22:50342927-50342949 CCGGGCCTCCCTCCTGCCACAGG - Intergenic
950193477 3:10993272-10993294 CCGCGTCCCCTCCATGCCCTGGG - Intronic
950676316 3:14556298-14556320 CCCCTCCTCCCCTCTTCCCTGGG + Intergenic
950749894 3:15120272-15120294 CCTCGCCTCCTGCTTGCCCTGGG - Intergenic
951415476 3:22417223-22417245 CTGAGCCTCCCCCCTGCCATGGG + Intergenic
952265002 3:31776770-31776792 TCCCTCCTCCCCCCAGCCCTGGG - Intronic
952881899 3:37990791-37990813 CCGCGCCTTCGCCCTGCCTGTGG - Intronic
954954348 3:54506092-54506114 CCCTGCCTCTCCTCTGCCCTTGG - Intronic
955611846 3:60765892-60765914 CCTCCCATCCCTCCTGCCCTTGG + Intronic
955642965 3:61106458-61106480 CCCCACCTCCTCCCAGCCCTTGG + Intronic
956011075 3:64832299-64832321 CAGCGTCTCCCCCTTGGCCTTGG + Intergenic
956467667 3:69535641-69535663 CCGCCCCTGCCTCCGGCCCTAGG + Intronic
961268835 3:125672017-125672039 CCAAGCCTCCCCACTGCCATGGG + Intergenic
961514008 3:127421683-127421705 CTGCTCCTGCCCCCTGCCCTGGG - Intergenic
962840640 3:139229488-139229510 CTGCTCCTCCTCCCTCCCCTGGG - Intronic
964358595 3:155871403-155871425 CCCCGTTTCCCGCCTGCCCTCGG + Intronic
965092277 3:164179519-164179541 CCGAGCCTGCCCCCCGCCGTGGG + Intergenic
966242080 3:177765992-177766014 CAACGCCCCTCCCCTGCCCTTGG - Intergenic
968234334 3:197022908-197022930 CCTCAGCTCCTCCCTGCCCTCGG + Intronic
968372873 4:11579-11601 CCGCGCCTGCGCCTTGTCCTCGG - Intergenic
968472453 4:788298-788320 CGGCACCTCTCCCCTCCCCTAGG + Intronic
969099264 4:4756685-4756707 CAGCGACTCCCACCTGCCGTGGG + Intergenic
969303123 4:6309122-6309144 CCGAGCCTCCCCCTGGCCGTGGG - Intergenic
969583869 4:8080890-8080912 CCGCCCCTCCCGGCTGCCCCAGG - Intronic
969645877 4:8428483-8428505 CCGCGGCTCCGCCCCGCCCATGG - Intronic
969788040 4:9474024-9474046 GCGCCCCGCCCCCCTGCCATGGG - Intergenic
969788327 4:9474870-9474892 GCGCCCCGCCCCCCTGCCATGGG - Intergenic
970911267 4:21278745-21278767 CCCCATCTCCCCTCTGCCCTTGG - Intronic
972765621 4:42150950-42150972 CCGCCCCTCCTTCCTGCCCCGGG - Intronic
973707322 4:53593230-53593252 CCTCCCCTCCCCCTTGCCCAGGG - Intronic
973817619 4:54632808-54632830 CCGAGCCTCCCTCCGCCCCTTGG + Intergenic
974807533 4:66899548-66899570 CCAAGCCTCCCCTCTGCCATGGG - Intergenic
975139105 4:70902351-70902373 CCGCCCCCTCCCCCTGCCATTGG + Intronic
975708730 4:77137345-77137367 CCACGCCCCCCCCCAGCCCCCGG - Intergenic
976246863 4:83013031-83013053 CGGCGCCTCGTCCCTCCCCTTGG + Intergenic
978748599 4:112222704-112222726 CTGAGCCTCCCCTGTGCCCTGGG + Intergenic
979725445 4:123955669-123955691 CTCCTCCTCCTCCCTGCCCTTGG - Intergenic
981271048 4:142847092-142847114 CCCCTCCTCCCCCTTGCCCCGGG + Intronic
981713500 4:147731828-147731850 CCGCGGCTCCCCTCCACCCTGGG - Intergenic
982388970 4:154843163-154843185 TTCCGCCTCCTCCCTGCCCTTGG - Intergenic
