ID: 927877422

View in Genome Browser
Species Human (GRCh38)
Location 2:26668046-26668068
Sequence TCTCTCTGGAACTTCTGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927877422_927877425 -5 Left 927877422 2:26668046-26668068 CCAGCGCAGAAGTTCCAGAGAGA No data
Right 927877425 2:26668064-26668086 AGAGAGCCCCCAGGATGTCCTGG No data
927877422_927877433 27 Left 927877422 2:26668046-26668068 CCAGCGCAGAAGTTCCAGAGAGA No data
Right 927877433 2:26668096-26668118 GAAAGTCTTCACAGACATAGAGG No data
927877422_927877426 -4 Left 927877422 2:26668046-26668068 CCAGCGCAGAAGTTCCAGAGAGA No data
Right 927877426 2:26668065-26668087 GAGAGCCCCCAGGATGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927877422 Original CRISPR TCTCTCTGGAACTTCTGCGC TGG (reversed) Intergenic