ID: 927881773

View in Genome Browser
Species Human (GRCh38)
Location 2:26694159-26694181
Sequence CCTGAGACCCAGACAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 938
Summary {0: 1, 1: 1, 2: 10, 3: 155, 4: 771}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927881773_927881779 -3 Left 927881773 2:26694159-26694181 CCTTCCCCTGTCTGGGTCTCAGG 0: 1
1: 1
2: 10
3: 155
4: 771
Right 927881779 2:26694179-26694201 AGGCTCACCTCCAGACAAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 159
927881773_927881781 -1 Left 927881773 2:26694159-26694181 CCTTCCCCTGTCTGGGTCTCAGG 0: 1
1: 1
2: 10
3: 155
4: 771
Right 927881781 2:26694181-26694203 GCTCACCTCCAGACAAGGAGGGG 0: 1
1: 0
2: 1
3: 11
4: 161
927881773_927881778 -6 Left 927881773 2:26694159-26694181 CCTTCCCCTGTCTGGGTCTCAGG 0: 1
1: 1
2: 10
3: 155
4: 771
Right 927881778 2:26694176-26694198 CTCAGGCTCACCTCCAGACAAGG 0: 1
1: 0
2: 0
3: 22
4: 185
927881773_927881782 2 Left 927881773 2:26694159-26694181 CCTTCCCCTGTCTGGGTCTCAGG 0: 1
1: 1
2: 10
3: 155
4: 771
Right 927881782 2:26694184-26694206 CACCTCCAGACAAGGAGGGGTGG 0: 1
1: 0
2: 0
3: 27
4: 227
927881773_927881780 -2 Left 927881773 2:26694159-26694181 CCTTCCCCTGTCTGGGTCTCAGG 0: 1
1: 1
2: 10
3: 155
4: 771
Right 927881780 2:26694180-26694202 GGCTCACCTCCAGACAAGGAGGG 0: 1
1: 0
2: 0
3: 26
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927881773 Original CRISPR CCTGAGACCCAGACAGGGGA AGG (reversed) Intronic
900077104 1:827001-827023 CCTGAGTCCGAGACTGGGGTAGG - Intergenic
900488099 1:2933071-2933093 GCTGAGCCCCAGGCTGGGGATGG + Intergenic
900913728 1:5620089-5620111 GCAGTGACCCAGACAAGGGAGGG + Intergenic
901644716 1:10710236-10710258 CTTGAGGCCCTGACTGGGGAAGG - Intronic
902101708 1:13996094-13996116 CCTGAGAGCCACACGGGGCAGGG + Intergenic
902163231 1:14549472-14549494 CCTGTGGCCCAGACACAGGATGG + Intergenic
902293030 1:15447393-15447415 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
902374535 1:16024087-16024109 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
902379476 1:16045851-16045873 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
902438960 1:16416768-16416790 CCTGAGCCCCAGAAATAGGATGG + Intronic
902508443 1:16952928-16952950 CCAGAGCCCCAGGCAGGGGTGGG - Intronic
902664177 1:17926006-17926028 ACAGAGACTCAGAGAGGGGAAGG + Intergenic
902792340 1:18777902-18777924 ACTGAGGCCCAAACATGGGAAGG + Intergenic
902859537 1:19235163-19235185 CCTGTGCCCCAGTCAGGGGGAGG + Exonic
902885982 1:19405121-19405143 TCTGAGACCCAGAGATGAGAAGG - Intronic
902925927 1:19695654-19695676 CCTGTGTCCCAGACAGGTGGGGG - Intronic
902936377 1:19767761-19767783 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
903014731 1:20354461-20354483 ACTGAGGCCCAGACGGGGGCAGG - Intronic
903016400 1:20364914-20364936 ACTGAGGCCCAGAGAGGTGAAGG - Intergenic
903022050 1:20401472-20401494 ACTGAGGCCCAGAGAGGGAAAGG + Intergenic
903035640 1:20490962-20490984 ACTGAGGCCCAGCCAGGGAATGG + Intergenic
903067858 1:20710826-20710848 ACTGACACCCAGAAAGGAGAAGG + Intronic
903185093 1:21624406-21624428 CCTGAGGCCCAGAGACGGGCAGG + Intronic
903189367 1:21648193-21648215 ACTGAAGCCCAGAGAGGGGATGG + Intronic
903228507 1:21907364-21907386 TCTGAGGCCCAGAGAAGGGAAGG - Intronic
903304696 1:22404633-22404655 ACTGAGGCTCAGACAGGCGAGGG - Intergenic
903465686 1:23551220-23551242 ACTGAGGCTCAGAGAGGGGAAGG + Intergenic
903497535 1:23779766-23779788 ACTGAAGCCCATACAGGGGAAGG + Intronic
903573572 1:24323710-24323732 GCTGAGTTCCAGAGAGGGGAGGG - Intronic
903647420 1:24903631-24903653 ACTGAGGCCCAGACAGGGTGAGG + Intronic
903648443 1:24908881-24908903 CCTGAGGCCCAGAGAGAAGAAGG - Intronic
903658048 1:24960803-24960825 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
903677551 1:25073923-25073945 ACTGAGGCCCAGAGAGGGAACGG - Intergenic
903708909 1:25307228-25307250 CCTGAGGCCCAGAGAGGGGTGGG + Intronic
903718210 1:25385190-25385212 CCTGAGGCCCAGAGAAGGGTGGG - Intronic
903809679 1:26028481-26028503 CCTGCAACCCAGCCAGGGGAGGG - Intronic
903889561 1:26560552-26560574 ACTGAGGCCCAGAGAGGGGCAGG + Intronic
904031911 1:27538481-27538503 CCTGAAGCCCAGAGAGGGAAGGG - Intronic
904047395 1:27616774-27616796 ACTGAGGCCCAGAGAAGGGAAGG - Intronic
904080571 1:27869879-27869901 ACTGAGACTCAGAGAGGGTATGG + Intergenic
904262700 1:29299130-29299152 ACTGAGACCCAGAGAGGTCAAGG + Intronic
904398969 1:30243370-30243392 CCTGAGACTCAGAGAGGTGAGGG + Intergenic
904468690 1:30722871-30722893 ACTGAGACCCAAAGAGGGAAAGG + Intronic
904611682 1:31729279-31729301 ACTGAGACCCAGGGAGGTGAAGG + Intronic
904673337 1:32181898-32181920 ACTAAGACCCAGAGAGGAGAAGG - Intronic
904851541 1:33463245-33463267 ACTGAGGCCCAGACAGAAGAAGG - Intergenic
905250253 1:36643800-36643822 CCTGAGTCCCAGACATAGGAGGG + Intergenic
905468479 1:38174205-38174227 CCTGAGACCCAGTCTTGGGTTGG + Intergenic
905866462 1:41379608-41379630 CCAGAGAACCAGGCAGGGCAAGG + Intronic
905872242 1:41411742-41411764 GCTGAGACCCAGAGATGGGTGGG + Intergenic
905880414 1:41459740-41459762 TCTGAGCCCCAGCCAGGGGAGGG + Intergenic
905976056 1:42174644-42174666 ATTGAGACCCAGAGAGGGAAGGG - Intergenic
906639832 1:47435042-47435064 ACTGAGACCTACACTGGGGAAGG - Intergenic
906797389 1:48708846-48708868 TCTGGGACCCAATCAGGGGATGG + Intronic
906845175 1:49183990-49184012 ACTGAGGCCCAGAAAGGTGAAGG + Intronic
907183744 1:52592837-52592859 GCTGAGACCCAAATAGGGGAAGG - Intergenic
907320794 1:53601007-53601029 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
907447497 1:54518174-54518196 ACTGTGACCCAGACCGGGAAGGG - Intergenic
911263799 1:95719370-95719392 ACTGAGACCCAGAAAGGTGATGG - Intergenic
911716429 1:101138814-101138836 CCTGAGAGGCAGGCAGGGCAAGG - Intergenic
912540883 1:110414367-110414389 TCTGAGGCTCAGAGAGGGGAAGG + Intergenic
912701508 1:111881716-111881738 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
913089221 1:115465302-115465324 ACTGAGGCCCAGAGTGGGGAAGG + Intergenic
913227198 1:116710619-116710641 CCCAAGACCCAGAAAGGGGAAGG + Intergenic
913572424 1:120134038-120134060 TTTGAGATTCAGACAGGGGAAGG - Intergenic
914756045 1:150562123-150562145 CCTGAGACCCAGGGAGGGGTGGG + Intergenic
915511925 1:156391247-156391269 CCTCAGGCCCTGCCAGGGGAGGG + Intergenic
915546187 1:156599455-156599477 CCTGAGCCAGAGACAGAGGAAGG + Intronic
915806916 1:158863743-158863765 ACTGAGACCCAGAAAATGGATGG - Intergenic
916059442 1:161088735-161088757 CCTGATGCCCAGAGAGTGGATGG - Intronic
917060658 1:171033510-171033532 CCTGAGAGCCACACGGGGCAGGG - Intronic
917478043 1:175385759-175385781 CCTGAGGCCCATAGTGGGGAAGG + Intronic
919871983 1:201828971-201828993 ACTGAGCCCCAGACAGGTTAAGG - Intergenic
920088489 1:203435348-203435370 TCTGAGACCCAGAAAGGCTAAGG + Intergenic
920114078 1:203607589-203607611 GCTGAGACCCAGAGAGCTGAAGG - Intergenic
920188815 1:204179371-204179393 CCCGAGTCCCAGGCTGGGGATGG + Intergenic
920311592 1:205051999-205052021 ACTGAGATCCAGAGATGGGACGG + Intronic
920530612 1:206699391-206699413 CCTGTGACACAGCCAGGGGAGGG + Intronic
920801646 1:209194051-209194073 GCTGAGGCCCAGAGAGGGCATGG - Intergenic
920919168 1:210284090-210284112 TCTGAGGCACAGACAGGTGAGGG + Intergenic
921830442 1:219722846-219722868 GGTGGGACCCACACAGGGGAGGG - Intronic
922189477 1:223304766-223304788 CCTGAGACACAGAGAGGTTAAGG - Intronic
922204063 1:223431288-223431310 CCTGAGAACCAGGGAAGGGAAGG - Intergenic
922216726 1:223526107-223526129 ACTGAGGCCCAGAGAGGTGAAGG + Intergenic
922418803 1:225445761-225445783 CCTGAGGCCCAGAGAAGGGATGG - Intergenic
922988334 1:229884090-229884112 CCTAACACCAAGGCAGGGGAAGG + Intergenic
924779161 1:247131200-247131222 CCTGAGAGCCAGGCGGGGAAGGG + Intronic
1062977676 10:1697630-1697652 CCTGAACCCCAGACAAGGGTGGG + Intronic
1063607002 10:7531402-7531424 ACTGAGAACCAGACGGTGGATGG + Intergenic
1063970599 10:11379000-11379022 GCTGAGGCCCAGAGAGGGCAAGG - Intergenic
1065480954 10:26193447-26193469 CCAGATCCCCAGCCAGGGGAGGG - Intronic
1067089205 10:43258061-43258083 CCTGAGATCCTGAATGGGGAAGG - Intronic
1068169068 10:53370434-53370456 CATGGGACCCAGGCATGGGAGGG - Intergenic
1068958670 10:62844736-62844758 ACTGAGACCCAGAGAGGAAAAGG + Intronic
1069651942 10:70055045-70055067 CCTGGGAACCAGACAGAAGATGG - Intronic
1069716177 10:70522890-70522912 ACTGAGGCCCAGAGAGGGGAAGG + Intronic
1069716950 10:70527193-70527215 ACTGAGGCCCAGAGAGGGAAAGG - Intronic
1069780197 10:70950544-70950566 CCTGAGACCCAGAGTTGGGAAGG - Intergenic
1069789656 10:71011545-71011567 TCTAAGGCCCAGAGAGGGGAAGG - Intergenic
