ID: 927872377

View in Genome Browser
Species Human (GRCh38)
Location 2:26631779-26631801
Sequence CAGGAGGACTGGAGGTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 277}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927872364_927872377 8 Left 927872364 2:26631748-26631770 CCTCCCTTTCCCTCTGGCTTAAG 0: 1
1: 0
2: 0
3: 26
4: 300
Right 927872377 2:26631779-26631801 CAGGAGGACTGGAGGTATGAGGG 0: 1
1: 0
2: 3
3: 20
4: 277
927872367_927872377 5 Left 927872367 2:26631751-26631773 CCCTTTCCCTCTGGCTTAAGGGA 0: 1
1: 0
2: 3
3: 19
4: 231
Right 927872377 2:26631779-26631801 CAGGAGGACTGGAGGTATGAGGG 0: 1
1: 0
2: 3
3: 20
4: 277
927872368_927872377 4 Left 927872368 2:26631752-26631774 CCTTTCCCTCTGGCTTAAGGGAA 0: 1
1: 0
2: 2
3: 19
4: 217
Right 927872377 2:26631779-26631801 CAGGAGGACTGGAGGTATGAGGG 0: 1
1: 0
2: 3
3: 20
4: 277
927872363_927872377 11 Left 927872363 2:26631745-26631767 CCACCTCCCTTTCCCTCTGGCTT 0: 1
1: 2
2: 14
3: 173
4: 1523
Right 927872377 2:26631779-26631801 CAGGAGGACTGGAGGTATGAGGG 0: 1
1: 0
2: 3
3: 20
4: 277
927872362_927872377 12 Left 927872362 2:26631744-26631766 CCCACCTCCCTTTCCCTCTGGCT 0: 1
1: 0
2: 8
3: 114
4: 1168
Right 927872377 2:26631779-26631801 CAGGAGGACTGGAGGTATGAGGG 0: 1
1: 0
2: 3
3: 20
4: 277
927872370_927872377 -2 Left 927872370 2:26631758-26631780 CCTCTGGCTTAAGGGAAGCTCCA 0: 1
1: 0
2: 1
3: 14
4: 170
Right 927872377 2:26631779-26631801 CAGGAGGACTGGAGGTATGAGGG 0: 1
1: 0
2: 3
3: 20
4: 277
927872369_927872377 -1 Left 927872369 2:26631757-26631779 CCCTCTGGCTTAAGGGAAGCTCC 0: 1
1: 0
2: 1
3: 17
4: 175
Right 927872377 2:26631779-26631801 CAGGAGGACTGGAGGTATGAGGG 0: 1
1: 0
2: 3
3: 20
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927872377 Original CRISPR CAGGAGGACTGGAGGTATGA GGG Intronic
900772158 1:4553903-4553925 CAGGAGTACTGAAGCCATGAAGG + Intergenic
902992102 1:20195403-20195425 CTTGAGTGCTGGAGGTATGAAGG + Exonic
903396176 1:23003417-23003439 AAGGAGGAATGGAGGGAGGAAGG + Intergenic
903480887 1:23652471-23652493 CGGGAGGACTGAAGGGAGGAGGG + Intergenic
903761900 1:25704205-25704227 CAGCAGGACTGGGGGCAGGAAGG - Intronic
903859757 1:26357475-26357497 CAGGGGGACTGGGGGTGTGGTGG - Intergenic
903919513 1:26789296-26789318 CAGGAGGCCTGGAGGAAGGGAGG - Intronic
905266302 1:36756445-36756467 GAGGAGGACAGGAGGAAAGAGGG + Intergenic
905278752 1:36835750-36835772 CAAGAGGGCTTGAGGGATGAAGG - Intronic
906138960 1:43521959-43521981 AAGGAGGCTAGGAGGTATGAAGG + Intergenic
906686875 1:47768470-47768492 CAGCAAGACTGTAGGTGTGATGG - Intronic
906744675 1:48213464-48213486 AAGGAGGACTGGAGGGTGGAAGG + Intergenic
907570164 1:55476107-55476129 CCAGAGGAGTGGAGGAATGAGGG + Intergenic
911104364 1:94118390-94118412 CAGGAGACATGGAGGTTTGAGGG + Intronic
913391503 1:118318097-118318119 CAGGAGCTCTGGAGGTGTGGAGG + Intergenic
