ID: 927869407

View in Genome Browser
Species Human (GRCh38)
Location 2:26614097-26614119
Sequence CTCATTAGGAGGCCCGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 67}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927869395_927869407 13 Left 927869395 2:26614061-26614083 CCCTGGGAACAGAGCCCCGGCCA 0: 1
1: 0
2: 1
3: 15
4: 209
Right 927869407 2:26614097-26614119 CTCATTAGGAGGCCCGAAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 67
927869400_927869407 -3 Left 927869400 2:26614077-26614099 CCGGCCAGCTTGGCCAGCACCTC 0: 1
1: 1
2: 1
3: 37
4: 324
Right 927869407 2:26614097-26614119 CTCATTAGGAGGCCCGAAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 67
927869398_927869407 -1 Left 927869398 2:26614075-26614097 CCCCGGCCAGCTTGGCCAGCACC 0: 1
1: 0
2: 6
3: 31
4: 268
Right 927869407 2:26614097-26614119 CTCATTAGGAGGCCCGAAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 67
927869401_927869407 -7 Left 927869401 2:26614081-26614103 CCAGCTTGGCCAGCACCTCATTA 0: 1
1: 0
2: 1
3: 9
4: 141
Right 927869407 2:26614097-26614119 CTCATTAGGAGGCCCGAAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 67
927869396_927869407 12 Left 927869396 2:26614062-26614084 CCTGGGAACAGAGCCCCGGCCAG 0: 1
1: 0
2: 6
3: 26
4: 272
Right 927869407 2:26614097-26614119 CTCATTAGGAGGCCCGAAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 67
927869399_927869407 -2 Left 927869399 2:26614076-26614098 CCCGGCCAGCTTGGCCAGCACCT 0: 1
1: 1
2: 5
3: 29
4: 335
Right 927869407 2:26614097-26614119 CTCATTAGGAGGCCCGAAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927869407 Original CRISPR CTCATTAGGAGGCCCGAAGA GGG Intronic
900605714 1:3522724-3522746 CACAGTAGGAGGCCAGGAGAAGG + Intronic
903967729 1:27100723-27100745 CTCATGAGAAGGCCTGAAGGAGG - Intronic
905645348 1:39621546-39621568 CTCATCAGGAGGCGGGAAGAAGG - Intergenic
905688598 1:39926564-39926586 ATCATTAGCAGGCACTAAGAAGG - Intergenic
905690663 1:39940505-39940527 GGCAAAAGGAGGCCCGAAGAGGG + Intergenic
922830629 1:228551914-228551936 CTTATTAGTATGCCCGAAGTCGG + Intergenic
1066388611 10:34961230-34961252 CTCATGGGGAGACCTGAAGAGGG - Intergenic
1070602818 10:77877717-77877739 CACAGGAGGAGGCCCAAAGAGGG + Intronic
1080289454 11:30654561-30654583 CTCCTTATGAGCCCCCAAGAAGG - Intergenic
1081221852 11:40472048-40472070 CACTTTGGGAGGCCCGAGGAGGG + Intronic
1083895034 11:65615809-65615831 CTAAGGAGGAGGCCGGAAGAAGG - Exonic
1101254216 12:102961771-102961793 CTCATTTGGAGGACCAGAGATGG + Intergenic
1102390753 12:112546930-112546952 CTCATTAGGATGCCCCGAGGAGG + Intergenic
1103889032 12:124224715-124224737 CTCACCCGGAGGCCTGAAGACGG - Intronic
1106017640 13:25884472-25884494 CTCATTAGCAGGCTCTTAGAAGG + Intronic
1106521707 13:30504141-30504163 CTAATGAGGAGCCCTGAAGAAGG + Intronic
1107628123 13:42311519-42311541 CCCATTTGGAGGCACAAAGAGGG + Intronic
1109414461 13:62020359-62020381 CTCATTTGGAGGCCACAATAAGG - Intergenic
1111071219 13:83171170-83171192 CTCAATAGGAGGTACCAAGATGG + Intergenic
1113136954 13:107101365-107101387 CTCTATAGGAGGCCACAAGAGGG - Intergenic
1121967662 14:98325536-98325558 CTCCTTGGGAGGGCAGAAGATGG - Intergenic
1124392128 15:29269164-29269186 ATCATCAGGAGGCCCGTAGTGGG + Exonic
1125005120 15:34808103-34808125 CCCATTTGGAGGCCAGGAGATGG + Intergenic