1069800974 10:71081239-71081261 ACTGAGGCCCAGAGAGGGGACGG + Intergenic
1070617008 10:77977069-77977091 CCTGAGCCCCACACAGGCCAGGG - Exonic
1070734978 10:78857008-78857030 ACTGAGACCCTGAGAAGGGAAGG + Intergenic
1070765903 10:79056275-79056297 ACTGAGACCCAGGCAGGGGAAGG - Intergenic
1070774971 10:79104136-79104158 TCTGAGGCCCAGAGAGGGGAGGG - Intronic
1070829304 10:79408866-79408888 ACTGAGACCCAGGCAGGGAAGGG - Intronic
1070916768 10:80160083-80160105 GCTGAGACTCAGGCTGGGGAAGG - Intronic
1071483858 10:86085143-86085165 GATGAGCCCCAGACATGGGAGGG + Intronic
1072756519 10:98025096-98025118 ACTGAGATCCAGAGAGGAGAGGG - Intronic
1072834485 10:98696440-98696462 CCTGAGAGCCACACAGGGCAGGG + Intronic
1073079966 10:100853503-100853525 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1073218203 10:101848474-101848496 CCTGAGAAACAAAAAGGGGAAGG + Intronic
1073716527 10:106114571-106114593 CCTGAGATCCACAGAGGGAAAGG + Intergenic
1074003255 10:109393375-109393397 CCTGAGAGCCACACAAGGAAGGG + Intergenic
1074184067 10:111086148-111086170 TCTGAGCCACAGACATGGGATGG - Intergenic
1074480090 10:113811561-113811583 CCTGAGAGCCACACAGGGAAGGG + Intergenic
1074859280 10:117498004-117498026 GCTGAGGCCCAGAGAGGGGAAGG + Intergenic
1074975695 10:118579854-118579876 ACTGAGGCCCAGAGAGGGTATGG - Intergenic
1075592534 10:123703119-123703141 ACCGAGGCCCAGAGAGGGGAAGG + Intergenic
1075953427 10:126501898-126501920 TCAGAGACTCAGAAAGGGGAGGG + Intronic
1076215206 10:128687631-128687653 GCTGAGACTCAGAGAAGGGAAGG - Intergenic
1076531399 10:131147615-131147637 GCCGAGGCCCAGAGAGGGGAGGG - Intronic
1076921813 10:133458280-133458302 CCTGAGCCTCAGACTGCGGAAGG - Intergenic
1077448012 11:2610828-2610850 CCTGACACCAGAACAGGGGAGGG + Intronic
1077648376 11:3946884-3946906 CCTGAGACACAGAGAGGGAAAGG - Intronic
1077854988 11:6115582-6115604 CCTGGGAGCCACACAGGGCAGGG + Intergenic
1077874748 11:6294552-6294574 CTTGTGAACCAGATAGGGGAAGG - Intergenic
1078088802 11:8251212-8251234 ACCAAGACCCAGAAAGGGGAAGG + Intronic
1078673335 11:13385091-13385113 TTTGAGACTCAGCCAGGGGAAGG + Intronic
1079450399 11:20596402-20596424 GCTGCAACCCAGACAGGAGAGGG - Intergenic
1079496849 11:21053618-21053640 CCTGAGTCCCATACAGTGAAGGG + Intronic
1079966284 11:26984051-26984073 CCTGAGAGCCACACAGGGCAGGG - Intergenic
1080459169 11:32438494-32438516 ACTGAGGCCCAGACAGCCGAAGG + Intergenic
1080841228 11:35985263-35985285 CCACAGAACCAGACAGTGGAAGG - Intronic
1081340240 11:41918323-41918345 CCTGAGAGCCACACAGGGCAGGG - Intergenic
1081636059 11:44723049-44723071 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1081760539 11:45573838-45573860 CCTGAGAATCAGAGAGGTGAAGG + Intergenic
1081967334 11:47177779-47177801 CCTGGGACCCAGGGAGGGGAGGG - Exonic
1082820845 11:57543717-57543739 CCTGAGAGCCCCACTGGGGAGGG + Exonic
1083487768 11:62994410-62994432 CCTGAGCCCCAGAGAGTGCAGGG + Intronic
1083521767 11:63320310-63320332 CCTGAGAGCCACACAGGGCAGGG + Intronic
1083660594 11:64250292-64250314 CTTGAGGCCCAGAGAGGGGAAGG - Intergenic
1083886428 11:65575717-65575739 ACTGAGACCCAGAAAGGGGAAGG - Intergenic
1084038464 11:66527875-66527897 CCAGACCCCCAGACAGGGCAGGG + Intronic
1084105330 11:66976891-66976913 ACTGAGGCCCAGAGTGGGGAAGG + Exonic
1084155588 11:67311013-67311035 CTTGAGTCCCAGACAGGGCCTGG - Intronic
1084269354 11:68020856-68020878 CTTGAGGCCCAGACAGGGCTAGG + Intronic
1084547604 11:69822203-69822225 CCTCAGGCCCAGCCAAGGGAGGG + Intergenic
1085024837 11:73230325-73230347 ACTGAGAGCCAAGCAGGGGAAGG - Intronic
1085154981 11:74285275-74285297 ACCGAGGCCCAGAGAGGGGAAGG - Intronic
1085201959 11:74707230-74707252 ACTGAGGCCCAGAGAAGGGAAGG + Intronic
1085270023 11:75264777-75264799 ACTGAGGCCCAGAGTGGGGAAGG + Exonic
1085317724 11:75555489-75555511 CATGGGACGCAGCCAGGGGAGGG - Intergenic
1085450492 11:76629322-76629344 ACTGCGACCCAGACAGGAGAAGG - Intergenic
1085619930 11:78030418-78030440 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
1085692292 11:78673598-78673620 ACTGAGACTCGGATAGGGGAAGG - Intronic
1085709583 11:78816942-78816964 GGTGAGGCCCAGAGAGGGGAAGG - Intronic
1086402063 11:86469185-86469207 ACTGAGACCCAGACAGAGAAAGG - Intronic
1086513756 11:87588909-87588931 CCTGAGAGCCACACAGGGAAGGG + Intergenic
1086908166 11:92440908-92440930 GCTGAGACCCAGTCAGGTTAAGG - Intronic
1088167716 11:106957540-106957562 CCTGAGAGCCACACGGGGAAGGG - Intronic
1088906758 11:114160964-114160986 CCTGGGACACAGGAAGGGGAAGG - Intronic
1089096493 11:115923958-115923980 ACTAAGACCCAGAGAGAGGAAGG + Intergenic
1089234729 11:117013802-117013824 ACTGAGACCCAGAGAAGGAAAGG + Intronic
1089329151 11:117677783-117677805 ACTGAGGCACAGACAGGTGAAGG + Intronic
1089329759 11:117681082-117681104 CCTGGGACCCAGACAGCTGGCGG - Intronic
1089642811 11:119858955-119858977 CATGAGACCCTGACCTGGGACGG - Intergenic
1089679447 11:120111113-120111135 CCTGTGTCCCAGACAGGGTGAGG + Intergenic
1090645904 11:128766609-128766631 CCTGAGACCCAGGCAGGGCGGGG - Intronic
1091289622 11:134430577-134430599 ACTGAGGCCCGGAGAGGGGAGGG + Intergenic
1091348049 11:134868500-134868522 CCCGAGACACTGAGAGGGGAGGG + Intergenic
1091965909 12:4741495-4741517 CCTGAGTCCCAAAGAGGTGAGGG - Intronic
1092104904 12:5914467-5914489 CCTGATACCGAGACAGAGTAGGG + Intronic
1092134647 12:6138199-6138221 GCTGAGGCTCAGACAGGGTAAGG + Intergenic
1093303209 12:17479053-17479075 CCTGAGAGCCACACGGGGCAGGG + Intergenic
1093383451 12:18521997-18522019 CCTGAGAGCCACATAGGGCAGGG - Intronic
1093413776 12:18896473-18896495 CCTGAGAGCCACACAGGGCAGGG - Intergenic
1094043623 12:26143843-26143865 CCTGAGAATCTGACAGGAGATGG - Intronic
1095289760 12:40464399-40464421 CCTGAAACCAAGACAGGAGCAGG - Exonic
1095649732 12:44593235-44593257 ACTGAGATCCAGAAAGGAGATGG + Intronic
1096613988 12:52821463-52821485 ATTGAGACACAGACAGGGAAGGG + Exonic
1096879151 12:54653514-54653536 CCTGAGGCCCAGGTAGGGAAGGG - Intergenic
1097455606 12:59795736-59795758 CCTGAGAGCCACACAGGGCAAGG + Intergenic
1097529566 12:60781127-60781149 CCTGAGAGCTACACAGGGCAGGG - Intergenic
1098201901 12:68064643-68064665 CCTGAGAGCCACACGGGGCAAGG - Intergenic
1098729168 12:74011179-74011201 CCTGGGACTCGGACAGTGGATGG + Intergenic
1098870898 12:75815833-75815855 ACTGAGGCCCAGAAAGGAGAAGG + Intergenic
1099381076 12:81953497-81953519 CCTCAGACCCAGACTGATGAAGG + Intergenic
1100022625 12:90088950-90088972 CCTGAGACCTGTACAGGAGATGG + Intergenic
1101865235 12:108515487-108515509 ACTGAGGCCCGGAGAGGGGAGGG - Intronic
1101875846 12:108596653-108596675 ACTGAGGCCCAGAGAGGGCAGGG - Intronic
1101926193 12:108973243-108973265 ACTGAGGGCCAGAGAGGGGAGGG + Intronic
1101960311 12:109244355-109244377 ACTGAGGCCCAGAGAGGTGAAGG - Intronic
1102016442 12:109650997-109651019 CCGAAGCCACAGACAGGGGAGGG - Intergenic
1102024809 12:109708404-109708426 CAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1102157936 12:110745337-110745359 ACTGAGGCCTAGAGAGGGGAAGG - Intergenic
1102257740 12:111425813-111425835 GCTGAGCCCCAGGCAGGGCAAGG + Intronic
1102432031 12:112891097-112891119 ACTGAGACCCAGAGAGGGCAAGG + Intronic
1102466035 12:113131314-113131336 ACTGAGGCCCAGAGAGGGAAGGG - Intronic
1102514927 12:113440007-113440029 CCTGAGGCCTGGAAAGGGGACGG - Intergenic
1102688814 12:114744479-114744501 ACTGAGACCCAGGGAGGGGAGGG + Intergenic
1102741455 12:115211128-115211150 CTACAGTCCCAGACAGGGGAGGG + Intergenic
1102914745 12:116744485-116744507 GCTGAGGCTCAGAGAGGGGAAGG + Intronic
1102949494 12:117020778-117020800 GCTGAAAACCAGACAGGAGAGGG - Intronic
1103037002 12:117664690-117664712 ACTGAGACCCAGATAGAGGAAGG + Intronic
1103451548 12:121032778-121032800 TCTGACACCCAGTGAGGGGAAGG - Intronic
1103721549 12:122978169-122978191 CCTGAGGCCCAGAGAGGGGAAGG - Intronic
1105706672 13:22971595-22971617 CCTGAGGCCCAGTGTGGGGATGG + Intergenic
1106575241 13:30968372-30968394 TCTTAGATCCAGACAAGGGAAGG + Intronic
1107552784 13:41492845-41492867 TCTGAGGCCCAGAGAGGGGAAGG - Intergenic
1107784164 13:43937671-43937693 ACTGAGGCTCAGAGAGGGGAGGG + Intergenic
1108056546 13:46490953-46490975 CCTGAGACTCAGGCAGGGCAGGG - Intergenic
1108880420 13:55107633-55107655 CCTAAGAGCCACACAGGGCAGGG + Intergenic
1110790590 13:79582415-79582437 CCTGACAGCCACACAGGGCAAGG - Intergenic
1110986262 13:81973774-81973796 CCTGAGAGCCACACAGGACAGGG + Intergenic
1111045143 13:82805183-82805205 CCTGAGAGCCACACAGGGCAGGG + Intergenic
1111200242 13:84927389-84927411 CCTGAGAGCCACACTGGGCAGGG + Intergenic
1112607988 13:100926866-100926888 CCTGAGAGCCAGACAGCTGATGG - Intergenic