915524827 1:156469093-156469115 CAGGAGGACTGTGGGGATGAGGG + Intronic
915738813 1:158102340-158102362 CTGGAGGAATGCAGGTATGGAGG + Intergenic
916389584 1:164316919-164316941 CAGGAGGCCTGGAAGGAAGAAGG + Intergenic
916453786 1:164949240-164949262 CAGGAGAACTGGTGGGCTGAGGG + Intergenic
917060856 1:171037227-171037249 AAGGAGGAAGGGAGGAATGACGG + Intronic
918439808 1:184555703-184555725 GAGGAGGACTGGAGGTGGGGTGG + Intronic
918441975 1:184576717-184576739 CATGAGAACTGGAGGTAGGGAGG - Intronic
921075569 1:211697808-211697830 CAGGAGGGCTGCAGGCATGTAGG + Intergenic
922033289 1:221825014-221825036 CAGGAGGTGTGGAGGTTTGTTGG + Intergenic
922992388 1:229925457-229925479 CAGGAGCTCTGGATGTATGCTGG + Intergenic
923876014 1:238048198-238048220 AAGGATGACAGGAGGTAAGAAGG + Intergenic
1062824538 10:557945-557967 CTGGAGGGCTGGAGGCAGGAGGG + Intronic
1063455495 10:6179612-6179634 CAGGAGGACTGCAGGCAAGAGGG + Intronic
1064320535 10:14300284-14300306 GAGAAGGCTTGGAGGTATGATGG + Intronic
1066449044 10:35511402-35511424 CAGGTGGTCTGGTGGTAGGAAGG + Intronic
1067346340 10:45441515-45441537 CAGGAGGCCTGGAAGGGTGAAGG + Intronic
1067757626 10:49016857-49016879 CAGGAAGCCGGGAGGTATGAAGG - Exonic
1069784289 10:70977875-70977897 CAGGATGACTGCAGGGATGATGG + Intergenic
1069812007 10:71168199-71168221 CAGGAGCACAGTAGGTAAGAAGG - Intergenic
1071338825 10:84624024-84624046 CAGGAGGCCTGGGGTTATGCGGG - Intergenic
1072303713 10:94086724-94086746 CAGGAGCACTGTTGGAATGATGG + Intronic
1072321247 10:94252313-94252335 CAGGAGGATGGACGGTATGAAGG + Exonic
1072606169 10:96984576-96984598 CAAGAGTACTGAAGGAATGAAGG + Exonic
1073150229 10:101306300-101306322 CAAGAGGAATTGAGGTTTGACGG - Intergenic
1073191859 10:101657071-101657093 CGGGAGGATTGGAGGGAGGAGGG - Intronic
1076040498 10:127243631-127243653 CAGGAGGGCTGGGGGTGTGCGGG + Intronic
1077274569 11:1697925-1697947 AAGGAGGACAGGAGGACTGATGG - Intergenic
1077498767 11:2899470-2899492 CAGGCTGACTGGAGGAAGGAAGG - Exonic
1077847944 11:6045887-6045909 CAGGAGGACTAAAGGGATGAAGG + Intergenic
1078156632 11:8805556-8805578 CTGAAGGACTGGAAGTAGGAGGG - Intronic
1078270352 11:9789053-9789075 CAGGGGCCCTGGAGGCATGAGGG - Intronic
1079369452 11:19838234-19838256 CAGGAGGAGTGTAGTGATGATGG + Intronic
1079370273 11:19846634-19846656 CAGGAGGACTGAATGTGTGATGG - Intronic
1079453372 11:20616867-20616889 CTGTAGGACTGTAGGAATGATGG - Intronic
1081441346 11:43084987-43085009 CAGGAGGTCTGGTGGTTTGAAGG - Intergenic
1081703765 11:45168414-45168436 TGGGAGGAGTGTAGGTATGAGGG + Intronic
1082890452 11:58133346-58133368 CAGGAGGGCTGAAGGCATAAGGG + Intronic
1085471803 11:76763290-76763312 CAGGAGTAATGCAGGGATGACGG + Intergenic
1086530323 11:87777477-87777499 CAGGAGGAAGGGAGGGATGGGGG - Intergenic
1088814222 11:113410447-113410469 TAGGGGGACTGGAGGTGGGAGGG + Exonic
1089286545 11:117411283-117411305 CAGCAGGACTGGGGGAATAAGGG - Intronic
