ID: 927882223

View in Genome Browser
Species Human (GRCh38)
Location 2:26696872-26696894
Sequence CTGAACAAGTAGAAGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927882223 Original CRISPR CTGAACAAGTAGAAGGAGTA GGG (reversed) Intronic
901881053 1:12194049-12194071 CTGAACAAGTGGATGAAGGAAGG - Intronic
905845836 1:41230704-41230726 CTGAACAAATAGATGAATTAGGG + Intronic
908152683 1:61319731-61319753 CTGAAGAAGTAGAATGGATATGG + Intronic
909270299 1:73615584-73615606 CTGAACTTGTAGAATGAGTTTGG + Intergenic
909328613 1:74385032-74385054 CTGATCAATTAGGAGGAGTGAGG - Intronic
911241223 1:95469796-95469818 CTGATCAAGCAGAAGAATTAGGG - Intergenic
912024490 1:105150770-105150792 CTGAACAAAAAGAAAGAATATGG + Intergenic
914926395 1:151892251-151892273 AGGAGCAAGTAGAAGGAGGAGGG + Intronic
915610243 1:156986168-156986190 CTTAACCTGGAGAAGGAGTAAGG + Exonic
916222833 1:162461673-162461695 CTCAACAAGTAGAAGAAATTAGG + Intergenic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
921451723 1:215316354-215316376 CAGAACAAGAAGGAGGAATAGGG + Intergenic
921752669 1:218815243-218815265 CTGAGCCAGTAGAAGGAACATGG + Intergenic
921879846 1:220243572-220243594 CTGAAAAAGTAGATGGAAGATGG - Intronic
922044670 1:221932995-221933017 CTGAACTTGTAGAATGAGTTTGG - Intergenic
922800787 1:228363941-228363963 CCAAACAAGGAGAAGGAGAAGGG - Intronic
1063277536 10:4587498-4587520 CTGAACAAGAAGAAGGTCTCTGG - Intergenic
1063980107 10:11445850-11445872 CTGAACAAGTCAAAGTGGTAAGG - Intergenic
1064005687 10:11697117-11697139 CTGAACAACCAGAAGGATGAAGG - Intergenic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1067365081 10:45619524-45619546 AAGAACAAGTGGAAGGAGTGAGG + Intronic
1070052094 10:72899217-72899239 CTGAAGAAATAGAAGGGGAAAGG + Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1072507697 10:96085349-96085371 TTGAACATGTAGAAAAAGTAGGG + Intergenic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1074349452 10:112721750-112721772 ATGAACAAGTAGAAGTTATAGGG + Intronic
1074677307 10:115866256-115866278 CTGAACAATTATAAGGAGTGGGG + Intronic
1078361005 11:10667553-10667575 CTGGACATGTAGAATGAATAGGG - Intronic
1079573376 11:21972665-21972687 CTGAACAAGTACAAGGTACAAGG + Intergenic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1080290546 11:30666053-30666075 TAGAACAAGAAGAAGGAGAAGGG + Intergenic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1088367943 11:109058580-109058602 CTCACCAAGTAGAGGGAGCAGGG - Intergenic
1089089720 11:115861209-115861231 AAGAAAAAGTAGAAGGAGTAAGG + Intergenic
1090235354 11:125142824-125142846 ATGGACAAGGGGAAGGAGTAAGG + Intergenic
1090737541 11:129623310-129623332 AGGAACAAGTAGAAAGAGAAAGG - Intergenic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1095424369 12:42059788-42059810 TTGAATCAGTAGAATGAGTAAGG + Intergenic
1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG + Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1104226859 12:126843475-126843497 TTGAACAAGTTAAAGGAGGAAGG - Intergenic