1113470515 13:110541671-110541693 GCTGAGCCCCAGGCAGGCGAAGG - Intronic
1114535502 14:23419724-23419746 TCTGAGAACCAGGCAGAGGAAGG + Intronic
1115359337 14:32484123-32484145 TCTTCGACCCAGCCAGGGGAGGG - Intronic
1115928924 14:38468220-38468242 CCTGAGAGCCACACAGGGCAGGG - Intergenic
1117883132 14:60331406-60331428 CCTGAGACCCAGGGAAGAGAAGG + Intergenic
1118459690 14:65976701-65976723 CCTGGGCCCCAGACAGGGCTTGG + Intronic
1118478807 14:66143566-66143588 CCTGAGAGCCATACAGGGCAGGG + Intergenic
1118500752 14:66360349-66360371 ACAGGGACCCACACAGGGGATGG + Intergenic
1118772732 14:68952879-68952901 CCTGACACCCAAGCAGGGCACGG + Intronic
1119439933 14:74621434-74621456 TCTGAGGCCCAGGGAGGGGAAGG - Intergenic
1119678223 14:76572353-76572375 GCTGTGCCCCACACAGGGGAGGG - Intergenic
1120247624 14:82025484-82025506 CCTGAGAACCACACAGGGCAGGG - Intergenic
1120980902 14:90288133-90288155 CCTGAGACCCAGCAAGGTCAGGG + Intronic
1121436561 14:93924523-93924545 CCTCTGACCCACACAAGGGAAGG - Intronic
1121582867 14:95044215-95044237 ACTGAGACCCAGAGAAGGAAAGG - Intergenic
1121942347 14:98083104-98083126 CCTGAGAACCAGAGAGTTGATGG - Intergenic
1122152573 14:99732854-99732876 CCTGAGGCCCAGCCAGGGCCGGG + Intergenic
1122156639 14:99754062-99754084 ACTGAGTCCCAGAGAGGGGAAGG - Intronic
1122409162 14:101517311-101517333 GCTGAGACCCAGCAAGGTGAAGG - Intergenic
1122794106 14:104197130-104197152 GGTGAGGCCCAGAGAGGGGAAGG - Intergenic
1122850029 14:104523069-104523091 CCTGAGGCCCAGCTTGGGGACGG + Intronic
1122887860 14:104718487-104718509 CCTGGGTCTCAGACAGGGGGTGG + Intronic
1122941629 14:104984113-104984135 GCTGAGGCCCAGACGGGGGTGGG + Intergenic
1122987238 14:105218094-105218116 CCTGGGTCCCACACAGGGCAGGG + Intronic
1123110476 14:105864768-105864790 GCTGAGACCCAGGCAGGGAGGGG + Intergenic
1123896874 15:24838558-24838580 TCTGAGACCCAGGGAGGGGCAGG - Intronic
1123963977 15:25438141-25438163 CCGGGGCCCCAGACAGGGAAGGG - Intronic
1125234921 15:37502166-37502188 CCTGAGAGCCACACGGGGCAGGG + Intergenic
1125468224 15:39976392-39976414 CCTGCGGCACAGCCAGGGGAAGG - Exonic
1125715782 15:41819224-41819246 CCTGAGTCCGAGACAAGGAAGGG - Exonic
1126419743 15:48459028-48459050 ACAGAGGCCCAGAGAGGGGAAGG - Intronic
1127687809 15:61365363-61365385 CCTGAGAGCCACACGGGGCAGGG - Intergenic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1127982324 15:64044519-64044541 GCTGAGATCCAGAAAGGGGAAGG + Intronic
1128161677 15:65426797-65426819 ACTGAGGCCCAGAGAGAGGATGG - Intergenic
1128163326 15:65439153-65439175 CGTGAGACCTAGACTGGGGAAGG + Intergenic
1128336288 15:66787647-66787669 ACTGAGGCCCAGAGAGGGCAGGG + Intergenic
1128531116 15:68448691-68448713 GCTGAGGCTCAGATAGGGGAAGG - Intergenic
1128544782 15:68559647-68559669 ACGGAGGCCCAGACAGGGAAAGG - Intergenic
1128856630 15:71023590-71023612 CCTGAGAGCCACACAGGGCAAGG + Intronic
1129250558 15:74306611-74306633 ACTGAGGTCCAGACAGGGAAGGG - Intronic
1129523549 15:76200401-76200423 ACTGAGGCCCAGAGAGGGGATGG + Intronic
1129669265 15:77598116-77598138 CCTGAGGCTCAGAAAGGTGAAGG + Intergenic
1129672898 15:77616914-77616936 CCTGAGAGACAGACAGGTGACGG - Intronic
1129742181 15:77994621-77994643 CCTGTGACTCAGGCAGGGCATGG + Intronic
1129843301 15:78756859-78756881 CCTGTGACTCAGGCAGGGCATGG - Intergenic
1129970052 15:79770154-79770176 CCAGCAACCCAGACATGGGATGG + Intergenic
1130068654 15:80628173-80628195 CCTGAGAGCCAGAGAGCTGATGG - Intergenic
1130106295 15:80931139-80931161 CCTGAGACCCAGAAGGAGGTGGG - Intronic
1130358793 15:83160771-83160793 CCTGAGACCCAGGCAGAAAATGG - Intronic
1130466538 15:84195476-84195498 GTTGAGGCCCAGACATGGGATGG + Intergenic
1130497726 15:84478060-84478082 GTTGAGGCCCAGACATGGGATGG - Intergenic
1130557749 15:84934882-84934904 CCTGAGACCCAGAGAGAAAAAGG - Intronic
1130995802 15:88903328-88903350 ACTGAGAGCCAGAGAGAGGAAGG - Intronic
1131153134 15:90059423-90059445 ACTGAGGCCCAGGGAGGGGAAGG - Intronic
1131266017 15:90915891-90915913 CATGAGGTCCAGAAAGGGGAAGG - Intronic
1131464693 15:92645825-92645847 CCTGCCACCCAGGTAGGGGAGGG + Intronic
1131831451 15:96357221-96357243 CCTGAGGCCACGACTGGGGAAGG + Intergenic
1131908389 15:97169207-97169229 GCTGAGGCCCAGAGAGGAGATGG + Intergenic
1132330338 15:101008298-101008320 CCTGAGATACAGACAGACGATGG - Intronic
1132384137 15:101387955-101387977 CCTCAGACACATACAGGGGACGG - Intronic
1132703144 16:1230457-1230479 CCTGGCACCGAGACAGGGGCAGG - Intergenic
1132705176 16:1240411-1240433 CCTGGCACCGAGACAGGGGCAGG + Intergenic
1132708305 16:1255774-1255796 CCTGGCACCGAGACAGGGGCAGG + Intergenic
1132806490 16:1777463-1777485 CCTGAACCCCAGGCAGGGAAGGG + Intronic
1132884521 16:2176766-2176788 CCTGGCACCCAGAGAGGGGCTGG - Exonic
1133222615 16:4325217-4325239 CCTGAGCCCCTGACATAGGAAGG + Intronic
1133319681 16:4905167-4905189 GCTGAGACCCAGCTAGGGGAAGG - Intronic
1134107730 16:11495802-11495824 GCTGAGACACAGAAAGGGTAAGG + Intronic
1135064238 16:19295981-19296003 CCTGAGTCCCAGAAAAGGGTGGG + Intronic
1135768273 16:25196801-25196823 GCTGAGACCCAGAGAGGTAAAGG - Intergenic
1135983455 16:27166707-27166729 TCTGAGGCACAGACAGGTGAAGG + Intergenic
1136008156 16:27345163-27345185 ACTGAGGCCCAGGCAGGGGCAGG - Intronic
1136089864 16:27911062-27911084 CCTGAGCCCCAGTCAAGGGCTGG + Intronic
1136251586 16:29008965-29008987 CTTGAGAGCCAGACGGGTGATGG - Intergenic
1136448339 16:30337573-30337595 CCTGAGACCCAGAAAGAGGAAGG - Intergenic
1136662017 16:31771611-31771633 CCTGGGAACCACACAGGGCAAGG + Intronic
1136777052 16:32877572-32877594 CCTGACACCCGGACAGAGGCTGG - Intergenic
1136893567 16:33983941-33983963 CCTGACACCCGGACAGAGGCTGG + Intergenic
1137384668 16:48030326-48030348 GCTGAGGCCCAGAGAGGTGAAGG - Intergenic
1137405252 16:48184121-48184143 ACTGAGGCCCAGACAAGGGAAGG - Intronic
1137445836 16:48531663-48531685 CCTGACACCCAGAGAAGGGAAGG + Intergenic
1137524186 16:49219435-49219457 CTTGAGACCCAGAGAGGTAAAGG - Intergenic
1137528608 16:49261412-49261434 CCTGAGCCCCAGAAAGGAGGTGG - Intergenic
1137686531 16:50390640-50390662 GCTGGGACCCAGGCAGGGGCTGG + Intergenic
1137726180 16:50658239-50658261 GCTGAGGCCCAGAGAGGGAAAGG - Intergenic
1137876580 16:52002424-52002446 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1138202724 16:55101968-55101990 ACTGAGACCCAGAGAAGGCAGGG + Intergenic
1138217317 16:55215530-55215552 ACTGAGCCCCAGAGAGGAGAAGG - Intergenic
1138275103 16:55728668-55728690 ACCGAGGCCCAGACAGGGAAGGG + Intergenic
1138288197 16:55825735-55825757 ACTGAGGCCCAGACAGGGAAGGG - Intronic
1138429995 16:56962546-56962568 ACTGAGGCCCAGAGAGGGCAGGG - Intronic
1138515942 16:57535741-57535763 ACTGAGGCCCAGAGAGGGCAGGG - Intronic
1138528668 16:57623092-57623114 ACTGAGACTCAGAGAGGGAAAGG - Intronic
1138556830 16:57775745-57775767 CCTGAGCCCAAGACACAGGACGG + Intronic
1139268604 16:65661867-65661889 CCTGAGACCGAGACTGGGGAGGG + Intergenic
1139282963 16:65785524-65785546 CCTGACACCCAGCCAGGGCTGGG - Intergenic
1139465163 16:67150506-67150528 ACTGCGACCCTTACAGGGGAGGG - Exonic
1139972477 16:70784842-70784864 CAAGAGGCACAGACAGGGGAGGG + Intronic
1140963741 16:79943725-79943747 ACTAAGTCCCAGAGAGGGGAGGG + Intergenic
1141147893 16:81544510-81544532 CCTGAGAGCCACACAGAGGCCGG - Intronic
1141259977 16:82443865-82443887 ACTGAGCCTCAGAGAGGGGACGG - Intergenic
1141357824 16:83365183-83365205 CCTGAGAACCAGAGAGCTGATGG + Intronic
1141526395 16:84614564-84614586 CCTGAGTGCCAGAGTGGGGAGGG + Intronic
1141697845 16:85628496-85628518 CCTCAGACCCAGGCATTGGAGGG + Intronic
1142044947 16:87919403-87919425 CCTGAGAATCAGCCATGGGATGG + Intronic
1142047534 16:87935258-87935280 CCTGAGACCCAGAAAGAGGAAGG + Intronic
1142276301 16:89120644-89120666 CCTGTGACCCAGAGAGAAGATGG - Intronic
1203079467 16_KI270728v1_random:1139681-1139703 CCTGACACCCGGACAGAGGCTGG - Intergenic
1142560306 17:805477-805499 CCTGAGGCCCTGAAAGGCGAAGG - Intronic
1142916458 17:3142995-3143017 CCTGGGAGCCACACAGGGCAAGG - Intergenic
1143020372 17:3914455-3914477 CCTGTGACACACACAGAGGAGGG + Intronic
1143493448 17:7296837-7296859 CCTAAGACCAAGACTGGGGAAGG + Intergenic
1143659627 17:8316452-8316474 CCTGAGACCCAGCGAGCAGAAGG - Intronic
1143921782 17:10336082-10336104 ACTGAGGCCCAGAGAGGTGAAGG + Intronic
1144173064 17:12678413-12678435 GCTGAGACCCAGACAAGGCTTGG - Intronic
1144625041 17:16840188-16840210 CCTGAGACTCACACAGGAGTCGG + Intergenic
1144643206 17:16950769-16950791 ACTGAGTCCCAGGCGGGGGAGGG - Intronic
1144674536 17:17153449-17153471 CCTGGGTACCAGGCAGGGGAGGG - Intronic