1091724291 12:2834799-2834821 CAGGAGGCCAGGAGAGATGAGGG - Exonic
1092063448 12:5569422-5569444 AAGGAGGACTGGAGGGGTGAGGG - Intronic
1092078437 12:5692726-5692748 TAGGTGGTCTGGAGGTGTGATGG + Intronic
1092489239 12:8930383-8930405 AAGGAGGACTGGAGGCATTAAGG - Intronic
1092704838 12:11271160-11271182 CAGCTTGGCTGGAGGTATGATGG + Intergenic
1092745569 12:11669334-11669356 CAGGAGGACGGGAGGAAAGGAGG - Intronic
1096355728 12:50939075-50939097 CAGGAGGAGTGAAGGTGTGGAGG - Intergenic
1097048051 12:56202365-56202387 CAGGAGAACTGGGGGAAGGAGGG - Exonic
1097179901 12:57165876-57165898 CAGGAGCGCTGGAAGTGTGACGG + Exonic
1097221684 12:57454965-57454987 TAGAAAGACTAGAGGTATGAGGG + Intronic
1099890488 12:88583549-88583571 CAGGTGGACAGGAGGGATGGGGG + Intergenic
1100370720 12:93966760-93966782 AGGGAGGAGTGGAGGGATGAAGG - Intergenic
1100370739 12:93966835-93966857 AGGGAGGAGTGGAGGGATGAAGG - Intergenic
1101278538 12:103227130-103227152 AAGGAGGAATGGAGGTTGGAAGG + Intergenic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1103848435 12:123915507-123915529 CGGAAGGACTGGAGGGGTGATGG - Intronic
1105441202 13:20416425-20416447 CAGGAGGTCTGGAGGCAGGAAGG + Intronic
1105947437 13:25201896-25201918 CAGGAGGTCCAGAGGTATGTTGG + Intergenic
1106658076 13:31768765-31768787 CAGGAGGAGTTGAGGAATGTGGG - Intronic
1107703792 13:43078084-43078106 AAGGAGGACTCGAGATATAATGG - Intronic
1109217795 13:59609879-59609901 CAGGAGGACTGCAGGAAAAAAGG - Intergenic
1109845463 13:67983926-67983948 CAGGAGGCCTGGAAGTGGGAGGG + Intergenic
1110613876 13:77519914-77519936 CAAGAAGGCTGGAGGAATGAAGG + Intergenic
1110650663 13:77938143-77938165 CAGGAGGAATGGAGGGTGGAAGG + Intergenic
1112533250 13:100224607-100224629 CAGGAGGACTGCAAGTATTCAGG + Intronic
1112835748 13:103512195-103512217 GAGGAGGATTGGAGGAAGGAGGG + Intergenic
1113483674 13:110639370-110639392 CTGGAGGACTTGAGGCATGCTGG + Exonic
1113732999 13:112655935-112655957 CAGGTGGACAGGAGGTGAGAGGG + Intronic
1114853113 14:26404391-26404413 GAGGAGGAATGGAGGAAGGATGG + Intergenic
1116218934 14:42056770-42056792 AAGGAGGAATGAAGGAATGAAGG + Intergenic
1120764448 14:88315906-88315928 AAGAAGGACGGGAGGAATGAAGG + Intronic
1120889846 14:89482237-89482259 CAGGAGGCCGGGAAGTATGGAGG - Intronic
1121779149 14:96610727-96610749 CAGGAGGACTGGTGGAAAGTTGG - Intergenic
1122632746 14:103114473-103114495 CAGGAAGACTAGAGATAAGAAGG - Intergenic
1122891499 14:104734201-104734223 CAGGTGGGCTGGTGGCATGATGG - Intronic
1125720446 15:41842651-41842673 GAGGAGGCCTGGAGGAGTGAGGG + Intronic
1127817538 15:62625037-62625059 CAGGATGACTGGAGGATTCAGGG + Intronic
1129136316 15:73555391-73555413 CAGGAGGTCTGGAGGCATGAAGG - Intronic
1132500228 16:281731-281753 CAGGAGGACTGGGGGTGGGGAGG - Exonic
1132843903 16:1991186-1991208 CAGGAGGCATTGAGGTTTGACGG + Intronic
