ID: 927877420

View in Genome Browser
Species Human (GRCh38)
Location 2:26668037-26668059
Sequence AACTTCTGCGCTGGGTACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927877420_927877425 4 Left 927877420 2:26668037-26668059 CCTCAGTACCCAGCGCAGAAGTT No data
Right 927877425 2:26668064-26668086 AGAGAGCCCCCAGGATGTCCTGG No data
927877420_927877423 -5 Left 927877420 2:26668037-26668059 CCTCAGTACCCAGCGCAGAAGTT No data
Right 927877423 2:26668055-26668077 AAGTTCCAGAGAGAGCCCCCAGG No data
927877420_927877426 5 Left 927877420 2:26668037-26668059 CCTCAGTACCCAGCGCAGAAGTT No data
Right 927877426 2:26668065-26668087 GAGAGCCCCCAGGATGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927877420 Original CRISPR AACTTCTGCGCTGGGTACTG AGG (reversed) Intergenic