1127018124 15:54711770-54711792 CTCATTAGGTGGCACGATGCCGG - Intergenic
1142133824 16:88442710-88442732 CTCCGCAGGAGGCCCGTAGACGG + Intergenic
1149745738 17:59095964-59095986 CACGTTGGGAGGCCCAAAGATGG - Intronic
1164371721 19:27649436-27649458 CCCATTAGAATGCCCGAAGTTGG + Intergenic
1164521558 19:28983799-28983821 CTCATCAGGTGGCCCTCAGAGGG - Intergenic
1168272943 19:55259761-55259783 CACTTTAGGAGGCCCGAGGCCGG + Intergenic
926768114 2:16341599-16341621 GTCATTAGGATGCTTGAAGAAGG - Intergenic
927869407 2:26614097-26614119 CTCATTAGGAGGCCCGAAGAGGG + Intronic
929062259 2:37934416-37934438 CTCATAAGGTGGCCCTCAGAGGG + Intronic
937227296 2:120377249-120377271 CACATTAGGTGGCCCACAGAGGG - Intergenic
939791435 2:146582676-146582698 CTCATAAGGAAGCCCAAAGGTGG + Intergenic
941393318 2:164943565-164943587 CTCATCAGGAGGTTGGAAGAGGG + Intronic
1179007999 21:37531471-37531493 CTGACTTGGAGGCCCGAGGAAGG + Intergenic
1182905346 22:33931105-33931127 CACTTTGGGAGGCCCGAAGCAGG - Intergenic
953107447 3:39898068-39898090 CTCATCAGGAAGCTAGAAGATGG + Intronic
956650914 3:71503856-71503878 CTCATTAGGGGGTCAGGAGAAGG + Intronic
957258814 3:77873775-77873797 TTCATTTGGAGGCAGGAAGACGG + Intergenic
960531664 3:118772393-118772415 CTAATTAGCAGGCACCAAGAAGG - Intergenic
978027578 4:103896647-103896669 CTCATGAGGAGTCCTGGAGAAGG + Intergenic
981753760 4:148119086-148119108 TTCATTAGGTGGGCAGAAGAGGG - Intronic
990773516 5:59278331-59278353 CTGATGAGGAGGCCTGAATATGG + Intronic
991127083 5:63081457-63081479 CCCAATAGGAGCCCTGAAGAAGG + Intergenic
998027302 5:138829483-138829505 CTGATTAGGAGGCTCTAAAACGG - Intronic
1001251413 5:170149750-170149772 CTCAGGAGGAGCCCCAAAGAAGG + Intergenic
1006169312 6:32084065-32084087 CTCATTCGAAGGCCCCTAGAGGG - Intronic
1007646024 6:43381892-43381914 CTAATTAGCTGGCCTGAAGATGG + Intergenic
1011138381 6:84125023-84125045 CTTATTAAAAGGCCTGAAGATGG - Exonic
1015243621 6:131053394-131053416 CTCATTAGGAGACGGGACGAAGG + Intronic
1015423088 6:133033851-133033873 ATCATTTGGAGGCCCTAAAAAGG - Intergenic
1016781334 6:147962693-147962715 CTCAATAGGAGACCCCAAGCTGG - Intergenic
1025724757 7:64046275-64046297 CACTTTAGGAGGCCCGAGGGGGG - Intronic
1025753785 7:64314817-64314839 CACTTTAGGAGGCCCGAGGCGGG - Intronic
1029354388 7:100040700-100040722 GTAATTAGGAGGCCTGAGGAGGG + Exonic
1030018526 7:105248693-105248715 CACTTTAGGAGGCCCGAGGCAGG + Intronic
1030538965 7:110804770-110804792 CTCATTAGCATGGCCGAAGCTGG - Intronic
1033646915 7:143311982-143312004 CTTATTTGGAGGCACAAAGATGG - Intergenic
1049076720 8:140402446-140402468 CACTTTGGGAGGCCCGAAGCAGG + Intronic
1049613256 8:143565556-143565578 CTCAGTAGCAGCCCCAAAGAGGG - Intergenic
1050033593 9:1412072-1412094 CTGATGAGGAAGCCAGAAGAGGG + Intergenic
1051441529 9:17088440-17088462 CTCTTTGGGAGGCCGGAGGATGG + Intergenic
1055750587 9:79500565-79500587 CACATTAGGAGGAGCCAAGATGG - Intergenic
1062482193 9:136757709-136757731 CACATTAGCAGGCCCAGAGAAGG - Intronic
1186472654 X:9833502-9833524 CTAATTAGGAGGTCCGATGCAGG - Intronic
1186572628 X:10731710-10731732 CACTTTGGGAGGCCCGAAGCAGG + Intronic
1189429165 X:40932009-40932031 AGCATTAGGAGGGCCAAAGATGG + Intergenic
1189993004 X:46612276-46612298 ATGATTAGGATGGCCGAAGAGGG + Intronic