1133326840 16:4947113-4947135 ATGGAGGAATGGAGGGATGAAGG - Intronic
1135719297 16:24801426-24801448 CTGGAGGACTGGTGGACTGAGGG + Intronic
1136294172 16:29292201-29292223 CAGCAGTACTGGAGCTATGGGGG + Intergenic
1136344086 16:29664055-29664077 CAGGATGACTGGTTGCATGAGGG - Exonic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1140874412 16:79137717-79137739 CAGGAGGAGTGGGGGCAGGAAGG - Intronic
1141637265 16:85320875-85320897 CAGGAGGACAGCAGGTACCAAGG - Intergenic
1143815101 17:9506597-9506619 GAGGAGGCCTGGACATATGAAGG + Intronic
1144327196 17:14193702-14193724 CAGGAGGGCTGGTGGTGTGCAGG - Intronic
1144476084 17:15590565-15590587 CAGGAGGGCTGGTGGTGTGCAGG - Intronic
1146948986 17:36892758-36892780 TAGGAGGGCTGGTGGGATGAGGG - Intergenic
1147257835 17:39192660-39192682 GAGGAGGACTGCAGGGATGTAGG + Intronic
1150636972 17:66919828-66919850 CAGGAGGAATGAAGGGATGTGGG - Intergenic
1152245861 17:79184237-79184259 CAGGAGGCTGGGATGTATGATGG - Intronic
1152358219 17:79816712-79816734 ATGGAGGCCTGGAGGAATGAAGG - Intergenic
1154040141 18:10846850-10846872 CAGGGGAACTGCAGGCATGATGG + Intronic
1154291871 18:13115628-13115650 CAGGCAGACTGGAGATAGGAGGG + Intronic
1156664308 18:39386698-39386720 CAGGAGTGCTGGAAGTAAGAGGG - Intergenic
1157519544 18:48336106-48336128 CAGAAAGACTGGAGGCAGGAGGG - Intronic
1157768851 18:50326763-50326785 CAAGAGGACTGGAGCCATTAGGG + Intergenic
1158873197 18:61708851-61708873 CAGGTGAACTAGAGGGATGAAGG - Intergenic
1160047414 18:75399920-75399942 CAGGAGGGGTGGGGGTAAGATGG + Intergenic
1160205143 18:76825244-76825266 CAGGAGGACTGGTGTTCAGAAGG - Intronic
1161764170 19:6197388-6197410 CAGGAGGAGCTGAGGTATGTGGG - Intronic
1161845254 19:6708500-6708522 AAGGAGGAATGGAGGGAGGAAGG - Intronic
1163203747 19:15787406-15787428 CAGGAGGAAGGGAGGAAAGATGG + Intergenic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164439128 19:28258660-28258682 CAAGAGGAGTGGAGGAGTGAGGG - Intergenic
1164770799 19:30807308-30807330 CAGGTGCACTGGAGGAATTATGG + Intergenic
1164816072 19:31204391-31204413 AAGGAGGAATGGAGGTACCAAGG - Intergenic
1164911626 19:32017129-32017151 GATGGGGAATGGAGGTATGATGG - Intergenic
1164926847 19:32137379-32137401 CTAGAGGACTGGAGGGAGGAAGG + Intergenic
1165079285 19:33298443-33298465 GAGGAGGACTCGGGGTAGGAGGG + Intergenic
1165164307 19:33840658-33840680 GATGGGGACTGGAGGCATGAGGG - Intergenic
1165926067 19:39327120-39327142 GAGGAGGACTGGAGACAAGAGGG - Intergenic
1166493341 19:43278884-43278906 CAGGAAGACTGCAGGTATGATGG - Intergenic
1168127010 19:54289846-54289868 CAGGAGGGGTGGGGGCATGAAGG + Intergenic
1168173440 19:54606614-54606636 CAGGAGGGGTGGGGGCATGAGGG - Intronic
925073225 2:987747-987769 CTGGAGGACAGGAGGGTTGATGG + Intronic
927872377 2:26631779-26631801 CAGGAGGACTGGAGGTATGAGGG + Intronic
928875605 2:36035058-36035080 CAGGAGGACGGTATGTAAGAGGG - Intergenic