1110584350 13:77170923-77170945 CTAAACAACTAGATGGAGAATGG + Intronic
1113308066 13:109099759-109099781 CAGAGCAAGTAGTGGGAGTATGG - Intronic
1114402305 14:22421056-22421078 CTGCAGAAGCAGAAGGACTATGG - Intergenic
1114574167 14:23697326-23697348 CTGACCAAGTAGTATGTGTACGG - Intergenic
1116416874 14:44688627-44688649 CTGAAAAAATGGAGGGAGTATGG + Intergenic
1116464831 14:45219759-45219781 GTGAACAACTAGAAGGACTTGGG + Intronic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1119705368 14:76779732-76779754 CTGAGCAAGTAGACGCAGTTAGG - Exonic
1119931225 14:78549345-78549367 GTGAACAAAGAGAAGGAGAAGGG - Intronic
1120242920 14:81971001-81971023 CTGAAAGAGTTGAAGGAGTTAGG - Intergenic
1124521295 15:30408227-30408249 CTGAACATATAGAAGGAGAGAGG - Exonic
1124537367 15:30557990-30558012 CTGAACATATAGAAGGAGAGAGG + Exonic
1124761288 15:32449597-32449619 CTGAACATATAGAAGGAGAGAGG - Exonic
1124777346 15:32599466-32599488 CTGAACATATAGAAGGAGAGAGG + Exonic
1124959491 15:34383785-34383807 CTGAACAAATAAAAGGAGAGAGG - Exonic
1124976117 15:34530006-34530028 CTGAACAAATAAAAGGAGAGAGG - Exonic
1125112376 15:36048039-36048061 CTGAAAAAGTAAAAACAGTAAGG - Intergenic
1126337235 15:47599461-47599483 CTCAAAAAGTAGATGGAGTTTGG + Intronic
1127487878 15:59436385-59436407 CTCAAGTAGTAGAGGGAGTAGGG + Intronic
1128647253 15:69386909-69386931 CTGACTCAGGAGAAGGAGTAGGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129772491 15:78211734-78211756 CTGGCAAGGTAGAAGGAGTAAGG - Intronic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1133185441 16:4093826-4093848 CTGAACAAGTAATAGCAGCAAGG - Intronic
1133343045 16:5050623-5050645 CTGAACTTGTAGAATGAGTTGGG - Intronic
1136776200 16:32873108-32873130 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1136894415 16:33988404-33988426 ATGGACAAGAAGAAAGAGTAAGG - Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1203078615 16_KI270728v1_random:1135217-1135239 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1143566422 17:7723971-7723993 CTGAACAAGTTGAATGAGCTGGG + Intronic
1143871298 17:9958968-9958990 GTGAACAAGTGGAAGGAGGATGG - Intronic
1144802567 17:17940577-17940599 CTGAACAAAGAGCAGGAATAAGG + Intronic
1146620343 17:34392143-34392165 CTGAATAAGGTGCAGGAGTAGGG - Intergenic
1148390295 17:47267398-47267420 CTGAACGTGTGGAAGGAGTTTGG - Intronic
1152783745 17:82237644-82237666 CTGAAGAGGTAGACGGAGTAGGG - Exonic
1159924692 18:74257521-74257543 ATGAACAAGGAGAAAGAATATGG + Intronic
1160099587 18:75907630-75907652 CTGAACAACCACAAGGGGTAAGG + Intergenic
1161355175 19:3814995-3815017 CTGGAAAAGTCAAAGGAGTAAGG + Intronic
1163946695 19:20543521-20543543 TTGTACAAATAGAAGGAATATGG - Exonic
1164423291 19:28116802-28116824 CTGAACAAGTGGAAGGGGCAGGG - Intergenic
1165194966 19:34094699-34094721 CAGAGCAAGTTAAAGGAGTAGGG - Intergenic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1167786630 19:51643206-51643228 GGGAATAAGTAGAAGGGGTATGG + Exonic
925112851 2:1351537-1351559 CTGAACAGGTAGAAGAAAGAGGG + Intronic
925523633 2:4775752-4775774 CTGAACAAGGAGAAGGTATAAGG + Intergenic
