ID: 927877425

View in Genome Browser
Species Human (GRCh38)
Location 2:26668064-26668086
Sequence AGAGAGCCCCCAGGATGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927877420_927877425 4 Left 927877420 2:26668037-26668059 CCTCAGTACCCAGCGCAGAAGTT No data
Right 927877425 2:26668064-26668086 AGAGAGCCCCCAGGATGTCCTGG No data
927877422_927877425 -5 Left 927877422 2:26668046-26668068 CCAGCGCAGAAGTTCCAGAGAGA No data
Right 927877425 2:26668064-26668086 AGAGAGCCCCCAGGATGTCCTGG No data
927877419_927877425 24 Left 927877419 2:26668017-26668039 CCAACGCAATCAGATTATTGCCT No data
Right 927877425 2:26668064-26668086 AGAGAGCCCCCAGGATGTCCTGG No data
927877421_927877425 -4 Left 927877421 2:26668045-26668067 CCCAGCGCAGAAGTTCCAGAGAG No data
Right 927877425 2:26668064-26668086 AGAGAGCCCCCAGGATGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927877425 Original CRISPR AGAGAGCCCCCAGGATGTCC TGG Intergenic