982460900 4:155667621-155667643 CCGCGGGTCCCCCGGGCCCTGGG - Intronic
983230626 4:165126026-165126048 CTGAGCCTCCCCCCAGCCATGGG - Intronic
984803743 4:183735853-183735875 CCCCCCCTCCCCCCGGCCCGGGG + Intergenic
984839187 4:184052268-184052290 CTGTGCCCCACCCCTGCCCTCGG - Intergenic
984992714 4:185396646-185396668 CCGCCCCCTCCCCCTGCCCCCGG + Exonic
985396802 4:189553034-189553056 GCCCACCTCTCCCCTGCCCTCGG - Intergenic
985403569 4:189615305-189615327 CTGAGCCTCCCCCCTGCGGTGGG - Intergenic
985409137 4:189664826-189664848 CTGAGCTTCCCCCCTGCCATGGG - Intergenic
985462523 4:190120988-190121010 CCGCGCCTGCGCCTTGTCCTCGG + Intergenic
985590917 5:764632-764654 CTGAGCCTCCCCGCTGCCATGGG + Intronic
985785326 5:1890206-1890228 CCAGGCCTCCCCCTTGGCCTGGG - Intergenic
986002717 5:3642816-3642838 CAGCCCCTCCCCACTGCCCTGGG - Intergenic
986738936 5:10689014-10689036 CCGCCCTTCCTCCCTGCCCTCGG + Intronic
988577929 5:32444552-32444574 CCGCGGCTCCCCGCTGCCCGGGG + Intronic
988609313 5:32710582-32710604 CCGCGCCAGCCCCCTCCCCCTGG - Intronic
989146716 5:38257750-38257772 CCGCCCCGGCCCCCTGCCCCAGG + Intergenic
990910192 5:60844374-60844396 CGGCTCCTCCCTCCGGCCCTCGG - Exonic
992124376 5:73626054-73626076 CCGCGCCTCCCCGCTGCCACTGG - Intergenic
994083351 5:95731650-95731672 CCGAGTCGCCGCCCTGCCCTTGG + Exonic
995653266 5:114396057-114396079 CCTTGCCTCCCTCCAGCCCTTGG + Intronic
995840417 5:116438522-116438544 CCCAGCCTTCCTCCTGCCCTTGG - Intergenic
996478665 5:123949276-123949298 CTGAGCCTCCCCGCTGCCATGGG - Intergenic
997367738 5:133336583-133336605 CAGCCTCTCACCCCTGCCCTGGG - Intronic
997605583 5:135173678-135173700 GCGCCCCTTCCCTCTGCCCTGGG + Intronic
998101611 5:139439470-139439492 CCGAGCCTCCCCCGTGCCCGAGG + Exonic
1000318896 5:160118700-160118722 CCTCGCTTCCCCGCTGCCCGGGG - Intronic
1001824161 5:174732504-174732526 CCGGGCCGCCCCCTTGCTCTGGG + Intergenic
1002421930 5:179153438-179153460 GCACGCCTCCCCCCAGACCTGGG + Intronic
1003868574 6:10384130-10384152 GCGCCCCTCCCCCCTTCTCTGGG - Intergenic
1004217618 6:13717024-13717046 CCGAGCCTCCCCACCGCCATGGG + Intergenic
1005589916 6:27312489-27312511 CTGCGCCTCGCCCCTGGCGTCGG + Intergenic
1006299387 6:33185606-33185628 CCTCCCCTCCCCCATGCCGTGGG - Intronic
1006639076 6:35479766-35479788 CGGGGCCTCCTCCCTGCCCACGG + Intronic
1007094502 6:39205043-39205065 CCCAGCTGCCCCCCTGCCCTGGG - Intronic
1007341045 6:41191798-41191820 CTGCTCCTCCCTCCTGTCCTGGG - Exonic
1007462071 6:42026276-42026298 CCCCGCCGCCCCCCTGCCAAGGG + Intronic
1007620886 6:43213740-43213762 CAGGGCCTCCCCACTGCGCTGGG - Exonic
1007783108 6:44265332-44265354 CCGCGCCTCCGACATGCCCGCGG + Exonic
1008598499 6:53065860-53065882 CCCCGCCGACCCCCAGCCCTAGG - Intronic
1009510776 6:64547812-64547834 CTGAGCCTCCCCACTGCCATGGG - Intronic
