ID: 927879198

View in Genome Browser
Species Human (GRCh38)
Location 2:26678767-26678789
Sequence CTCCTCTTCTGTGCCATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927879193_927879198 -10 Left 927879193 2:26678754-26678776 CCCTGCAACTACCCTCCTCTTCT No data
Right 927879198 2:26678767-26678789 CTCCTCTTCTGTGCCATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927879198 Original CRISPR CTCCTCTTCTGTGCCATCAA GGG Intergenic
No off target data available for this crispr