926033346 2:9612594-9612616 CTGGACCAGTAGGAGGAGTGTGG + Intronic
926922768 2:17955685-17955707 CTGAACCTGTAGAAAGAGCATGG - Intronic
926980625 2:18563384-18563406 CTTCAAAGGTAGAAGGAGTATGG - Exonic
927628889 2:24753466-24753488 TTCAACAAGGAGTAGGAGTAGGG - Intronic
927882223 2:26696872-26696894 CTGAACAAGTAGAAGGAGTAGGG - Intronic
928071196 2:28219177-28219199 CTGAACAACCTGAAAGAGTAAGG - Intronic
930196123 2:48512205-48512227 CTGGGCAAGCAGAAGGATTATGG - Intronic
934117525 2:88811163-88811185 CTGAACAAGTACCAGGAGCAAGG + Intergenic
936161126 2:110084899-110084921 CTGAACAAGTACCAGGAACAAGG + Exonic
936183537 2:110286455-110286477 CTGAACAAGTACCAGGAACAAGG - Intergenic
936444698 2:112586411-112586433 CTGAACAACCAGAAGGATGAAGG - Intronic
936601101 2:113895443-113895465 ATGAACAAGAATTAGGAGTATGG + Intronic
937691031 2:124755465-124755487 CTGATCAAGAAGAAGTTGTAAGG - Intronic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
940033976 2:149293969-149293991 CTGAAGGATTAGAAGGAGCAGGG + Intergenic
940076851 2:149751413-149751435 CTGAACAAGGAGTTGGAGTGGGG - Intergenic
940670157 2:156657699-156657721 CTGTACAGGGAGAAGGAGAAGGG + Intergenic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941950827 2:171154677-171154699 ATGAAGTAGTAGAAGCAGTATGG - Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942966503 2:181900142-181900164 CTCAGGAAGTAGGAGGAGTAAGG - Intronic
943457018 2:188120664-188120686 CTGAATAAGTGGAAGGATTCTGG + Intergenic
944270225 2:197775097-197775119 CTTAATAAGTAGAAAGAGTGAGG + Intronic
944758308 2:202786784-202786806 ATGAACAAGTAGAAACAATAAGG + Intronic
944777509 2:202981962-202981984 CCGAACAAATAAAAAGAGTATGG - Intronic
945406236 2:209452221-209452243 CTCTACAAGTAGACAGAGTAGGG + Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
948085497 2:235243388-235243410 TTGAACAGGCAGAAGGACTAAGG + Intergenic
948799055 2:240422319-240422341 CTGAAAAAGTATTAGAAGTAAGG + Intergenic
1169284656 20:4297846-4297868 CTGAACAAGGAGAAAAAGTCAGG - Intergenic
1177216020 21:18130042-18130064 CGGAGCAAGGAGAAGGAATAGGG + Intronic
1178178061 21:30128053-30128075 CGGAACAATGAGAAGGAGAATGG + Intergenic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1184220139 22:43094660-43094682 CTGAGCACCTAGAAGGATTAGGG + Intergenic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
949179885 3:1116180-1116202 GTCAACAAGGAGAAGGATTAAGG + Intronic
951140720 3:19155426-19155448 CTGAACAAGTGGGAGTAGAAGGG - Intronic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
953735459 3:45490433-45490455 TTCAATAAGTAGAAGGAGAATGG + Intronic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
955165496 3:56507053-56507075 CTGAACTTGTAGAATGAGTTTGG - Intergenic
956226743 3:66968666-66968688 CTGAAGAAATATAAGGAATAGGG - Intergenic
959554285 3:107698961-107698983 GTGAACAAGGAAAAGGACTATGG + Intronic
961379980 3:126490746-126490768 CTGACTAAAGAGAAGGAGTAGGG + Intronic
962365588 3:134777335-134777357 CTGATCAAGGAGAAGAAATAAGG - Intronic