928914160 2:36454165-36454187 GAGGAGGACTGGGGTTATTATGG - Intronic
930696347 2:54415947-54415969 CAGGAGGACAGCAGGGATTAGGG - Intergenic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
931088174 2:58857148-58857170 CAGGAGGGATGGAGAGATGAAGG + Intergenic
931285549 2:60828780-60828802 AGGAAGGAGTGGAGGTATGAGGG + Intergenic
933860337 2:86460381-86460403 CAGGAGGGCTGGAGAGATAAAGG + Intronic
934060331 2:88286409-88286431 AAGGAGGACTGGGGGTCGGAAGG - Intergenic
934729540 2:96647913-96647935 CAGGGTGGCTGGAGGAATGAGGG + Intergenic
935216006 2:100975841-100975863 CAGGGGCTCTGGGGGTATGAGGG - Intronic
936115596 2:109700456-109700478 CAGGAGGACTGGAAGGAAGCGGG + Intergenic
936233643 2:110725220-110725242 AAGGAGGAATGGAGGGAGGAAGG + Intergenic
936715356 2:115180901-115180923 CAGGAGGAAGGGAGGCATGGAGG - Intronic
937638478 2:124184807-124184829 CAGGAGCACTGGACCTAAGATGG + Intronic
938708053 2:133951028-133951050 CAAGAAGACTAGAGGTAGGAAGG + Intergenic
938828614 2:135032049-135032071 CAGCAGAAATGGTGGTATGAGGG - Intronic
940845156 2:158632504-158632526 CATGAGGACTGGCGGTACAAGGG - Intronic
941015096 2:160346561-160346583 CAGGAGGAGTGGACGGATGATGG - Intronic
942150750 2:173074540-173074562 CTGGATGACTGGAAGAATGATGG - Intergenic
942181402 2:173384355-173384377 CTGGAAGACTGGAAGGATGAAGG - Intergenic
946488660 2:220126215-220126237 GAGGAGGACTGCAGGGAAGAAGG + Intergenic
947832480 2:233151417-233151439 CGGGAGGACTGGAGCTAGGTGGG - Intronic
947855346 2:233320245-233320267 CAGGATGTCTGGACGAATGAAGG - Intronic
948238496 2:236408773-236408795 CTGGAGGCCTTGAGGTTTGAGGG + Intronic
948296223 2:236862707-236862729 CAGGATGACTGGTTGGATGAAGG - Intergenic
948678247 2:239611735-239611757 CAGTGTGACTGGAGGTGTGATGG - Intergenic
949081068 2:242100195-242100217 CAGGATGAATGGATGTCTGAGGG + Intergenic
1169642261 20:7766760-7766782 CAGGAGGAATGGGGATATCATGG + Intergenic
1169869739 20:10237898-10237920 CAGGAGAAATGGTGGTATGGGGG - Intronic
1170223444 20:13965110-13965132 CAGGAGGTCAGGAAGTAGGAAGG + Intronic
1170289036 20:14747054-14747076 CATGAGGACTGGACATATGATGG - Intronic
1170592766 20:17783505-17783527 CAGGAGGAGTGGAGGTTGGGTGG - Intergenic
1170867982 20:20177372-20177394 CAGGAGGTCTGGAGATAGGCAGG + Intronic
1171139479 20:22728751-22728773 CAAGGGGACTGGAGCTAAGATGG - Intergenic
1171338094 20:24405860-24405882 CAGGTGGGCTGGTGGTAAGAAGG - Intergenic
1172314566 20:33943758-33943780 CTGGAGGAGTGGAGTGATGATGG + Intergenic
1172703217 20:36864844-36864866 CAGGAGGACTTGAGCTCTGATGG + Intergenic
1173003615 20:39123246-39123268 CACCAGAACTGGAGGCATGAAGG - Intergenic
1173640201 20:44596413-44596435 CATGAAGACTGGAGGTGTGGGGG + Intronic
1175723637 20:61302583-61302605 CAGGATGACTTGAGGGATGGAGG - Intronic
1179124577 21:38579556-38579578 CATGAGGACTGGAGGAAAGAGGG + Intronic