1144761285 17:17709032-17709054 ACTGAGGCCCAGAGAGTGGAAGG + Intronic
1144833143 17:18142848-18142870 CCTTGGACCCAGATAGGGTAGGG - Intronic
1144881389 17:18432533-18432555 CCTGAGACTCACACAGGAGTCGG - Intergenic
1145018162 17:19412160-19412182 ATTGAGGCCCAGAGAGGGGAAGG + Intronic
1145150844 17:20511853-20511875 CCTGAGACTCACACAGGAGTCGG + Intergenic
1145885047 17:28376225-28376247 CCTGAGGCCCAGCGAAGGGAAGG - Intronic
1145954005 17:28842308-28842330 CCTCTGAACCAGGCAGGGGAAGG - Intronic
1146260152 17:31415657-31415679 ACTGAGGCCGAGAGAGGGGAAGG + Intronic
1146284268 17:31564091-31564113 ATTGAGACCCATATAGGGGATGG - Intergenic
1146401063 17:32500392-32500414 CCTGTGAACCAGACCTGGGAAGG + Intronic
1147305467 17:39561137-39561159 CCTGAGACCTGGAATGGGGAAGG + Intronic
1147384607 17:40073976-40073998 CCTAAGCCCCAGACATGGGAAGG - Intronic
1147564900 17:41529961-41529983 ACTGAGACCCAGAGATGGGCAGG - Intergenic
1147575034 17:41594078-41594100 TGTGAGTCCCAGACAGGGGAAGG + Intergenic
1147628858 17:41917535-41917557 CCTGGGACACAGCCAGGGGAAGG + Intronic
1147718481 17:42523213-42523235 CCTGGGCCCCAGACAGGTGAAGG + Intergenic
1148049664 17:44763497-44763519 CCTGAGGCCCAGAGAAGTGAGGG + Intronic
1148070681 17:44906884-44906906 ACTGAGACTCAGACAGGAAAGGG - Intronic
1148438747 17:47701022-47701044 ACTGAGGCCCAGAGAGGGGCAGG + Intronic
1148509561 17:48157190-48157212 CCTGAGAACAGGACAGGTGATGG + Intronic
1148560643 17:48604073-48604095 CCAGAGGCCGAGACAAGGGAGGG + Intronic
1148593278 17:48832309-48832331 GCTTGGACCCAGACAGCGGAGGG + Intronic
1148652322 17:49259199-49259221 ACTGAGGCCCAGAATGGGGAAGG + Intergenic
1148798709 17:50210055-50210077 CCTGAGGCCCAGAAGGTGGAGGG + Intergenic
1148887936 17:50787043-50787065 CCTGGGATCCAGACTGTGGAGGG - Intergenic
1149229787 17:54519460-54519482 CCTGAGAGCCACACAGGGCAGGG - Intergenic
1149242257 17:54663738-54663760 CCTGAGAGCCACACAGGGCAGGG - Intergenic
1149299789 17:55294546-55294568 CCTTACACACAGAAAGGGGAAGG - Intronic
1149412024 17:56418671-56418693 ACTGAGACCCAGAAAGGTGAAGG + Intronic
1149993365 17:61394992-61395014 CCTGAGCCCCAGAGAAGGGCAGG + Intergenic
1150638216 17:66931409-66931431 ACTGAGGCTCAGAGAGGGGAAGG + Intergenic
1151263822 17:72938199-72938221 CCTGCCACCCAGAAAGGAGACGG + Intronic
1151340330 17:73466874-73466896 ACTGAGGTCCAGAGAGGGGAAGG + Intronic
1151824133 17:76514166-76514188 CCTGCTAGCCAGGCAGGGGAAGG + Intergenic
1152621446 17:81366891-81366913 ACTGAGACCCAGAGCGGAGAAGG - Intergenic
1152721725 17:81927013-81927035 CCCGAGCCCCAGCCAGGGGCAGG + Intronic
1152744577 17:82032869-82032891 CCTGAGATCCGCACAAGGGAGGG + Intronic
1152873627 17:82772929-82772951 CGTGTGCCCCAGACAGGGGAAGG + Intronic
1153382416 18:4454716-4454738 ACGGGGACCCAGGCAGGGGAAGG - Intronic
1155542578 18:26884014-26884036 CGTAATACCCAGCCAGGGGAGGG + Intergenic
1155574288 18:27228066-27228088 CCTAAGAGCAAGACAGGGGTTGG + Intergenic
1155762781 18:29588378-29588400 CCTGAGAGCCACACAGGGCAGGG + Intergenic
1156664489 18:39389667-39389689 CCTGAGAGCCACACAGGGCAGGG + Intergenic
1156720975 18:40069775-40069797 ACTGAGACCCAGAAAGTGAAAGG - Intergenic
1157462971 18:47918066-47918088 ACTGAGGGCCAGGCAGGGGAAGG + Intronic
1157699407 18:49751493-49751515 CCAGTGAGCCAGGCAGGGGAGGG + Intergenic
1157788416 18:50507517-50507539 CCTAAGAGCCAGACAGGGCCAGG - Intergenic
1157964242 18:52190197-52190219 ACTGAGGCCCAGAGAGGGCAAGG - Intergenic
1158144623 18:54298325-54298347 CCTGATGTCCAGACAGAGGAGGG - Intronic
1158716583 18:59885712-59885734 CCTGGGACCCTGAAAGGAGAGGG + Intergenic
1158729259 18:60004210-60004232 CCTGAGAGCCACACGGGGCAGGG - Intergenic
1158909644 18:62047255-62047277 CCTGACACCATGACAGTGGAGGG - Intronic
1159871401 18:73762658-73762680 CTTGAGACCCAGCCAGGCCATGG - Intergenic
1160027176 18:75228070-75228092 CTTGAGACACAGCCAGGGGAGGG + Intronic
1160276447 18:77442223-77442245 CCTTAGACACAGACAGGGCAAGG - Intergenic
1160353767 18:78208943-78208965 ACTGAGATCAAGACAGGAGAAGG - Intergenic
1160674638 19:383347-383369 CCTGAGAGAGGGACAGGGGAGGG - Intergenic
1160733202 19:650187-650209 CCAGGGACCCAGGCTGGGGATGG + Intronic
1160734637 19:656946-656968 CCAGAGACCCACCCAGGCGATGG - Intronic
1160775877 19:855489-855511 ACTGAGGCCCGGAGAGGGGAGGG + Intronic
1160798579 19:956797-956819 ACTGAGGCCCAGAGAGGGGCAGG + Intronic
1160823938 19:1070893-1070915 CCTGACACCTAGAGAGGGAAGGG - Intronic
1160939774 19:1614809-1614831 ACTGAGTCAGAGACAGGGGATGG + Intronic
1161113034 19:2480188-2480210 ACTGAGGCACAGACAGGTGAAGG - Intergenic
1161232278 19:3180240-3180262 ACTGAGGCCCAGAGAGGGGCCGG - Exonic
1161272630 19:3398473-3398495 ACTGAGGCCCAGAGAGGGCAGGG - Intronic
1161335254 19:3709467-3709489 GCTCAGAGCCAGAGAGGGGAGGG + Intronic
1162018446 19:7857917-7857939 ACTGAGAGCCAGAGTGGGGAAGG + Intronic
1162550689 19:11356842-11356864 ACTGAGGCCCAGGCAGGCGAGGG - Exonic
1162899380 19:13785490-13785512 GCTGAGACTCAGAAAGGTGAAGG - Intergenic
1163526600 19:17825167-17825189 ACTGAGACCCAGAGAGGGAAAGG + Exonic
1164134831 19:22405475-22405497 CCTGAGAGCCATACGGGGAAGGG + Intronic
1164163956 19:22651158-22651180 CCTGAGAGCCACACGGGGCAGGG - Intronic
1164588142 19:29490426-29490448 ACTGAAGCCCAGAGAGGGGACGG + Intergenic
1164650461 19:29887460-29887482 CATGAGACCCAGAAAGGGGCTGG + Intergenic
1164832005 19:31330273-31330295 CCTGAGGGCCAGGCAGGTGAGGG - Intronic
1165314780 19:35048116-35048138 GCTGAGGCTCAGAGAGGGGAGGG + Intronic
1165895700 19:39139659-39139681 CCTGAGACCTGGATGGGGGAGGG - Intronic
1165900148 19:39165728-39165750 ACTGAGGCCCAGAGAAGGGAAGG - Intronic
1166091193 19:40510165-40510187 ACTGAGCCTCAGAGAGGGGAAGG - Intronic
1166094509 19:40530629-40530651 CCGCGGACGCAGACAGGGGAGGG + Intronic
1166225310 19:41391487-41391509 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
1166311071 19:41962942-41962964 ACTGAGGCCCAGAGACGGGAGGG - Intergenic
1166354630 19:42219631-42219653 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
1166359402 19:42246604-42246626 CCTGAGGCCCAGAAAGGGGAAGG - Intronic
1166519401 19:43470261-43470283 TCTGAGACCCAGAGAGAGGAAGG + Intergenic
1166830920 19:45639259-45639281 CCTGGGACCCAGACCGGCGTGGG - Intronic
1166856447 19:45784678-45784700 ACCGAGGCCCAGACAGGGGAAGG - Exonic
1166873274 19:45883397-45883419 ACTGAGGCTCAGAGAGGGGATGG - Intergenic
1166938867 19:46350998-46351020 CCTTAGACTCAGACATGAGACGG - Intronic
1167112659 19:47471457-47471479 GATGAGACCCAGACACAGGAAGG + Intronic
1167348784 19:48962658-48962680 ACAGAGACCCAGAGATGGGAGGG - Intergenic
1167413914 19:49360761-49360783 ACAGAGACCCAGAGAGGGGATGG + Intronic
1167459172 19:49615364-49615386 ACAGAGACCCAGAGACGGGAGGG + Intronic
1167537261 19:50062124-50062146 CATGTGACCCACACAGGGAAAGG + Intergenic
1167552285 19:50169485-50169507 ACAGAGACCCAGAAGGGGGAGGG - Intergenic
1167690232 19:50980568-50980590 ACAGAGACCCAGAGAGAGGAGGG + Intronic
1167690267 19:50980710-50980732 ACAGAGACCCAGAGAGAGGAGGG + Intronic
1167752699 19:51390424-51390446 ACAGAGACCCAGAGAGAGGAGGG - Intronic
1167842129 19:52130889-52130911 CCTGTGACCCACAGAGGTGACGG - Intronic
1167888116 19:52518589-52518611 CCTGTGATCCAGAGAGGTGAGGG + Intergenic
1167963074 19:53123032-53123054 CCTGGGATCCAGAGAGGGAAAGG - Intronic
1168115481 19:54219743-54219765 ACTGAGGCCCAGGCAGGGGAGGG + Intronic
1168121284 19:54253892-54253914 ACTGAGGCCCAGGCAGGGGAAGG + Intronic
1168132824 19:54332050-54332072 ACTGAGGCCCAGGCAGAGGAGGG + Intergenic
1168181496 19:54665284-54665306 ACTGAGGCCCATGCAGGGGAGGG - Intronic
1168325236 19:55535541-55535563 GCTGAGACTCAGAGAGGGCAAGG + Intronic
1168591955 19:57643751-57643773 CTTGAGGGCCAGAGAGGGGAGGG - Intergenic
925403965 2:3593598-3593620 CCTGAGATCAAGACAAGGCAAGG - Intergenic
925433276 2:3815285-3815307 CCTGAGAGCCACACAGGGCAGGG - Intronic
926185685 2:10689161-10689183 GCTGAGATCCAGCAAGGGGAAGG - Intronic
926623630 2:15070965-15070987 ACTGAGACCCAGAGAGGAAAAGG + Intergenic
927185584 2:20479883-20479905 GCTGAGACCCACACTCGGGATGG + Intergenic
927198316 2:20563295-20563317 ACTGAGGCCCAGAGAGGGAAGGG + Intronic
927596226 2:24400480-24400502 CCTGACTTCCAGGCAGGGGAGGG - Intergenic
927811416 2:26182537-26182559 CCAGAGGCCCAGAGAGGGAAAGG + Intronic
927881773 2:26694159-26694181 CCTGAGACCCAGACAGGGGAAGG - Intronic
927884402 2:26709790-26709812 CCTGAGGCCCAGCAAGGCGATGG + Intronic
928096163 2:28406479-28406501 ACGGAGACCCAGAAAGGTGAAGG + Intronic
928124725 2:28607437-28607459 CCTGAGCCCAAGACTGGGGTAGG - Intronic
928308973 2:30194156-30194178 ACTGAGACCCAAAGAGGTGAAGG - Intergenic
