ID: 927875649

View in Genome Browser
Species Human (GRCh38)
Location 2:26653625-26653647
Sequence GATGGTGGCCCCCTGGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927875649_927875659 2 Left 927875649 2:26653625-26653647 CCACACCCCAGGGGGCCACCATC No data
Right 927875659 2:26653650-26653672 GGACATCCCAGGCCAGGAGTTGG No data
927875649_927875663 28 Left 927875649 2:26653625-26653647 CCACACCCCAGGGGGCCACCATC No data
Right 927875663 2:26653676-26653698 AGCCTTCATCCCTCCAGCTGAGG No data
927875649_927875657 -4 Left 927875649 2:26653625-26653647 CCACACCCCAGGGGGCCACCATC No data
Right 927875657 2:26653644-26653666 CATCCTGGACATCCCAGGCCAGG No data
927875649_927875654 -9 Left 927875649 2:26653625-26653647 CCACACCCCAGGGGGCCACCATC No data
Right 927875654 2:26653639-26653661 GCCACCATCCTGGACATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927875649 Original CRISPR GATGGTGGCCCCCTGGGGTG TGG (reversed) Intergenic
No off target data available for this crispr