964414673 3:156434793-156434815 CTGAGAAAGAAGAAGGAGTTGGG + Intronic
965413338 3:168360483-168360505 GTGAAAAACTAAAAGGAGTAAGG - Intergenic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
967495620 3:190142054-190142076 GTGGACAACTAGAAGGAGAAGGG - Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
973859778 4:55051713-55051735 CTAAACAATTAGAAGGAGGAAGG + Intergenic
974985354 4:69017698-69017720 CTGAACAATAAGCAGGAATAGGG - Intronic
975979637 4:80142892-80142914 CTTAAAATGTAGAAAGAGTAGGG - Intergenic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
976813035 4:89117653-89117675 CTAGCCAAGCAGAAGGAGTAGGG + Intergenic
981513514 4:145583026-145583048 CTGAACCACTGGAAGGAGTTTGG - Intergenic
982001144 4:151022378-151022400 CTGAACAAATAAAAGGAATATGG - Intergenic
982612321 4:157591084-157591106 TGGAACAAGAAGAAGGAGTATGG + Intergenic
982875913 4:160649412-160649434 ATAAACAAGTAAAAGCAGTAAGG + Intergenic
983352901 4:166616333-166616355 ATCAACAACTAAAAGGAGTATGG + Intergenic
986287264 5:6368984-6369006 TTGAACAAGTGGAAGATGTATGG + Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
989793350 5:45434621-45434643 CTGAACAATGACAAAGAGTATGG + Intronic
993132123 5:83912101-83912123 CTGAATAATTAGAAGGAAAAAGG - Intergenic
993906504 5:93629845-93629867 TTTAACAAGAAAAAGGAGTATGG + Intronic
998084643 5:139309178-139309200 CTGAAAAAGTTGAAAGAGAAAGG - Intronic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
999523102 5:152372903-152372925 CTGAACAAATAGAAGCAGGGGGG + Intergenic
999643421 5:153694961-153694983 ATGAACAAGAAGGAGGAGAAAGG + Intronic
999942923 5:156563911-156563933 CTGAAGAACTTGAGGGAGTAGGG - Intronic
1001189627 5:169616806-169616828 CTGACCATGTAGAATGAGTTAGG - Intergenic
1001763330 5:174225302-174225324 CTGTACAAGTAAAAGAAGCACGG - Intronic
1002767185 6:252167-252189 CTGAACAATTCTAAGGAGGAAGG - Intergenic
1003494669 6:6653722-6653744 CTGAGCAACTGGAAGGAGAAAGG - Intronic
1003790992 6:9547479-9547501 CTCCAGAAGTAAAAGGAGTAAGG - Intergenic
1005211641 6:23472245-23472267 CAGGTGAAGTAGAAGGAGTATGG + Intergenic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1010137000 6:72566591-72566613 TTAAACAAGTAGAAGAAGTTAGG + Intergenic
1010356001 6:74934351-74934373 GTGAACTAGTAGAAAGAGTGAGG + Intergenic
1011350957 6:86423342-86423364 CTGAACAAGTAGAACCTGTAGGG - Intergenic
1012283709 6:97362666-97362688 CAGAACAGGTACAAGGAGTTTGG + Intergenic
1013376361 6:109518964-109518986 CAGAACACCTAGAAGGAGGAGGG - Intronic
1014503097 6:122217780-122217802 CTGAAAAAGTAGAAAGTGAATGG - Intergenic
1014681413 6:124435160-124435182 CTGGATAACTAGAAGGAATATGG + Intronic
1014883765 6:126754951-126754973 CTGAACAAGAGGAAAGAGAATGG + Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1017007849 6:150040861-150040883 CTTAACAGGAGGAAGGAGTAGGG + Intergenic
1018564566 6:165137619-165137641 CAGAGCAAGAGGAAGGAGTAGGG - Intergenic
1018651574 6:165996493-165996515 CTGAACAAGAAGCAGGACTGGGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1021054129 7:16026140-16026162 TTGAAAAAGTTGAAGGTGTAAGG - Intergenic