929190427 2:39134772-39134794 CATGAGACCCAGGCCGGGCATGG + Intergenic
929584956 2:43107756-43107778 CCTGAGGCCCGGGCAGGGAAGGG - Intergenic
929587152 2:43123750-43123772 TCTGAGACCTAGCCAGGGGTGGG - Intergenic
929918256 2:46154148-46154170 TCGGAGGACCAGACAGGGGAGGG + Intronic
930002426 2:46870226-46870248 CCTGGGATCCAGCCAGGAGAGGG - Intergenic
930318689 2:49827808-49827830 CCTGAGAGCCACACGGGGCAGGG - Intergenic
931916542 2:66962782-66962804 CCTGAGAGGCAGAGAGGGGGTGG - Intergenic
932226347 2:70044079-70044101 TCTGAGAACCAGACTGAGGAAGG - Intergenic
932280649 2:70489107-70489129 ACTGAGACCCAGGGATGGGAAGG - Intronic
932820825 2:74898451-74898473 GCTGAGCCCAAGACAGAGGATGG - Intergenic
932874130 2:75432957-75432979 CCTGAGAGCCACACAGGACAGGG + Intergenic
933976452 2:87515809-87515831 CCTGAGATCCCGACTGGGGGCGG - Intergenic
935265340 2:101388569-101388591 CCTTAGTCACAGACAGGGCAGGG - Intergenic
935738826 2:106128581-106128603 CCTGAGAACCAGAGAGCCGAGGG - Intronic
936317367 2:111434996-111435018 CCTGAGATCCCGACTGGGGGCGG + Intergenic
936863312 2:117047826-117047848 CCTGAGGCCCTAACTGGGGAGGG + Intergenic
937179778 2:119983291-119983313 CCTTAGACCCAAACAGGTGCTGG + Exonic
937248391 2:120508869-120508891 CCTGGGACCCAGACAGCATAAGG + Intergenic
937426653 2:121805552-121805574 ACTGGGGCCCAGAGAGGGGAGGG + Intergenic
937446115 2:121959643-121959665 CCTGGGAGGTAGACAGGGGAAGG + Intergenic
937992368 2:127671777-127671799 CCTGAGCCCCAGACTGGGCCAGG - Intronic
938374612 2:130797509-130797531 CCTGAAACCCAGCCACGGGGCGG + Intergenic
939391035 2:141570302-141570324 CCTGAGAGCCACACGGGGCAGGG + Intronic
939808873 2:146807768-146807790 GCTGAGAACCACACAGGGCAGGG + Intergenic
939982440 2:148797608-148797630 CCTAGGACCCAGAGAGAGGAAGG + Intergenic
941164974 2:162074444-162074466 ACCGAGACCCAGAGAGGGCAGGG + Exonic
941935010 2:170975276-170975298 CCTGAGACCCGGGCAGGTGTGGG + Intergenic
942082081 2:172409854-172409876 ACTGAGACCCATAAAGGGTAAGG - Intergenic
943513959 2:188862170-188862192 CCTGAGAGCCACACAGGGCAGGG + Intergenic
944455151 2:199885449-199885471 CCTGAGACCCGGGAAGGGGGAGG + Intergenic
944634400 2:201660803-201660825 TGTGAGACCCAGGAAGGGGAAGG - Intronic
945340004 2:208640993-208641015 CCTGAGAACCAAACACAGGAGGG - Intronic
946065746 2:216985862-216985884 ACTGAGGCCCAGAGTGGGGAAGG + Intergenic
946149801 2:217756672-217756694 CCGGAGGCCCGGGCAGGGGAAGG - Intergenic
946909554 2:224445975-224445997 CTTGATACCCAGACAGGACAAGG - Intergenic
947073258 2:226315025-226315047 CCTGAGACCCAGAAGGAAGAAGG - Intergenic
947612374 2:231531937-231531959 ACAGAGTCCCAGGCAGGGGACGG + Intergenic
947708092 2:232292696-232292718 CCTGAGCCCCTGAAAGGAGAAGG + Intronic
948783922 2:240341098-240341120 CCCGAGAACCAGACAGGGACTGG - Intergenic
948840201 2:240645035-240645057 GTTGAAACCCAGACAGGGGCTGG - Intergenic
948896548 2:240930402-240930424 CCTGAGGCCCAGCCAGGGCTGGG - Intronic
948941660 2:241199909-241199931 CCTGAGGCCCTGAGAGGGGAAGG + Intronic
1168799087 20:633240-633262 GCTGAGACTCAGAGTGGGGAAGG + Intergenic
1168886800 20:1266005-1266027 GCTGAGGCCCAGAGAGGTGAAGG + Intronic
1168954225 20:1823569-1823591 CCTGAGGCTCAGAGAGGGCAGGG + Intergenic
1168955293 20:1830268-1830290 ACTGAGGCCCAGAGAGGGGAAGG - Intergenic
1168970501 20:1927579-1927601 GGTGAGACCCAGACAGAGGTAGG + Intronic
1169026343 20:2374801-2374823 ACAGAGGCCCAGAGAGGGGAAGG + Intergenic
1169267705 20:4176753-4176775 CCTGAGAGCCGGACTGGGGCAGG - Intronic
1169427505 20:5508202-5508224 CATGAGACCCAAAGAGGGCAGGG + Intergenic
1170686714 20:18576039-18576061 CCTGGGAACTAGACTGGGGAGGG + Intronic
1170782663 20:19439242-19439264 CCTGATCCCCAGACCTGGGATGG - Intronic
1172399568 20:34638137-34638159 GCTGGAACCCAGAAAGGGGATGG - Intronic
1172484596 20:35290827-35290849 CCTGTGCCCCAGGCAGGGGACGG - Intronic
1172505058 20:35455364-35455386 CCCGAGGCCCAGAGAGGGGCTGG + Exonic
1172594293 20:36139657-36139679 ACTGAGACCCAGAGAGGGGAAGG - Intronic
1172603456 20:36199234-36199256 ACCGAGACCCAGAAAGAGGAAGG + Intronic
1172761856 20:37328673-37328695 ACCCAGACCCAGACTGGGGAAGG - Intergenic
1172799262 20:37564711-37564733 ACTGAGACCCAGGGAGGAGAAGG + Intergenic
1172842736 20:37911758-37911780 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
1173324407 20:42019442-42019464 ACTGAGTCTCAGAGAGGGGAAGG - Intergenic
1173527696 20:43745449-43745471 ACTGAAGCCCAGACAGGGTAAGG + Intergenic
1173569316 20:44066494-44066516 ACTGAGGCCCAGAAAGGGAAAGG + Intronic
1173648238 20:44646926-44646948 ACTGAGACTCAGAGAGGGGAGGG - Intronic
1173855703 20:46249322-46249344 CCTGACTCCCAGACAGGTGTGGG - Intronic
1173902106 20:46598445-46598467 ACTGAGGCCCAGAGAAGGGAAGG + Intronic
1173903423 20:46607643-46607665 TCTGAGACTCAGGAAGGGGAAGG - Intronic
1174149021 20:48473086-48473108 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149047 20:48473244-48473266 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149085 20:48473495-48473517 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174151600 20:48489923-48489945 TCTGAGAGCCAGACCGGGGGTGG + Intergenic
1174407776 20:50313179-50313201 CATAAGACCCAGAGAGGGGAAGG + Intergenic
1174540626 20:51286464-51286486 TCTGAAAGCCAGACAGGGGAGGG + Intergenic
1175497135 20:59423004-59423026 TCTGAGACCCAGAGCGGGGCAGG + Intergenic
1175980499 20:62736251-62736273 CCCCAGACCCAGACAGGGAAAGG - Intronic
1176000937 20:62830807-62830829 CCTGGGACGCAGACAGGGAGAGG + Intronic
1176260760 20:64178350-64178372 CCTCAGACCCATTCAGGGGTGGG + Intronic
1176412654 21:6457424-6457446 CCTGTGTCCCAGGCAGGGGCGGG - Intergenic
1177956678 21:27606637-27606659 CCTGAGAGCCACACTGGGCAGGG - Intergenic
1178103064 21:29291142-29291164 ACTGAGTCCCAGGCAGGGCAAGG + Intronic
1179428833 21:41304552-41304574 ACTCATCCCCAGACAGGGGATGG + Intronic
1179525167 21:41971308-41971330 CCTGCTACCCAGGCAGGGGAGGG + Intergenic
1179688148 21:43065746-43065768 CCTGTGTCCCAGGCAGGGGCGGG - Intronic
1180618262 22:17143035-17143057 CCTGAGGGCCAGAGAGGAGACGG + Intronic
1180917348 22:19498504-19498526 CCTGAGACCCAGGCAAGGCCTGG - Intronic
1181785168 22:25221591-25221613 ACTGAGTCCCAGAGAGGGGCAGG - Intronic
1181853339 22:25765589-25765611 ACTGAGGCCAAGAAAGGGGAAGG - Intronic
1181983444 22:26782603-26782625 ACTGAGACCCAGAGAGGGGCAGG + Intergenic
1182024592 22:27108133-27108155 GCTGAGGCCCAGAGAGGGAAGGG - Intergenic
1182043965 22:27259915-27259937 ACTGAGGCCCAGAGAAGGGAGGG - Intergenic
1182097915 22:27638402-27638424 GCTGAGGCCCAGAGAGGGGTTGG + Intergenic
1182100476 22:27654345-27654367 ACTGAGGCCCAGAGAGGGAAAGG + Intergenic
1182279524 22:29209690-29209712 CCTCAGGCCCAGGCAGGGGTTGG - Intronic
1182359485 22:29738250-29738272 CCTGAGCCTCAGGAAGGGGAAGG + Intronic
1182475227 22:30573517-30573539 CCTGAGGCCCAGAGAGGGTGAGG - Intronic
1182558385 22:31141094-31141116 CTTGAGAGCCACACAGGGCAGGG + Intergenic
1182674899 22:32031512-32031534 GCTGAGAAGCAGAGAGGGGAGGG - Intergenic
1182680472 22:32075454-32075476 ACTGAGGTCCAGACAGGGGAAGG + Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182735453 22:32529633-32529655 ACTGAGGCCCAGAGATGGGAGGG + Intronic
1182830932 22:33304086-33304108 GCAGAGACCCAGAAAGGGGAAGG - Intronic
1182939023 22:34255683-34255705 CCTGAGAGCCACACAGGGAAGGG - Intergenic
1183090642 22:35519673-35519695 ACTGAGGCCCAGCCAGGGGAAGG + Intergenic
1183210707 22:36449623-36449645 GCTGAGGCCCAGAGATGGGAAGG - Intergenic
1183236133 22:36619110-36619132 ACCGAGACCCAGAAAGGTGAAGG + Intronic
1183343641 22:37295196-37295218 ACTGAGACCCAGAGAGGGACAGG - Intronic
1183346901 22:37313029-37313051 ACTGAGGCCCAGAGATGGGAGGG + Intronic
1183347358 22:37315223-37315245 GCTGAGGACCAGAGAGGGGAAGG - Exonic
1183354477 22:37350916-37350938 CCTGACTCCCAGGCGGGGGAAGG - Intergenic
1183371155 22:37433309-37433331 CCAGAGACCCAGCTATGGGAGGG + Intergenic
1183538442 22:38416346-38416368 ACTGAGGCCCAGACAGGAAAGGG - Intergenic
1183676927 22:39304357-39304379 CCTGAGACAGAGGCTGGGGAGGG + Intergenic
1183735881 22:39644610-39644632 CCTGAACCCCAGAAAGGTGAGGG + Intronic
1183975806 22:41511582-41511604 ACTGAGACCCAGACCAGGGCAGG + Intronic
1184034656 22:41912749-41912771 CCTGAAGCCCAGAAAGGAGAAGG + Intronic
1184278765 22:43425655-43425677 ACCGAGCCCCAGAGAGGGGAAGG + Intronic
1184475995 22:44721747-44721769 GCCGAGGCCCAGACAGGGGAGGG + Intronic
1184511235 22:44934523-44934545 CCTGACGCCCTGGCAGGGGAGGG - Intronic
1184684163 22:46088470-46088492 ACTGAGACCCGGAGAGAGGAAGG - Intronic
1184799558 22:46751420-46751442 GGTGAGACCCAGAGAGGGGCTGG + Intergenic
