ID: 927876258

View in Genome Browser
Species Human (GRCh38)
Location 2:26657295-26657317
Sequence CCAAATTCAGGCGGGCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927876258_927876267 6 Left 927876258 2:26657295-26657317 CCACCGTGCCCGCCTGAATTTGG No data
Right 927876267 2:26657324-26657346 GAGTCTAGGGAAGAGCCAATCGG No data
927876258_927876266 -7 Left 927876258 2:26657295-26657317 CCACCGTGCCCGCCTGAATTTGG No data
Right 927876266 2:26657311-26657333 AATTTGGGATATTGAGTCTAGGG No data
927876258_927876268 7 Left 927876258 2:26657295-26657317 CCACCGTGCCCGCCTGAATTTGG No data
Right 927876268 2:26657325-26657347 AGTCTAGGGAAGAGCCAATCGGG No data
927876258_927876265 -8 Left 927876258 2:26657295-26657317 CCACCGTGCCCGCCTGAATTTGG No data
Right 927876265 2:26657310-26657332 GAATTTGGGATATTGAGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927876258 Original CRISPR CCAAATTCAGGCGGGCACGG TGG (reversed) Intergenic