1009739316 6:67723325-67723347 CCGAACCTCCCCCATGCCGTGGG + Intergenic
1010289171 6:74115573-74115595 CCACCCCTCCCACCAGCCCTTGG - Intergenic
1012851017 6:104446561-104446583 CTGAGCCTCCCCCCTGCCGTGGG + Intergenic
1013368628 6:109452615-109452637 CCTCTCATACCCCCTGCCCTAGG - Exonic
1014230295 6:118895010-118895032 CCCCGCCGCCCGCCTGCCCCCGG + Intronic
1016330537 6:142947576-142947598 CCGCGCCGCCGCCCTGCCCGGGG + Intergenic
1017653165 6:156601496-156601518 CCCCTCCTCCCACCTGCCATGGG - Intergenic
1017672553 6:156779726-156779748 CCGCGTCCCCCCCCTCCCCCAGG + Intronic
1018046409 6:159969575-159969597 CCGCGCCCCCCGCCTGCGCACGG - Intronic
1019112092 6:169724503-169724525 CCGCGGCTCCCCCCAGCCCCCGG + Intronic
1019134530 6:169899863-169899885 CAGCCCCTCCCCGCTTCCCTGGG + Intergenic
1019192289 6:170259344-170259366 TGGCACCTCCTCCCTGCCCTGGG + Intergenic
1019395732 7:816746-816768 CCCCGCGTCCCCCCGGCCCCCGG - Intronic
1019395944 7:817490-817512 CCGCACCGCCCACCTGTCCTGGG - Intronic
1019509072 7:1408151-1408173 CCTCCCCTCCCGCCTGCCCGGGG - Intergenic
1019737802 7:2659227-2659249 CAGCTCCTCCCCGCTGGCCTTGG + Intronic
1020137382 7:5594580-5594602 CCGCGCCGCCCCCGGGCCCAGGG + Intronic
1021133906 7:16943261-16943283 CCGAGCCTCCCCACTGCTGTGGG + Intergenic
1022471050 7:30682161-30682183 GCTCGCCTCCCGCCTACCCTCGG + Intronic
1022714979 7:32891357-32891379 CCGCGCCCCTCCCCCGCCCGCGG + Intronic
1023259677 7:38345786-38345808 CCCTGCCTCCCTTCTGCCCTGGG - Intergenic
1023260146 7:38350111-38350133 CCCTGCCTCCCTTCTGCCCTGGG - Intergenic
1023261126 7:38359265-38359287 CCCTGCCTCCCTTCTGCCCTGGG - Intergenic
1023840910 7:44097021-44097043 CCCCTCCTCCCTCCAGCCCTGGG - Intergenic
1023842472 7:44104926-44104948 CCACACCCCCGCCCTGCCCTGGG - Intronic
1023918387 7:44607377-44607399 CCGCGCCCTCGCCCTGACCTGGG + Intronic
1024318854 7:48045564-48045586 CCACGCCTCGACCTTGCCCTTGG + Intronic
1025143266 7:56483365-56483387 CCTCGCCCCGCCCCTTCCCTCGG - Intergenic
1025664409 7:63574678-63574700 CCGCCCACCACCCCTGCCCTGGG + Intergenic
1026736821 7:72954342-72954364 CCCCGCCCCGCCCCTACCCTTGG + Intergenic
1027106913 7:75410721-75410743 CCCCGCCCCGCCCCTACCCTTGG - Intronic
1027179142 7:75925711-75925733 CAGTGCCTCCACCCTGGCCTAGG - Intronic
1027260554 7:76461881-76461903 CCGCGCCACCCCGCGCCCCTGGG - Intronic
1027311933 7:76959994-76960016 CCGCGCCCCCCCGCGCCCCTGGG - Intergenic
1027421144 7:78019456-78019478 GCGCGCACCCGCCCTGCCCTCGG + Exonic
1029123703 7:98283893-98283915 CCTCGGCGCCCCCCAGCCCTGGG - Intronic
1029272324 7:99384636-99384658 CTGTGCCTCCTCCCAGCCCTGGG + Intronic
1029410430 7:100406252-100406274 CCCCACCTCCACCCTGCCCATGG - Intronic
1029467885 7:100737361-100737383 TCCCTCCTCCCGCCTGCCCTCGG + Intronic