1179415562 21:41195580-41195602 CAGGGAGAATGGAGGTGTGAGGG - Intronic
1180787933 22:18557342-18557364 CAGGAGGCCTGGAGCTATGCTGG + Intergenic
1181233805 22:21437976-21437998 CAGGAGGCCTGGAGCTATGCTGG - Intronic
1181244845 22:21496867-21496889 CAGGAGGCCTGGAGCTATGCTGG + Intergenic
1182355884 22:29722065-29722087 CAGGAGGAGGGGATGGATGAGGG - Intronic
1182668467 22:31975918-31975940 CAGGTGTACTGGAAGTATAAAGG + Intergenic
1182718178 22:32376677-32376699 CAGGAGGACAGGAGCCATGGTGG - Intronic
1183467670 22:37987819-37987841 CAGGGAAACTGGAGGTAGGAGGG - Intronic
1183492955 22:38126555-38126577 CAGGGGGAGTGGGGGGATGAGGG - Intronic
1184126659 22:42492103-42492125 CAGGAGGACAAGAGGCAGGACGG - Intergenic
1184425360 22:44406041-44406063 CAGGAGGCCTGGGAGAATGAAGG - Intergenic
1184900858 22:47445627-47445649 CAGGAGGACAGGAGGTCAGGAGG - Intergenic
1184902181 22:47453316-47453338 CAGGAAGAAGGGAGGGATGAGGG - Intergenic
1185134285 22:49060308-49060330 CAGGAGGGCTGGAGGGTGGAAGG - Intergenic
1185185917 22:49400237-49400259 CGGGAGGGCTGGAGGCAGGAGGG + Intergenic
949840604 3:8315864-8315886 CAGGAGGGCTGAAGGCATAAGGG - Intergenic
950430723 3:12949493-12949515 CATGAGGCCTGGAGGCGTGATGG - Intronic
950440890 3:13009585-13009607 CAGGAGGAGGTGAGGGATGAGGG - Intronic
950692270 3:14669185-14669207 AAGGAGGAGTGTGGGTATGAAGG + Intronic
955027719 3:55186586-55186608 CAGGTGGACAGGAGTTATCAAGG + Intergenic
955991675 3:64634356-64634378 CAGAATGAATGGAGGTGTGAGGG - Intronic
957278435 3:78118788-78118810 CAGGCTGACTGGAGCTAGGAGGG - Intergenic
958266051 3:91438366-91438388 CAGGAATACTGGAGGTAGGCTGG + Intergenic
958516339 3:95121068-95121090 CTGGAGCCCTGGAGGCATGAGGG + Intergenic
960997059 3:123347329-123347351 CAGGAGGACTGGTGATAAGGTGG + Intronic
962039708 3:131693745-131693767 CAGGAAGAGGGGAGGTAAGAGGG - Intronic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964176237 3:153828096-153828118 AAGGAGGAATGGAGGGTTGAAGG + Intergenic
966407050 3:179608791-179608813 CAAGTTGACTGGAGGTCTGAAGG - Intronic
967411437 3:189170128-189170150 CAGGAGGAGTGGAGACATGCTGG - Intronic
968653231 4:1768051-1768073 CAGGAGGACGGGAGGCGTGCAGG - Intergenic
970621907 4:17830810-17830832 CAGGTGGAGGGGAGGTATCATGG + Intronic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
972142024 4:35972824-35972846 CTGTAGGATTGGAGGTAGGAGGG - Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
975989476 4:80242513-80242535 CAGGAGGACTGCTTGTATGCAGG - Intergenic
976558423 4:86475835-86475857 AAGGAGGAATGGAGGGGTGAAGG - Intronic
976615098 4:87068536-87068558 CAGGGAGACGGGAGGTATGGAGG + Intronic
976673801 4:87682651-87682673 CAAAAGGAGTGGAGGCATGAAGG - Intergenic
977183846 4:93911614-93911636 CAGGAGGAATAGAGGAAAGAGGG - Intergenic
977614300 4:99070374-99070396 CTAGAGGGCTGGAGATATGAGGG - Intergenic