1184856157 22:47147864-47147886 CCGGAGGCCCAGCCTGGGGAAGG + Intronic
949465977 3:4344246-4344268 CCTGAGAGCCACACGGGGAAGGG + Intronic
950098134 3:10342033-10342055 ACAGAGGCCCAGAGAGGGGAAGG - Intronic
950195664 3:11007511-11007533 GCTGAGGCACAGAGAGGGGAAGG + Intronic
950447162 3:13045005-13045027 CCTCAGACACAGACAGGGCCAGG - Intronic
950451925 3:13070267-13070289 ACTGAGGCTCAGAGAGGGGAAGG - Intronic
950519361 3:13487387-13487409 CATGAGCCCCAGGCAGGGGTTGG - Intronic
950563066 3:13746949-13746971 ACTGAGGCCAAGAGAGGGGACGG + Intergenic
951951344 3:28202602-28202624 CCTGAGAGCCACACAGGTCAGGG + Intergenic
953024452 3:39136840-39136862 ACTGAGGCCCAGACAGGGCAGGG - Intronic
953025016 3:39139758-39139780 ACTAAGACCCAGAGAGGGGAAGG - Intergenic
953269158 3:41423760-41423782 CCTGAGAGCCACACAGGGCAAGG + Intronic
953866399 3:46586887-46586909 CCTGAGGACCAGATAGAGGAAGG + Intronic
954275422 3:49538886-49538908 ACTGAGGCCCAGAGAGGGCAAGG + Intergenic
954386027 3:50244466-50244488 ACTGAGACCAAGCCTGGGGAAGG + Intronic
954390772 3:50267057-50267079 CATGACAGCCAGATAGGGGAGGG - Intergenic
954395824 3:50292755-50292777 CCCCAGACCCAGGCAGGGGTAGG - Exonic
954419474 3:50411029-50411051 CCTGAGGCACAGGCAGGGAAGGG + Intronic
954575548 3:51674143-51674165 GCTCTGACCCAGAAAGGGGAGGG - Intronic
954628306 3:52034880-52034902 CCTGAGTCCCAGAAAGGTGGAGG + Intergenic
954654582 3:52186216-52186238 CCTGAGAACCATCCAAGGGATGG - Intergenic
954795223 3:53157989-53158011 CCTGAGGCCCACACAGCTGAAGG - Intronic
954942309 3:54385334-54385356 GCTGAGGCTCAGACAGGGGAAGG + Intronic
955367370 3:58322397-58322419 CCCGAGATCCAGACAAGGGAAGG + Intergenic
955933237 3:64078536-64078558 CCAGAGACACACAGAGGGGAAGG - Intergenic
957038332 3:75315527-75315549 ACTGAGACCTAGAAAGGAGAAGG - Intergenic
957268955 3:78003687-78003709 CCTGAGAGCCACACAGGGTAGGG - Intergenic
959418464 3:106104787-106104809 CCTGAGAGCCACATAGGGAAGGG - Intergenic
959883618 3:111474071-111474093 CCTGGGAGCCACACAGGGCAAGG - Intronic
960625426 3:119677265-119677287 CCTGAGACTCAGGCGGGGCAGGG + Exonic
961086352 3:124070839-124070861 ACTGAGACCCAGAAAGGAGAAGG - Intergenic
961555847 3:127696236-127696258 CCAGAAACCCAGACAGGCCAGGG - Intronic
961811663 3:129525463-129525485 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
962247331 3:133806383-133806405 CCTGAGTCCCAGTCAGAGTAAGG + Intronic
962392486 3:134984579-134984601 CCTGGGCCCCAGAGAGGGAAGGG + Intronic
962392498 3:134984608-134984630 CCTGGGCCCCAGAGAGGGAAGGG + Intronic
962392510 3:134984637-134984659 CCTGGGCCCCAGAGAGGGAAGGG + Intronic
962835670 3:139186362-139186384 CCTGAGGCACAGACAGGAGGGGG - Intronic
962839589 3:139221770-139221792 ACTGAGGCACAGATAGGGGAGGG + Intronic
962843917 3:139258937-139258959 ACTGAGGCCCAGAGAGGGAAAGG - Intronic
962974165 3:140431684-140431706 CCTGAACCCCACACAGGGGTAGG + Intronic
964007856 3:151852510-151852532 CCTGAGAGCCACACGGGGCAGGG - Intergenic
964129678 3:153272821-153272843 CCTGAGAAGCATACAGGGGAAGG + Intergenic
964714798 3:159710826-159710848 CATGAGACCCAGTCAGGAGTAGG + Intronic
966250603 3:177860676-177860698 CCTGAGAGCCACACCGGGAAAGG - Intergenic
967135804 3:186511713-186511735 ACTGAGCCCCAAACAGGGGCAGG - Intergenic
967882878 3:194314209-194314231 ATTGAGACCCAGAGAGGGTAAGG - Intergenic
968027636 3:195455904-195455926 CTTGAGACCAAGTCTGGGGAGGG + Intergenic
968232912 3:197014997-197015019 GCTGAGATTCAGAAAGGGGAAGG + Intronic
968517551 4:1021206-1021228 GCGGGGACCCAGGCAGGGGATGG + Intronic
968868182 4:3227216-3227238 CTTCAGCCCCAGACAGGGCAGGG - Intronic
968868191 4:3227250-3227272 CTTCAGCCCCAGACAGGGCAGGG - Intronic
968868201 4:3227284-3227306 CTTCAGCCCCAGACAGGGCAGGG - Intronic
968868210 4:3227318-3227340 CTTCAGCCCCAGACAGGGCAGGG - Intronic
968868220 4:3227352-3227374 CTTCAGCCCCAGACAGGGAAGGG - Intronic
968868230 4:3227386-3227408 CTTCAGCCCCAGACAGGGCAGGG - Intronic
968868240 4:3227420-3227442 CTTCAGCCCCAGACAGGGCAGGG - Intronic
968868250 4:3227454-3227476 CTTCAGCCCCAGACAGGGCAGGG - Intronic
968868260 4:3227488-3227510 CTTCAGCCCCAGACAGGGCAGGG - Intronic
968868270 4:3227522-3227544 CTTCAGCCCCAGACAGGGCAGGG - Intronic
968868280 4:3227556-3227578 CTTCAGCCCCAGACAGGGCAGGG - Intronic
968868290 4:3227590-3227612 CTTCAGCCCCAGACAGGGCAGGG - Intronic
968868300 4:3227624-3227646 CTTCAGCCCCAGACAGGGCAGGG - Intronic
968868310 4:3227658-3227680 CTTCAGCCCCAGACAGGGCAGGG - Intronic
968868320 4:3227692-3227714 CTTCAGCCCCAGACAGGGCAGGG - Intronic
968868330 4:3227726-3227748 CTTCAGCCCCAGACAGGGCAGGG - Intronic
968868340 4:3227760-3227782 CTTCAGCCCCAGACAGGGCAGGG - Intronic
968868350 4:3227794-3227816 CTTCAGCCCCAGACAGGGCAGGG - Intronic
969502001 4:7558981-7559003 GCTGAGGCCCAGATAGGGGCAGG - Intronic
969615720 4:8251620-8251642 GCTGAGGCCCAAAGAGGGGAAGG + Intergenic
969632409 4:8346345-8346367 CCTGAGAGCCAGGCAGCGGGAGG + Intergenic
969703432 4:8780031-8780053 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
970308908 4:14761203-14761225 CCTGACACCTAGACAGGGCTGGG + Intergenic
970494197 4:16609129-16609151 CCTGAGGGCCACACAGGGAAGGG + Intronic
972148446 4:36059469-36059491 CCTGAGTCCCGGACAAGGAAAGG + Intronic
972391680 4:38619503-38619525 CCTCAGAACCAGAAAAGGGAAGG - Intergenic
973218135 4:47694757-47694779 CCTGGGACCCAGCCAGTGGCTGG + Intronic
973381103 4:49321653-49321675 CCTGAGATTCTGAGAGGGGAGGG - Intergenic
976769275 4:88634111-88634133 CCTGAGAGCCACACAGGGCAGGG + Intronic
977461929 4:97336974-97336996 CCTGAGGGCCACACAGGGCAGGG + Intronic
978206066 4:106082846-106082868 CCTGTGATCCACACAGGGAAGGG + Intronic
978579090 4:110214705-110214727 ACTGAGGCCCAGAAAGGTGAAGG - Intergenic
979197924 4:117942035-117942057 CTTGAGAACCACACAGGGAAGGG - Intergenic
979775362 4:124583017-124583039 CCTGAGAGCCACACGGGGCAGGG + Intergenic
980184559 4:129445996-129446018 CCTGAGAGCCACACAGGGCAGGG + Intergenic
980309847 4:131112772-131112794 CCTGAGACTCAGATGGGGCAGGG - Intergenic
981186953 4:141815598-141815620 CCTGAGAGCCACACAGGGCAGGG + Intergenic
981352734 4:143751933-143751955 CCTGAGAGCCACACAAGGCAGGG + Intergenic
981950679 4:150403180-150403202 CCAGAAACACAGGCAGGGGAGGG + Intronic
982109958 4:152044924-152044946 CATGAGACACAGACAGGTCAAGG + Intergenic
983726840 4:170940146-170940168 CCTGAGAGTCACACAGGGCAGGG + Intergenic
984092015 4:175386976-175386998 ACTGAGAGCCACACAGGGTAGGG + Intergenic
984745470 4:183211688-183211710 CCTGAGACACAGAGAAGGGCTGG - Intronic
985705685 5:1400254-1400276 CCTGAGACCCAGAGAGGCCCCGG - Intronic
986140491 5:5025617-5025639 CCCGAGAGCCACACAGGGCATGG + Intergenic
988065505 5:26225846-26225868 CTTGAGACCCAGAGAGGAGCTGG - Intergenic
988065654 5:26227075-26227097 CTGGAGACCCAGACAGGAGCTGG - Intergenic
990333922 5:54753925-54753947 ACTGAGATCCAGACAGGCTAAGG - Intergenic
990509350 5:56476205-56476227 CTTGAGACTCAGACATGGCAGGG - Intronic
990620206 5:57550658-57550680 CCCGAGAGCCACACAGGGCAGGG - Intergenic
992533264 5:77672315-77672337 GCTGAGAGCCAAACAGGAGATGG - Intergenic
993117345 5:83734213-83734235 CCTGAGAGCCACACAGGGAAGGG - Intergenic
995080580 5:108047199-108047221 CCTGAGAGCCACACGGGGCAGGG + Intronic
995666091 5:114544430-114544452 TCTGAGAGCCACACAGGGCAGGG + Intergenic
995960242 5:117830140-117830162 CCTGAGAGCCACACGGGGCAGGG - Intergenic
997584606 5:135036895-135036917 CCTGAGACCCAAAGAGGAGCTGG + Intronic
997661217 5:135590774-135590796 CCTGAGATCCAGACACGCCATGG + Intergenic
997880596 5:137586071-137586093 ACTGAGACACAGAGAGGGTAAGG + Intronic
997885835 5:137629301-137629323 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
998008762 5:138676168-138676190 CCTGAGACTGAGACATGGGAAGG - Intronic
998130053 5:139647276-139647298 CCCCAGACCCAAGCAGGGGAGGG - Intergenic
998154443 5:139776403-139776425 CCTGAGGCCCAGAGAGGAGCAGG + Intergenic
998374220 5:141680710-141680732 ACTGAGGCCCAGAGAGGGGAAGG + Intronic
998391070 5:141787285-141787307 TTTGAGGCCCAGACAGTGGAAGG - Intergenic
999087424 5:148905040-148905062 ACTGAGACACAGAAAGGGGCAGG - Intergenic
999240690 5:150125672-150125694 CCTGAGGCCCAGAGAGGGGCAGG + Intronic
999246974 5:150160242-150160264 ACTGAGGCCCAGAGAGTGGAGGG + Intergenic
999259445 5:150228974-150228996 CCTGACAGCCAGGCAGGGGAAGG + Intronic
999281316 5:150368069-150368091 ACTGAGGCCCAGAGAGGTGAAGG - Intronic
999411192 5:151351218-151351240 ACTGAGGCCCAGATAGGAGAAGG + Intergenic
999428804 5:151508767-151508789 ACTGAGGCCCAGGCAGGGAAAGG - Intronic