1029857066 7:103528371-103528393 CCACCCCTCACCCCAGCCCTAGG - Intronic
1030072866 7:105712599-105712621 CAGCATTTCCCCCCTGCCCTAGG - Intronic
1030188725 7:106789803-106789825 CCCCTCCTCCTCCCCGCCCTGGG - Intergenic
1031288409 7:119901192-119901214 CCGCCCCTCCACCCAGCCCCAGG - Intergenic
1031484326 7:122310227-122310249 CCGCGCCGACCCGCTGGCCTTGG + Intronic
1032240376 7:130154718-130154740 TCGCGCCGCCTGCCTGCCCTCGG + Intergenic
1032410451 7:131690324-131690346 TCGCCCCTCCCTGCTGCCCTAGG - Intergenic
1033080602 7:138293634-138293656 CCGCTCCTCACTCCAGCCCTGGG + Intergenic
1033661976 7:143408670-143408692 CCGCGCCCCGCCCCTTCCCGGGG - Intronic
1034190952 7:149213247-149213269 CCCCGCTTTCCCTCTGCCCTGGG - Intronic
1035020436 7:155797292-155797314 CCACGGCTCCCTCCAGCCCTGGG + Intergenic
1035127170 7:156616843-156616865 CCGCGCCCCGCTCCTGCCCGCGG + Intergenic
1035264876 7:157685101-157685123 CCGCGGGTCCCGCCTGGCCTTGG + Intronic
1035266523 7:157692797-157692819 CCTCTCGTCCCCCCTGCCCAGGG + Intronic
1035331223 7:158098549-158098571 CCGTGCCTGCTCCCTGCCCCTGG - Intronic
1035349864 7:158238304-158238326 CCTCCCCTCCCTCCTGCCCTGGG + Intronic
1035395119 7:158529711-158529733 CCGCCCCTCCCCACAGCCCCTGG - Intronic
1036609093 8:10334430-10334452 CTGCACCTCCCCCCCGCCCCCGG - Intronic
1036695988 8:10975501-10975523 CCTCGCCCACCACCTGCCCTGGG + Intronic
1037305152 8:17497032-17497054 CCGCGCCCCGCCCCCGCCCCGGG + Intergenic
1037878665 8:22561952-22561974 CCGCGCCCCTCCGCAGCCCTCGG - Intronic
1043508970 8:80931301-80931323 ACGGGGCTCCCCGCTGCCCTGGG + Intergenic
1044576002 8:93769364-93769386 TCGCCTCTCCTCCCTGCCCTTGG - Intronic
1044933403 8:97271328-97271350 CCCCGCCACCCACCTGCCATAGG - Intergenic
1045653876 8:104367385-104367407 CCCGGCCTCTCCCCTCCCCTAGG - Intronic
1047353699 8:124100133-124100155 ACTCCCCTCCTCCCTGCCCTGGG + Intronic
1048186857 8:132249745-132249767 CCGAGCCTCCCCCTAGCCGTGGG - Intronic
1048302222 8:133260170-133260192 CCTCGCCTCACACCAGCCCTGGG - Intronic
1048766941 8:137854867-137854889 CCCCTCCTCCCTCCTGCCCTCGG + Intergenic
1048997227 8:139801502-139801524 CTGCCCCGCCCCCCTTCCCTTGG + Intronic
1049199101 8:141331259-141331281 CCCCACCTTCCCACTGCCCTCGG + Intergenic
1049350422 8:142161446-142161468 CCACGGCTCCACCCTGCCCTGGG + Intergenic
1049400534 8:142424784-142424806 CTGCGGCCACCCCCTGCCCTGGG + Intergenic
1049545242 8:143227779-143227801 CTGGGCCCCACCCCTGCCCTGGG + Intergenic
1049587853 8:143440270-143440292 CTGCACCTCCCCACTGCCCAGGG - Exonic
1049645892 8:143735433-143735455 CCATGCCTCTCCACTGCCCTGGG - Intergenic
1049673072 8:143878268-143878290 CCGCGCCCCTACCCTGGCCTCGG + Intronic
1049761125 8:144332414-144332436 CCCCGCTTCCGCCCTGCCCCGGG - Exonic