1023578723 7:41658274-41658296 CTGAGTAAGTACCAGGAGTAGGG - Intergenic
1026777142 7:73237602-73237624 CTGAACAAGCAGAAGGGGTGAGG - Intergenic
1027017988 7:74790974-74790996 CTGAACAAGCAGAAGGGGTGAGG - Intergenic
1027070036 7:75154953-75154975 CTGAACAAGCAGAAGGGGTGAGG + Intergenic
1028519931 7:91718626-91718648 CTGAAGAAGAAGAAGGATAATGG - Intronic
1030995363 7:116352903-116352925 GTCAAGAAGTAGAAGGAGCATGG - Intronic
1040011501 8:42664869-42664891 CTGAGAAAGTAGCAGGATTAAGG - Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1042541692 8:69913749-69913771 CTGAACAAGTCTAAGGATAATGG + Intergenic
1043805077 8:84661966-84661988 CTGGACAACTATAAGAAGTATGG - Intronic
1044439927 8:92210947-92210969 CTGAACAAGAAGAAGAAGAATGG - Intergenic
1044623206 8:94211049-94211071 CTGAACAAGTGAAAGGACTTGGG + Intronic
1046840317 8:118849140-118849162 CTAAGCTATTAGAAGGAGTAGGG + Intergenic
1047326385 8:123840726-123840748 CTCAACAAATAAAAGGATTAAGG + Intergenic
1050933743 9:11366677-11366699 CTGAACATGTGGTAGGAGTTTGG + Intergenic
1051602130 9:18885805-18885827 CTGAACAAGTAGCAGGTATGGGG + Intronic
1052210005 9:25892915-25892937 CTGATTAAGTATAAGGAGTAAGG + Intergenic
1052389559 9:27863203-27863225 CTTAAGCAGTAGATGGAGTAAGG - Intergenic
1053603883 9:39637412-39637434 CAGAACAATTAAAAGGACTAAGG + Intergenic
1053861700 9:42393459-42393481 CAGAACAATTAAAAGGACTAAGG + Intergenic
1054249658 9:62705002-62705024 CAGAACAATTAAAAGGACTAAGG - Intergenic
1054563768 9:66739534-66739556 CAGAACAATTAAAAGGACTAAGG - Intergenic
1056069115 9:82967576-82967598 ATGAAAAAGAAGATGGAGTAAGG - Intergenic
1056218455 9:84428012-84428034 ATGCAAAAGTAGAAGGAATAGGG + Intergenic
1056839381 9:89986265-89986287 GTGAACAAGTGGAGGGAGCATGG - Intergenic
1058035904 9:100252531-100252553 CTGCACAAGTACAAGGATGAAGG + Intronic
1058791966 9:108456657-108456679 GTGAACAAGTACAGGGAGTCTGG + Intergenic
1060886105 9:127153676-127153698 CTGACCAATTAGAAGAAGCAAGG - Intronic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1187495846 X:19794845-19794867 CTGAATGAATGGAAGGAGTAAGG - Intronic
1190002626 X:46704117-46704139 CTGATCAAGTAGACAGGGTAGGG - Intronic
1190525192 X:51322105-51322127 CTAAGCAAGTAAAAGGAGTGAGG + Intergenic
1190912161 X:54782828-54782850 CTGACCATGTAGAATGAGTTTGG - Intronic
1192292332 X:69810898-69810920 CTGGACATTTAAAAGGAGTAAGG + Intronic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1192724780 X:73737691-73737713 CTGACCTTGTAGAATGAGTAAGG + Intergenic
1193423010 X:81307377-81307399 CTGAATGAGGAGAAAGAGTAAGG - Intergenic
1194685716 X:96911568-96911590 CTTTCCAAGTAGAAGGATTAAGG - Intronic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1196100099 X:111838869-111838891 TTCAAAAAGTAGAAAGAGTATGG + Intronic
1197779109 X:130141977-130141999 CTTAACCATAAGAAGGAGTAGGG - Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1202364835 Y:24152002-24152024 CTGAAAAAGTATTAGGATTATGG + Intergenic
1202505946 Y:25518120-25518142 CTGAAAAAGTATTAGGATTATGG - Intergenic