999443002 5:151616970-151616992 ACTGAGGCCCAGAGAGGGAAAGG - Intergenic
999596818 5:153214459-153214481 CCTGAGAGCCACATAGGGTAGGG + Intergenic
1000362293 5:160458969-160458991 ACAGAGACCCACACAGAGGAAGG - Intergenic
1000872265 5:166591668-166591690 CCTGAAACCCAGACTGGCCATGG + Intergenic
1001157386 5:169284633-169284655 CCTGAGACCCAAAGAGATGAAGG + Intronic
1001288884 5:170442559-170442581 CCCCAGAGCCAGACAGGGCAGGG - Intronic
1001344219 5:170876184-170876206 CCTGAGAGCCACACAGGGCAGGG - Intronic
1001739198 5:174035760-174035782 CCTGAGAGCTACACAGGGCAAGG - Intergenic
1001757422 5:174181235-174181257 CATGAGACCCAGATAGGGCAGGG - Intronic
1001788734 5:174436692-174436714 CCTGAGAGCCACACAGGGCAGGG + Intergenic
1001826126 5:174746474-174746496 ACTGAGGCCCAGATAGGGGAAGG + Intergenic
1001946576 5:175783816-175783838 CCTGAGAACCAGAAAGCTGATGG + Intergenic
1001950086 5:175810259-175810281 ACTGAGACCCAGAGTGGGGAGGG + Intronic
1002066864 5:176656255-176656277 CCAGACACCCAGGCAGCGGAGGG + Intronic
1002296372 5:178233311-178233333 CCTGAAGCCCAGAAAGGGAAAGG + Intergenic
1002612287 5:180428787-180428809 CCTGAAACCCAAACAGGGCTGGG - Intergenic
1003066896 6:2911419-2911441 CCTGAGACTCAGAAAGGTTAAGG + Intergenic
1004425264 6:15502741-15502763 CCTGAGACCCTGAGAGGGTTTGG + Intronic
1004476054 6:15973267-15973289 CCTGAGACCCAGAGAGCCAATGG - Intergenic
1006184307 6:32171610-32171632 CCTGAGACACAAACTGGGGCAGG + Intronic
1006452414 6:34112752-34112774 CCTGAGCCCCAGGCAAGGGAGGG - Intronic
1007103407 6:39267232-39267254 ACTGAGACCCAGAGAGAGAAGGG + Intergenic
1007493223 6:42240576-42240598 GTTGAGACCCAGAGAGAGGAAGG - Intronic
1007514276 6:42398990-42399012 ACTGAGGCCCATAGAGGGGATGG - Intronic
1007585309 6:42985395-42985417 ACTGAGGCCCCGACAGGGCAAGG + Intronic
1008741480 6:54614677-54614699 CCTGAGAGCGACACAGGGAAGGG + Intergenic
1009370792 6:62899305-62899327 CCTGAGACTCAGACAGGTTAAGG - Intergenic
1009941128 6:70289085-70289107 ACTGGAACCCACACAGGGGAAGG - Intronic
1010083495 6:71888627-71888649 ACTGACACTCAGATAGGGGAGGG + Intronic
1010945526 6:81969804-81969826 CCTGAGAGCCACACAGGGAAGGG + Intergenic
1011520301 6:88197122-88197144 CCTGGGACCCACACAGAGGGAGG + Intergenic
1011558160 6:88589937-88589959 CCTGAGTACCAGAGAGGTGAAGG + Intergenic
1011806013 6:91073327-91073349 CCTGAGATCCAGAGAGCTGATGG + Intergenic
1012594244 6:101022397-101022419 CCTGAGACTCAAGCAGGGGCAGG + Intergenic
1012741251 6:103018750-103018772 CCTGAGAGCCACACAGGGCAGGG - Intergenic
1013196100 6:107846634-107846656 TCTGAGACCCAGGCAGGTCAGGG + Intergenic
1013461424 6:110378462-110378484 CCTGAGAGCCACACAGGGAAGGG + Intergenic
1014084675 6:117329728-117329750 CCTGAGAACCACACGGGGAAGGG + Intronic
1014338609 6:120173232-120173254 CCTGAGCCTGAGATAGGGGAAGG + Intergenic
1014369369 6:120584848-120584870 TCTGAGAGCCACACAGGGAAGGG - Intergenic
1014484845 6:121985462-121985484 CCTGACAGCCACACAGGGCAGGG - Intergenic
1014670405 6:124297518-124297540 CCTGAGAGCCACACGGGGCAGGG - Intronic
1017981189 6:159402170-159402192 CAGGAGAGCCAGAAAGGGGAGGG - Intergenic
1018381180 6:163259789-163259811 CCTGAGACCCAGCCTGGAGAAGG - Intronic
1019299274 7:295435-295457 CCTGGGACCCAGAAAAGGAAGGG + Intergenic
1019332816 7:469253-469275 GCAGAGTCCCAGACAGAGGAAGG - Intergenic
1019446745 7:1075146-1075168 CCTGAGGACCAAACACGGGAGGG + Intronic
1019475664 7:1242908-1242930 GCAGAGGCCCAGAGAGGGGAAGG + Intergenic
1019525979 7:1480754-1480776 ACAGAGACCCAGCCTGGGGAGGG - Intronic
1019525992 7:1480788-1480810 ACAGAGACCCAGCCTGGGGAGGG - Intronic
1019550918 7:1602123-1602145 ACTGGGACCCAGACAGAGGCCGG - Intergenic
1020088243 7:5323114-5323136 CCTGAGACGCACACAGGCGGCGG + Intronic
1020525182 7:9250745-9250767 CCTGAGAGCCACACTGGGCACGG + Intergenic
1020621705 7:10527518-10527540 CCTGAGAGCCACACGGGGAAGGG + Intergenic
1021971735 7:25971467-25971489 TCTGAGACCTAGATAGGAGAAGG - Intergenic
1022418042 7:30195160-30195182 ACTGAGACTCAGAGAGGGGCAGG - Intergenic
1022476060 7:30710669-30710691 AGTGAGGCCCAGAGAGGGGAAGG + Intronic
1022634542 7:32119671-32119693 CCTGAGAGCCACACGGGGCAAGG + Intronic
1023993128 7:45142041-45142063 TCTGAGACCCAGAGAGGGGACGG - Intergenic
1024088769 7:45918780-45918802 ACTAAGACCCAGAGAGGAGAGGG - Intronic
1024230837 7:47362073-47362095 GCTGAGACCCAGAGTGGGGCGGG + Intronic
1024550093 7:50555399-50555421 CCTGGGACCCAGAGAAGGAAAGG + Intronic
1025206030 7:56993815-56993837 CCTGAGACCCAGGTCAGGGAGGG + Intergenic
1025206067 7:56993999-56994021 CCTGAGACGCACACAGGTGGCGG - Intergenic
1025603532 7:63022727-63022749 ACTGAGGCCCAGAAAGGTGAAGG - Intergenic
1025665909 7:63583124-63583146 CCTGAGACCCAGGTCAGGGAGGG - Intergenic
1025968553 7:66299579-66299601 ACTGAGGCCCACACAGGAGATGG - Intronic
1026868760 7:73838296-73838318 ACTGAGGCCCAGAGAGGTGAAGG - Intronic
1026972199 7:74475381-74475403 ACTGGGGCCCAGAGAGGGGAAGG + Intronic
1027050741 7:75019785-75019807 CCTGAGATGCAGGCAGGGGCCGG + Intronic
1027149611 7:75723570-75723592 GCTGAGACCCAGCAAGGAGACGG - Intronic
1029281818 7:99440147-99440169 ACTGAGACCCAAGCGGGGGAAGG + Intronic
1029422061 7:100476969-100476991 GCTGAGACCAAGACAGAAGAAGG + Intronic
1030759265 7:113331350-113331372 CCTGAGAGCCACACCGGGCAGGG + Intergenic
1031653093 7:124315985-124316007 CTTGAGAGCCAGAGAGGTGATGG + Intergenic
1033454008 7:141486235-141486257 ACGGAGACCCAGAAAGGTGAGGG + Intergenic
1033879322 7:145862147-145862169 CCTGAAAGCCACACAGGGCAGGG + Intergenic
1034274273 7:149817220-149817242 AGTGAGCCCCAGAGAGGGGAGGG + Intergenic
1034450985 7:151137212-151137234 GCAGAGGCCCAGCCAGGGGAAGG - Intronic
1034724455 7:153322305-153322327 TCTGAAACACAGACAGGAGAGGG + Intergenic
1034732530 7:153400462-153400484 CCACAGACCCATACTGGGGAAGG - Intergenic
1034820946 7:154215794-154215816 CTGGCGACCCAGAGAGGGGAAGG - Intronic
1035068462 7:156124416-156124438 CCTGAGGCCCAGGGAGGGCATGG - Intergenic
1035196267 7:157223267-157223289 CCTCAGACACAGACAGCGGCGGG - Exonic
1035516067 8:232876-232898 CCTGAGTCCGAGACTGGGGTAGG + Intronic
1035764969 8:2098536-2098558 ACTGAGGCCCAGAGAGGCGACGG - Intronic
1035782516 8:2239662-2239684 GCTGTGCCCCAGAGAGGGGAGGG - Intergenic
1035809604 8:2479926-2479948 GCTGTGCCCCAGAGAGGGGAGGG + Intergenic
1035852569 8:2935292-2935314 CCTGAGTCCCTTGCAGGGGAGGG - Intergenic
1036781680 8:11651980-11652002 ACTGAGGCCCAGAGAGGTGAAGG + Intergenic
1037249654 8:16877422-16877444 CCTGGGAGCCACACAGGGCAAGG - Intergenic
1037479907 8:19294908-19294930 ACTGAGACCCACATAGGGAAGGG + Intergenic
1037884047 8:22586985-22587007 CCTGAGGCCCAGGGAGAGGAAGG - Intronic
1037905657 8:22714665-22714687 TCTGATACCCAGACAGAAGAGGG + Intronic
1037985886 8:23290269-23290291 CCTGAGAGTCAGTCAGGGAAGGG + Exonic
1038331206 8:26610917-26610939 CCTGAGGCCCTGACAGGGTAAGG + Intronic
1038706800 8:29901812-29901834 CCTGAGAGCCACGCAGGGAAGGG + Intergenic
1039265053 8:35815490-35815512 CCTGAGAGCCTCACAGGGCAGGG + Intergenic
1039411662 8:37360078-37360100 ACTGAGGTCCAGAGAGGGGAAGG - Intergenic
1039439900 8:37587973-37587995 ACTGAGACCCAGAGAGGCGAGGG + Intergenic
1039494695 8:37972152-37972174 CCTGAGGCCCAGAGAGGAAATGG + Intergenic
1040552146 8:48445840-48445862 CATTAGTCCCAGGCAGGGGATGG + Intergenic
1040841742 8:51792311-51792333 CCTGGGAGCCACACAGGGCAAGG + Intronic
1041021448 8:53642734-53642756 CCTGAGAGCCACACAGGGCAAGG - Intergenic
1041986693 8:63930502-63930524 CCTGAGACCCACCTAGGGCATGG + Intergenic
1042629870 8:70805163-70805185 CCTAAGAGCCACACAGGGCAGGG + Intergenic
1044356230 8:91225419-91225441 CCTGATAGCCACACAGGGAAGGG - Intronic
1045282535 8:100761551-100761573 ACTGAGACCCAGACAGCTTAAGG + Intergenic
1045501157 8:102745434-102745456 GCTGAGGCCCAGACAGGGTGGGG - Intergenic
1046450422 8:114383331-114383353 ACTGAGGCCCAGAAAGAGGAAGG + Intergenic
1047024634 8:120812082-120812104 GGAGAGACCGAGACAGGGGAGGG + Intronic
1047366395 8:124215551-124215573 CCTCAAACCCTGCCAGGGGAAGG - Intergenic
1047436511 8:124839429-124839451 CCTGAAGGCCAGACAGGGTAAGG + Intergenic
1047511646 8:125520427-125520449 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1047704905 8:127488569-127488591 GCTGAGACTCAGAAAGGGGGAGG + Intergenic
1047997923 8:130354541-130354563 GCTGTGACCCAGACAGTAGAAGG - Intronic
1049097923 8:140559670-140559692 CCTCAGGCCCAGACACGGGCAGG + Intronic
1049189117 8:141276832-141276854 CCTGAGGCCCAGACAGCGCTGGG + Intronic
1049203009 8:141350985-141351007 ACTGAGGCCCAGAGAGGGGCAGG + Intergenic
1049223882 8:141440552-141440574 ACTGAGCCCCAGAAAGGGAAAGG + Intergenic