982180921 4:152747788-152747810 TAGGAGGAGAGGAGGTATAAAGG - Intronic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
983511064 4:168610242-168610264 CAGGAGAACAGGAGCTCTGAGGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986979088 5:13425924-13425946 TAGGAGGACTGAAAGTTTGAGGG + Intergenic
993092948 5:83449774-83449796 CTGGAGCACTGCAGGTATTATGG + Intergenic
993471875 5:88316440-88316462 CAGGACAACTGGAGGTAGCAAGG - Intergenic
995554495 5:113313510-113313532 AAGGAGGGTTGGAGATATGATGG + Intronic
996509759 5:124305034-124305056 AAGGAGGACTGGAGGGTGGAAGG - Intergenic
997725993 5:136120251-136120273 GAGGAAGGCTGGAGGTATCAGGG - Intergenic
998159664 5:139806271-139806293 CAGCAGGGCTGGAGGTGGGAAGG + Intronic
998394333 5:141808750-141808772 CATGAGGCCTGGAGGAAGGATGG + Intergenic
1000364220 5:160476283-160476305 CCGAAGAACTGGAGGTTTGAGGG + Intergenic
1000559269 5:162765790-162765812 CAAGAGGTCTGGGGGTATGTGGG - Intergenic
1001120886 5:168979007-168979029 CAGCCTGACTGGAGGTAGGATGG + Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1002063045 5:176637738-176637760 GAGGAGGGCTGGAGGGAGGAGGG + Intronic
1003961546 6:11213608-11213630 CAGGGGGACTGGAAGGATGGTGG - Exonic
1007389995 6:41545583-41545605 CAGGGGGACTGGAGGGATTGTGG - Intergenic
1007533627 6:42564654-42564676 CTGGGGGAAAGGAGGTATGATGG - Intronic
1008624096 6:53300883-53300905 CAGGAGGGCTGCAGGAAGGAGGG - Intronic
1008989305 6:57584269-57584291 CAGGAATACTGGAGGTAGGCTGG - Intronic
1009177893 6:60482821-60482843 CAGGAATACTGGAGGTAGGCTGG - Intergenic
1011447965 6:87463023-87463045 GAGGTGGACTGGGGGTAGGATGG + Intronic
1011525957 6:88265238-88265260 CAGCATGACTGGTGGGATGAAGG + Intergenic
1017922272 6:158882852-158882874 GAGGAGGATTGGAGGATTGAAGG + Intronic
1018146001 6:160889420-160889442 CAGGAAGACTGGAAGTGCGAAGG - Intergenic
1019157313 6:170047962-170047984 CAGAAGGACTGGAGGTTGAAGGG + Intergenic
1019398360 7:835858-835880 CAGGGGGGCTGGAGACATGAGGG + Intronic
1019800677 7:3085795-3085817 CAGGAGGCAGGCAGGTATGAAGG + Intergenic
1021283300 7:18747004-18747026 AATGAGGACTGGAGTTATGGAGG + Intronic
1023743004 7:43297585-43297607 CAGGAGCAGCGGAGGCATGATGG - Intronic
1023812701 7:43924726-43924748 CAGGTGGGCTGGAGGTAGGAAGG + Intronic
1025941069 7:66076426-66076448 CAGGAGGACACGTGGTAAGAAGG - Intronic
1026777489 7:73239769-73239791 CAGGATGGCTTGAGATATGATGG - Intergenic
1027018342 7:74793141-74793163 CAGGATGGCTTGAGATATGATGG - Intergenic
1027069686 7:75152777-75152799 CAGGATGGCTTGAGATATGATGG + Intergenic
1027475649 7:78628019-78628041 CAGAGGGAATGGAGCTATGACGG + Intronic
1028274382 7:88835285-88835307 CAGGAGTACTGGTGATGTGAAGG - Intronic
1030751649 7:113238014-113238036 AAGGAGGAATGGAGGTTGGAAGG + Intergenic
1032298058 7:130660483-130660505 CTGTAGGCCTGGTGGTATGAGGG - Intronic
1033231801 7:139604072-139604094 CTGGCGGACTGGAGGTAAGCAGG - Exonic