1051605274 9:18912119-18912141 CAGCTCCTCCCTCCTGCCGTGGG - Intergenic
1053736736 9:41107221-41107243 CCGCTCTTCCCCCCGGCTCTTGG + Intergenic
1056677214 9:88686004-88686026 CCGAGCCTCCCCGCTGCTGTGGG - Intergenic
1056970216 9:91195344-91195366 CCACACCTCCCCCCTGGCCTAGG + Intergenic
1059404150 9:114089603-114089625 CCATGGCTCCCCTCTGCCCTTGG + Intronic
1059941876 9:119367659-119367681 CTCCACCGCCCCCCTGCCCTTGG + Intronic
1059942137 9:119369010-119369032 CCCCGCAGCCCCGCTGCCCTTGG - Intronic
1059944513 9:119395232-119395254 CCCCGCCCCTCCCCTGCCCTGGG - Intergenic
1060781177 9:126414409-126414431 CCTCCCCTTCCCCCTGCCCACGG - Intronic
1060831902 9:126722583-126722605 CCACGCCTCTCCCCTGCTCCCGG - Intergenic
1060849261 9:126860884-126860906 CCGCGCCGGCCGCCTGCCCGCGG - Intronic
1060933411 9:127502991-127503013 ATGAGGCTCCCCCCTGCCCTGGG + Exonic
1061293665 9:129666043-129666065 CCGCGCCTCGGCCCTGGCCCCGG - Exonic
1061578992 9:131525276-131525298 CCGCCCCTCCCCGCAGCACTCGG + Intronic
1061754331 9:132802308-132802330 CCCCTCCCGCCCCCTGCCCTGGG - Intronic
1061859457 9:133460456-133460478 CCCCGCCGCCCCCCCGCCCTGGG - Intronic
1061959207 9:133979478-133979500 CCGCTCCTTCCTGCTGCCCTGGG - Intronic
1062202325 9:135310050-135310072 CAGCTCTTCCTCCCTGCCCTGGG - Intergenic
1062277269 9:135736881-135736903 CCTGGCCTCCCCCCTTCCCCGGG - Intronic
1062321440 9:135992411-135992433 CCACGGCTCACCCCTGCCCTGGG + Intergenic
1062428596 9:136517124-136517146 CCGCCCCCACCCCCTGCCCTCGG - Intronic
1062549450 9:137079208-137079230 CCGCCCCTCCGCCCAGCCCTCGG + Intronic
1062622582 9:137429444-137429466 CTGCACCTCCCCCCATCCCTGGG - Intronic
1203785834 EBV:127042-127064 CTGCGCCTCCCTCCTGCGCCTGG + Intergenic
1203662407 Un_KI270753v1:57604-57626 CTGAGCTTCCCCCCTGCCATGGG + Intergenic
1187281560 X:17861333-17861355 CCCCGCCTCCTCCCACCCCTTGG - Exonic
1187332536 X:18354249-18354271 CGGCGCATCCTCCCTGCCGTGGG - Intronic
1187688605 X:21841040-21841062 CCAGGCCTCACCCCTGACCTAGG + Intronic
1189137058 X:38561270-38561292 CCTCGCCTCCCTCCTCCGCTGGG + Intronic
1189209859 X:39275853-39275875 CCCCTCCACCCCCCTGCCGTGGG + Intergenic
1191979725 X:66912514-66912536 CAGAGCCTCCCCCTTGCCCGGGG - Intergenic
1192184898 X:68940339-68940361 CCGTGCCTGCCACATGCCCTAGG + Intergenic
1192988612 X:76427613-76427635 CCCCGCCCCGCCCCTCCCCTGGG - Intergenic
1196844586 X:119888210-119888232 CCGCGCCGCACCCCCGCCATGGG - Intergenic
1197978787 X:132194357-132194379 CTGAGCCTCCCCCATGCCGTGGG + Intergenic
1198296876 X:135295840-135295862 CCACGCCTCCCTGCTGCTCTGGG + Exonic
1199976565 X:152897994-152898016 TCGCCCCTCGCCCCTCCCCTCGG - Intergenic
1200101088 X:153689298-153689320 CCGCCCCTCCCCTCTGGCCCGGG + Intronic
1200143369 X:153913132-153913154 CCTCCCCTCCCGCCTGTCCTTGG - Intronic