1049399022 8:142416575-142416597 CCAGGGACCCAGACAGGGCTGGG + Intergenic
1049583234 8:143422022-143422044 CCTGGGTCCCAGCCAGGAGACGG + Intronic
1049622345 8:143604331-143604353 CCTGGGAACCAGGCAGGGGAGGG + Exonic
1049624034 8:143612157-143612179 CCTGAGAGCCACAGAGAGGAGGG + Intergenic
1050359807 9:4819151-4819173 CCTCAACCCCAGACAGGGCAGGG + Intronic
1050630006 9:7549147-7549169 CCTGAGAGCCACACAGGGCAGGG + Intergenic
1051036089 9:12747121-12747143 CCTGAGAGCCACACGGGGAAGGG - Intergenic
1051682633 9:19623286-19623308 CCAGAAGGCCAGACAGGGGAAGG - Intronic
1052851360 9:33380383-33380405 ACTGAGGCCCAGAGAGTGGAGGG + Intergenic
1052964586 9:34329921-34329943 ACTGAGGCCCAGGGAGGGGAAGG - Intronic
1053267859 9:36728875-36728897 AGTGAGGCCCAGACAGGGGAAGG - Intergenic
1053289103 9:36868377-36868399 CCTCAGACGCAGCCAGGAGACGG + Intronic
1053307206 9:36993532-36993554 ACTGAGGCCCAGACAGAGAAAGG + Intronic
1053451988 9:38201359-38201381 ACTGAGGCCCAGACACAGGAAGG + Intergenic
1055452122 9:76440543-76440565 CCTCAGCCCCACACAGGGCAGGG - Intronic
1056320593 9:85431218-85431240 ACTGCGACCCTGACAGGGGAGGG + Intergenic
1056382591 9:86068525-86068547 CCTGAGACCTGGGCAGGGGCAGG - Intronic
1057017058 9:91661766-91661788 CCTGGGACCAAGACAGCGGCAGG - Intronic
1057203449 9:93156303-93156325 CCTGACACCCAAACAGCAGATGG + Intergenic
1057241739 9:93417332-93417354 CCTGGGAGCCACACAGGGCAAGG - Intergenic
1057277920 9:93686049-93686071 CAGGAGACCTAGACAGGGCAGGG - Intergenic
1057741848 9:97718924-97718946 ATTGAGACCCAGACTGGGAAAGG - Intergenic
1057748691 9:97772595-97772617 ACTGAGGCTCAGAGAGGGGAAGG + Intergenic
1057802596 9:98199238-98199260 ACTGAGGGCCAGAGAGGGGAAGG + Exonic
1057836673 9:98451071-98451093 ACTGAGACTCAGAAAGGGGTGGG - Intronic
1057838978 9:98469756-98469778 CCTAAGAGCCAGAGAGGGGAAGG - Intronic
1057850102 9:98559022-98559044 ACCGAGGCCCAGAAAGGGGAAGG - Intronic
1057892917 9:98882690-98882712 CCTGAGGCCCAGAGAGGGTCAGG + Intergenic
1057904525 9:98973944-98973966 CCTGAGGCTCAGAGAAGGGAAGG + Intronic
1057936246 9:99241530-99241552 ATTGAGGCCCAGAGAGGGGAAGG + Intergenic
1058374218 9:104304806-104304828 CCTGAGAGCCACACGGGGAAGGG + Intergenic
1058590948 9:106565108-106565130 CCTGAGAGCCACACAGGGCAGGG + Intergenic
1058680032 9:107432577-107432599 ACTGAGGCCCAGAGAGGGGAAGG - Intergenic
1059346422 9:113631999-113632021 CATGAGACCCAGAGAGGCAAAGG - Intergenic
1059433255 9:114262265-114262287 ACTGAGGCCCAGAGAGGAGATGG + Intronic
1059516731 9:114902815-114902837 CCTGAGTTCCAGGGAGGGGAAGG + Intronic
1059739232 9:117133468-117133490 ACTGAGGCCCAGAGAGTGGAAGG + Intronic
1059964674 9:119601967-119601989 ACTGAGGCCCAGGAAGGGGAAGG - Intergenic
1060022725 9:120146227-120146249 ACTGAGACCCAGGCAGGTTAAGG - Intergenic
1060072814 9:120565179-120565201 TCTGAAGCCCAGACAGGGGTAGG - Intronic
1060279428 9:122206042-122206064 ACTGAGACCCATGGAGGGGAAGG - Intronic
1060298109 9:122356668-122356690 ACTGAGACCCAGAGACTGGAGGG - Intergenic
1060321202 9:122562569-122562591 CCTGAGAGCCACACAGGGCAGGG - Intergenic
1060490278 9:124079120-124079142 ACTGAGGCCAAGACAGGGGCAGG - Intergenic
1060519435 9:124285968-124285990 ACTGAGGCCCAGAGAGGGCAAGG + Intronic
1060596115 9:124850064-124850086 TGTGAGTACCAGACAGGGGAGGG + Intergenic
1060606066 9:124915094-124915116 TGTGAGACCCAGACTCGGGAGGG - Intronic
1060776767 9:126380327-126380349 CCTGTGACCTAGACTGGGGCTGG - Intronic
1060815776 9:126634395-126634417 CCTGATACCCACACAGGGCGTGG - Intronic
1060870657 9:127037363-127037385 CCTGAGACCCAAAGAGAGGAGGG - Intronic
1060881796 9:127122777-127122799 CCTCAGCCCCAGACAGAGGCGGG + Exonic
1060976780 9:127769822-127769844 ACTGAGACTCAGAGAGGGGAAGG - Intronic
1061077889 9:128352895-128352917 GCTGAGACCCGGAGAGGGAAAGG + Intronic
1061089843 9:128420578-128420600 CCGGAGGACCGGACAGGGGAGGG - Exonic
1061141242 9:128768475-128768497 ACTGAGGCCCAGAGAGGAGATGG + Intronic
1061151056 9:128828582-128828604 ACTGAGGCCCAGAGAAGGGAGGG - Intronic
1061211387 9:129195410-129195432 ACTGAGGCCCAGAGAGGGGGGGG + Intergenic
1061374711 9:130217110-130217132 ACTGAGGCTCAGACAGGTGAGGG + Intronic
1061488345 9:130931709-130931731 ACTGAGGCCCAGAGAGGGCAAGG + Intronic
1061499451 9:130993642-130993664 CCTGAGGCCCAGAGAGGGGAAGG + Intergenic
1061513857 9:131077118-131077140 CCTGGGGCCCAGACAGGGATGGG + Intronic
1061765032 9:132876179-132876201 GCTGAGGCCCAGAGAAGGGAAGG - Intronic
1061766396 9:132884161-132884183 ACTGGGGCCCAGAGAGGGGAAGG + Intronic
1061871731 9:133524518-133524540 ACTGAGGTCCAGATAGGGGAAGG + Intronic
1062021143 9:134319958-134319980 GCTGAGACGCAGGGAGGGGAGGG - Intronic
1062052706 9:134455835-134455857 CCTGAGGCACAGGCAGGGAAGGG - Intergenic
1062322386 9:135996766-135996788 CCTGAGCCCCACACAGAGGCTGG - Intergenic
1062389646 9:136328785-136328807 CCTGGGCCCCACGCAGGGGAGGG + Intronic
1185846376 X:3441470-3441492 CCTGAGAGTCACACAGGGAAGGG - Intergenic
1186321071 X:8426177-8426199 CTTGGGACCCAGGCAGTGGAGGG + Intergenic
1186744897 X:12557375-12557397 CCCTAGATCCAGACAAGGGAAGG + Intronic
1188037823 X:25338295-25338317 CCTGAGAGCCACACAGGGAAGGG - Intergenic
1189296259 X:39920409-39920431 ACTGAGACCCAGACAGGGGAGGG + Intergenic
1189705550 X:43755780-43755802 CCTGAAACCCAGACTGAGGATGG - Intergenic
1190879887 X:54484563-54484585 ACTAAGACCCTGAGAGGGGAAGG + Intronic
1190924304 X:54888232-54888254 CCTGAGAGCCACACAGGGCAGGG + Intergenic
1191776786 X:64823144-64823166 ACTGAGGCCCAGAGAAGGGAAGG + Intergenic
1191841167 X:65514383-65514405 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
1191842715 X:65524584-65524606 ACTGAGGTCCAGAGAGGGGAAGG - Exonic
1192026259 X:67456336-67456358 CCTGATAGCCACACAGGGCAGGG + Intergenic
1192036493 X:67568366-67568388 ACTGAAACCCAGACAGGGAAGGG + Intronic
1192145270 X:68678020-68678042 ACTGAGACCCAGAAAAGGGAAGG + Intronic
1192203272 X:69080770-69080792 ACTGAGGCCCAGAGAGGTGAAGG - Intergenic
1192205243 X:69091477-69091499 GCTGAGAACCAGAGTGGGGAAGG - Intergenic
1192213768 X:69143757-69143779 TCTGAGGCCCAGGGAGGGGAAGG + Intergenic
1192226755 X:69233983-69234005 ACTGAGGCCCAGAAAGGGAAAGG - Intergenic
1192233833 X:69283982-69284004 CCTGATACCTAGGCAGGTGAGGG - Intergenic
1192437698 X:71153135-71153157 CCAGAGACCCTCTCAGGGGAAGG - Intronic
1193039217 X:76987246-76987268 CCTGAGAGCCACACAGGGAAGGG + Intergenic
1193058065 X:77175709-77175731 ACTGAAACCCAGAAATGGGAAGG - Intergenic
1193090998 X:77494064-77494086 CCTGAGAGCCACACGGGGCAGGG + Intergenic
1193902990 X:87205633-87205655 TCTGAGACCCTCCCAGGGGATGG + Intergenic
1194193420 X:90864821-90864843 CCTGGGAGCCACACAGGGCAAGG + Intergenic
1194851874 X:98880718-98880740 CCTGAGAGCCACACAGGGCAGGG + Intergenic
1195002055 X:100651340-100651362 TTTGAGAACCAGAAAGGGGAGGG + Intronic
1195153335 X:102097028-102097050 CCTGAGAGCCACACAGGGAAAGG + Intergenic
1195417921 X:104641039-104641061 CCTGAGCCACAGACAAGGCATGG + Intronic
1195898974 X:109777859-109777881 CCAGAGATCCAGACAGAGCATGG + Intergenic
1195979448 X:110561659-110561681 CCTGAGAGCCACACGGGGCAGGG - Intergenic
1196517356 X:116629012-116629034 CCTGAGAGCCACACAGGGAAGGG - Intergenic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1197049652 X:122042906-122042928 CCTGAGATCCATAAAGGGCAGGG - Intergenic
1198051997 X:132959100-132959122 ACTGAGGCCCAGAGAGGGGTAGG + Intronic
1198133598 X:133724634-133724656 ACTGAGACCCAGAGAAGAGAAGG - Intronic
1198313086 X:135438739-135438761 CCTGTGCCCGGGACAGGGGAGGG + Intergenic
1198769052 X:140109019-140109041 TCAGAGGCCCAGATAGGGGAAGG + Intergenic
1198845584 X:140906938-140906960 CCTGCCACCCAGACATGGGATGG - Intergenic
1199649551 X:149939081-149939103 CCTGAGAACCAGCGCGGGGAGGG + Intergenic
1199701241 X:150377271-150377293 CGTGAGGCCCAGAGAGGGGAAGG - Intronic
1199710807 X:150467790-150467812 TCTGAGACCCAGAGAGGGGCAGG - Intronic
1199807273 X:151312751-151312773 ACTGAGGCCCAGAAAGGGTAAGG - Intergenic
1199815609 X:151394472-151394494 ACTGCGGCCCAGAGAGGGGACGG - Intergenic
1199880767 X:151973081-151973103 ACTGAGGCCCAGATAGAGGAAGG + Intronic
1199940287 X:152619629-152619651 CCTGAGGCCCAGGCAAGGGTGGG + Intergenic
1199967373 X:152831313-152831335 ACTGAGACCCGGAGAGGGGAAGG + Intronic
1200249729 X:154546607-154546629 CCTGAGACCCCGAGAGCGAAGGG - Intronic
1200540031 Y:4447208-4447230 CCTGGGAGCCACACAGGGCAAGG + Intergenic
1200760286 Y:7031883-7031905 CCAAAGACACAGACAGTGGAAGG + Intronic
1200818126 Y:7554902-7554924 CCTGAGAGTCACACAGGGAAGGG + Intergenic
1201411772 Y:13705433-13705455 CCTGCCAGCCAGACAGGCGATGG - Exonic