1033597249 7:142866682-142866704 CAGGTGCACAGGAGGAATGAGGG + Intronic
1036156563 8:6347548-6347570 CAGGAGGACAGGAGAGATGGAGG - Intergenic
1037308045 8:17526430-17526452 TAGGAGGACAGGACGCATGATGG + Intronic
1037310067 8:17545718-17545740 AAGCAGGACTGCAGGTAAGAAGG - Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1038139437 8:24827136-24827158 CAAGAGGTCAGGAGGTAGGAAGG + Intergenic
1038449260 8:27628742-27628764 AAGGAGGACTAGAAGTATGTAGG + Intergenic
1038957434 8:32482769-32482791 CAGAAGGACTGGAGCTGTGGGGG + Intronic
1039498665 8:38000170-38000192 CAGGAGGCAGTGAGGTATGACGG + Intergenic
1039886182 8:41655213-41655235 CAAGTGGAATGGAGGTATGTGGG + Intronic
1042050346 8:64697568-64697590 GAGGAGGGCTGAAGGAATGAAGG + Intronic
1042680494 8:71378192-71378214 CAGGAAGACTGGGGGTGGGAGGG - Intergenic
1044755043 8:95452731-95452753 CAGGAGGATTGGAGGCTTGCGGG - Intergenic
1047480778 8:125280937-125280959 CAGGAAGACTGTAGGTTTGTAGG - Intronic
1049144287 8:140986701-140986723 CAGCAGAACTAGAGCTATGAGGG + Intronic
1051326508 9:15977028-15977050 CAGGAGGACTGGAGGAATGGAGG - Intronic
1051361500 9:16285449-16285471 CAGGAGGGCTGATGGGATGAGGG - Intergenic
1052448957 9:28601470-28601492 CTGGAGGACTAGAGGTATCAGGG + Intronic
1052792706 9:32890776-32890798 CAGGGTCACTGGAGGTGTGATGG - Intergenic
1053273397 9:36765700-36765722 CAGGAGGACTGGAGATCTCCAGG + Intergenic
1056278677 9:85018517-85018539 TTGGAGGACTTGCGGTATGAGGG - Intronic
1056572904 9:87831737-87831759 CAGGAGGGAGGGAGGCATGAAGG + Intergenic
1058369999 9:104255414-104255436 CAGGAAGACTGGAAGTAGGGAGG - Intergenic
1058641347 9:107088702-107088724 CAGCAGGAGAGGAGGTATGGTGG - Intergenic
1059396747 9:114039222-114039244 CAGGAGGACCGCAGCTAAGAGGG + Intronic
1059548931 9:115208056-115208078 GAGGAGGTATGGAGGTATGGAGG + Intronic
1062703159 9:137918635-137918657 CATGAGGGCTGGTGGCATGATGG + Intronic
1185603592 X:1354959-1354981 GAGGAGGACTGGGGGGAGGAAGG + Intronic
1185757728 X:2665205-2665227 TAGGAGGAATGGAGGAAGGAAGG - Intergenic
1185802875 X:3029359-3029381 CAGAAGGACTGTAAGTATGAAGG + Exonic
1186903706 X:14087863-14087885 GAGGAGAACTGGAGAAATGAGGG - Intergenic
1188055388 X:25535191-25535213 CAGGTGGACTGGAGATTTGTTGG - Intergenic
1189223335 X:39391698-39391720 CAGCAGGACTGGAGGCTTGCAGG - Intergenic
1190752145 X:53372016-53372038 CAGTAGGTCTGGAGGGATAAGGG - Intergenic
1190817145 X:53938801-53938823 CAGGATGAGGAGAGGTATGAAGG - Exonic
1192183153 X:68928929-68928951 CAGGAGGAAAGGAGGGAGGAAGG + Intergenic
1193684945 X:84566546-84566568 CAAGAAGACTGGTGGAATGATGG + Intergenic
1193799031 X:85913426-85913448 CTGGAGGACAGGAGGCAGGAAGG + Intronic
1194752707 X:97702520-97702542 AAAGAGGACTGGAGTTAAGAAGG - Intergenic
1197783622 X:130179545-130179567 CAGGAGGAATGGAGGTCAGTAGG - Intronic
1198033682 X:132780322-132780344 CAGGATGAAGGGAGGCATGAGGG - Intronic